SlideShare une entreprise Scribd logo
1  sur  63
BIOLOGIE MOLÉCULAIRE 2023/2024 (S6)
Préparé et présenté par Pr. Nihal Abitiu
Université Ibn Tofail de Kenitra
Ecole Supérieure de l’Education et de la Formation (ESEF)
Licence d’éducation : Spécialité Enseignement
Secondaire- Sciences de la vie et de la terre
‫التربية‬ ‫في‬ ‫اإلجازة‬
:
‫الثانوي‬ ‫التعليم‬ ‫تخصص‬
-
‫واألرض‬ ‫الحياة‬ ‫علوم‬
Biologie
moléculaire
1ère partie
Descriptif du module
N° d’ordre du module M34
Intitulé du module
BIOLOGIE MOLECULAIRE
Nature du module Disciplinaire
Langue FRANÇAIS
Semestre d’appartenance du
module
S6
Etablissement dont relève le
module
ESEF DE KENITRA
1ère partie
1.1. COMPÉTENCES ET OBJECTIFS DU MODULE
 COMPÉTENCES VISÉES
Au terme du module de Biologie moléculaire, les étudiants s’approprient les savoirs et savoir-faire liés à la
réplication du DNA, à l’expression de l’information génétique et au génie génétique et seront en mesure de les
réinvestir pour résoudre des problèmes scientifiques liés à ce contenu.
 OBJECTIFS
Au terme de ce module, l'étudiant sera en mesure de :
 Expliquer le processus de réplication du DNA chez les procaryotes et les eucaryotes ;
 Expliquer les étapes de l’expression de l’information génétique ;
 Expliquer les mécanismes moléculaires de régulation de l’expression de l’information génétique, chez les
procaryotes et les eucaryotes ;
 Dégager les voies moléculaires d’adressage des protéines ;
 Extraire et visualiser le DNA à partir de cellules végétales ;
 Expliquer les outils et les processus du génie génétique, ainsi que ses applications.
Descriptif du module
1ère partie
Descriptif du module
1.2. PRÉ-REQUIS PÉDAGOGIQUES
AVOIR DES CONNAISSANCES DE BASE EN RELATION AVEC LES MODULES SUIVANTES:
M01: Biologie cellulaire (S1)
M15: Génétique (S3)
M16: Biochimie (S3)
M17: Microbiologie (S3)
M21: Biochimie métabolique (S4)
1.3. VOLUME HORAIRE
Composante(s) du
module
Volume horaire (VH)
Cours TD TP
Activités
Pratiques
Travail
personnel
Evaluation
(évaluation des
connaissances et
examen final)
VH
global
26h 8h 12h 4h 50 h
VH global du module 26h 8h 12h 4h 50 h
% VH 52% 16% 24% 8% 100%
1ère partie
Descriptif du module
1.4. DESCRIPTION DU CONTENU DU MODULE
Fournir une description détaillée des enseignements et/ou activités pour le module : Cours, TD, TP (Tavaux du
laboratoires, table ronde, séminaires,), Activités Pratiques (Travaux de terrain, Stages, …).
Pour le cas des Licences d’Education, se conformer au contenu des filières types nationales.
Cours :
Partie 1 :Initiation aux techniques usuelles de biologie moléculaire
1. Méthodes d’étude des Acides nucléiques (extraction et purification)
2. Séparation des acides nucléiques et électrophorèse (Southern ou Northern blots)
3. Enzymes de restriction
4. Vecteurs de clonage (plasmides)
5. Marquage des acides nucléiques
6. Amplification par PCR
7. Séquençage du DNA
1ère partie
1ère partie
Partie 2 :Information génétique et Dogme Central
1. Acides nucléiques et matériel génétique
2. Réplication et réparation du DNA chez les procaryotes et les eucaryotes
3. Transcription et régulation de l’expression des gènes chez les procaryotes : RNA polymérase (a2bb's),
définition du promoteur et des éléments de régulation Initiation, élongation et terminaison (facteur Rho),
Contrôle de la transcription: opéron
4. Transcription et régulation de l’expression des gènes chez les eucaryotes : Transcription par la RNA pol II:
initiation, élongation, terminaison, promoteur, facteurs de transcription, Régulation de la transcription,
transduction du signal, Epissage du mRNA, capping et polyadénylationTranscriptomique, micro-arrays
Transcription par la RNA pol I Transcription par la RNA pol III
5. Régulation génétique chez les bactéries (opéron lactose et opéron tryptophane)
6. Traduction et mécanismes de la régulation de la traduction -code génétique : Traduction -tRNA -Ribosomes -
Initiation, élongation et terminaison
7. Recombinaisons génétiques chez les bactéries: Transformation, Conjugaison, Transduction
Descriptif du module
Travaux dirigés :
1. Techniques de séparation et d’analyse des acides nucléiques : ADN nucléaires et ARN, Plasmides
(Complément du cours).
2. Analyse de séquences d’ADN pour déterminer les signaux importants, faire des mutations et prédire leur(s)
conséquence.
3. Mutations de l’opéron lactose et leurs caractérisations via les diploïdes partiels (cis et trans dominance)
Travaux pratiques :
Extraction d`ADN génomique à partir d`échantillons eucaryotes (pour simplification, chez les végétaux) et
visualisation de l`ADN.
Extraction par lyse alcaline d’un plasmide à partir d’une bactérie
Séparation par électrophorèse en gel d’agarose.
1ère partie
Descriptif du module
2. PROCEDURES D’EVALUATION
2.1. Modes d’évaluation
 Examen de fin de semestre : épreuve écrite ;
 Contrôles continus : tests, épreuves orales, devoirs, exposés ; ou autre moyen de contrôle;
 Travaux pratiques : rapports de TP.
2.2. Note du module
(Préciser le pourcentage des différentes évaluations de module pour obtenir la note du module.)
 Contrôles continus : 20%
 Examens des travaux pratiques : 20%
 Examen final : 60%
1ère partie
Descriptif du module
A : rappels sur le génome
Les acides nucléiques
Le DNA circulaire
La chromatine
B: Les outils de la biologie moléculaire
Enzymes qui coupent les acides nucléiques
Enzymes qui changent les contraintes des AN
Enzymes qui travaillent sur les phosphates
Enzymes qui recopient les acides nucléiques
C: Les techniques de la biologie moléculaire
Purification des acides nucléiques
Dosage spectrophotométrique des AN
Dénaturation thermique des acides nucléiques
Electrophorèse sur gel
Qu’est ce que la biologie moléculaire ?
Plan du cours : première partie
Partie 1 :Initiation aux techniques usuelles de biologie Moléculaire
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
Plan du cours : deuxième partie
D : Réplication de l’ADN
Définitions élémentaires
Mécanismes de la réplication chez EColi
Mécanisme de la réplication chez les eucaryotes
Mécanismes de la réparation
E: La Transcription
Les procaryotes
Les eucaryotes
F: La Traduction
Le Code génétique
L’initiation
L’élongation
La terminaison
G : De l ’ADN aux protéines
Comment cela a-t-il commencé ? ??
!!
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
Du gène à la protéine
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
Du gène à l’organisme
1ère partie
Les acides nucléiques
 La chaîne d’ADN
 La chaîne d’ARN
 La polarité d’une chaine d’acide nucléique
 Conformation du brin d’AN
 Appariement des bases (règle de complémentarité)
 La double hélice
- Structure
- Sens de rotation
- L’ADN
- L’ARN
 Tableau récapitulatif de la structure des AN
1ère partie
Les acides nucléiques: l ’ADN
1ère partie
Les acides nucléiques: l ’ARN
La chaîne (ou brin) d’ARN est formée
par l ’enchaînement de ribonucléotides
GMP, AMP, CMP et UMP.
Reliés par des liaisons phosphodiester
entre le carbone 3 ’ d ’un nucléotide
et le carbone 5 ’ du suivant.
1ère partie
Extrémité 5’
Liaison phosphodiester
Liaison phosphodiester
Extrémité 3’
Polarité de la chaîne d’Acide Nucléique
Représentation schématique
du fragment 5’- C-A-G-3’
5’Phosphate – C – A – G -
3’OH
1ère partie
P-5 ’CGTGAATTCACG-3 ’OH
Brin d’ADN (sens)
1ère partie
Les appariements de nucléotides
Vus par un
modélisateur
Vus par un
chimiste
1ère partie
Brin d ’ADN (antisens)
P-5’CGTGAATTCACG-3 ’OH
1ère partie
Règle de complémentarité
1ère partie
5 ’
3 ’ 5 ’
3 ’
La double hélice d ’ADN
1ère partie
Deux chaînes hélicoïdales
Deux chaînes polynucleotidiques à
polarité inversée (antiparallèles).
Pourquoi antiparallèles ?
5 ’
5 ’
5 ’ 3 ’
3 ’
3 ’
3 ’ 5 ’
La double hélice d ’ADN
La forme B
1ère partie
La projection d'une hélice selon
son axe est un cercle
Hélice droite: rotation anti horaire
Hélice gauche: rotation horaire
Hélices droites et hélices gauches
1ère partie
Hélices droites
▲
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
▲
Hélice gauche
1ère partie
Hélices gauches
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
▲
Double hélice gauche
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
Les sillons de l ’ADN
Observer la différence entre
le grand sillon
le petit sillon
Intéressant pour la reconnaissance
des protéines
L’ ADN sous forme B
1ère partie
5 ’- CAAGAGCCUAAUAACUCGGGCUAUAAACUAAGGAAU - 3 ’
La chaîne d ’ARN
L ’ARN est structuré en simple brin...
...qui peut se replier en suivant la règle
de complémentarité des bases.
5 ’- - 3 ’
L’un des éléments de structure ainsi formé, qui joue un rôle important dans les fonctions
biologiques des ARN, est l ’épingle à cheveux ( hairpin ) ou tige boucle.
Tige
Boucle
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
La double hélice d ’ARN
Deux chaînes hélicoïdales
à rotation droite
Deux chaînes polynucleotidiques
à polarité inversée.
(antiparallèles).
Conformation A
1ère partie
Pr. Jacques
PAOLETTI
SC-L3BH-01
L’ ARN sous forme A
Les sillons de l ’ARN
le petit sillon
le grand sillon
Large et peu profond
Étroit et profond
donc propriétés de reconnaissance
complètement différentes de celles de l’ADN.
1ère partie
Les différentes catégories d ’ARN
Les ARN participent à toutes les étapes de l ’expression des gènes
et de la biosynthèse des protéines
Dans les cellules on trouve essentiellement quatre types d ’ARN.
Les ARN ribosomiques (rARN)
Les ARN de transfert (tARN)
Les ARN messagers (mARN)
des ARN nucléaires de petite taille(snARN)
5’
3’
rRNA 16S
rRNA 5S
3’
5’
mRNA
tRNA
snRNA
1ère partie
Forme
Nombre de paires de bases par tour
Angle de torsion par paire de base
Pas de l'hélice
Distance axiale entre les paires de bases
Angle de basculement
Largeur des sillons Grand
Petit
Distance du phosphore à l'axe de l'hélice
B
10 (10,4)
36°
34 Å
3,4 Å
voisin de 0
11,4 Å
6,0 Å
9,3 Å
A
11
32,7°
29 Å
2,6 Å
à peu près 20
2,4 Å
11,0 Å
9,5 Å
Caractéristiques des formes canoniques A et B des AN
34Å
3,4Å
Forme B
1ère partie
Cours 1:TECHNIQUES DE
SEPARATION ET D’ANALYSE DES
ACIDES NUCLÉIQUES:
ADN, ARN & PLASMIDES
1ère partie
Connaître les principes des
techniques de base de la biologie
moléculaire.
Savoir décrire les procédés
employés et leur utilité.
Connaître les outils utilisés dans
ces techniques.
Savoir analyser les résultats de
ces techniques.
1.Purification des acides nucléiques
2.Séparation des acides nucléiques
3.Elaboration de Cartes de restrictions des plasmides
1.1.Extraction des ADN
1.2.Extraction des ARN
1.3.Extraction des plasmides
1.3.1. Rappel sur les plasmides
1.3.2. Purification par Lyse alcaline
1.3.3. Purification par Gradient de chlorure de césium
2.1.Electrophorèse sur gel d’agarose
2.2.Electrophorèse sur gel de polyarylamide
=technique permettant d'isoler l'ADN de cellules ou de
tissus.
L'ADN extrait  digestion, hybridation (Southern blot),
séquençage, PCR, clonage…
Différents protocoles pour extraire l'ADN avec même
schéma de principe :
1.Purification des acides nucléiques
1.1.Extraction de l’ADN
•Lyse des cellules
•Elimination des protéines
•Elimination des autres acides nucléiques (ARN...)
•Concentration de l'ADN par précipitation à l'alcool
Différentes variantes employées:
l'ADN génomique (issu du ou des chromosomes des cellules
analysées)
Ou
l'ADN plasmidique (provenant de plasmides portés le plus
souvent par des cellules bactériennes comme Escherichia coli).
Kits commerciaux  extractions rapides à l'aide de
réactifs prêts à l'emploi.
lyse des cellules ou des tissus
=broyage ou pas + extraction/détergents
•disperser les bicouches lipidiques des
membranes
•dénaturer les protéines srtt celles
associées à l'ADN dans la chromatine
déprotéinisation de la solution
=extraction / solvants organiques, en
général du phénol +/-chloroforme
protéines dénaturées  précipité à
l'interface phénol-eau = « gâteau »
l'ADN en solution dans la phase
aqueuse
Pour éliminer les ARNs Traitement par l’ARNase.
Solution très visqueuse
l'ADN : très longs filaments
s'opposant aux écoulements
hydrodynamiques.
Préparation d'ADN génomique
L’ADN collecté/centrifugation
 dissous dans Tampon ou Eau pure.
précipitation de l’ADN
=addition d'éthanol ou d'isopropanol
dans la phase aqueuse
40
tampon sans pression osmotique,
faisant éclater les membranes
fermées
EDTA inhibe les nucléases en chélatant
les ions Mg++ & Ca++
SDS dénature les lipoprotéines
membranaires et les enzymes
lysosomiales et libère ainsi l'ADN tout
en préservant sa structure.
41
Phénol = agent déprotéinisant
TD1.TECHNIQUES DE SEPARATION
ET D’ANALYSE DES ACIDES
NUCLÉIQUES
42
Pour éliminer les traces de phénol et d'autres contaminants (prot.,
enz…)  dialyse ou purification par chromatographie en colonne
de gel dénaturant ou d'adsorption.
Ethanol mobilise l’eau du milieu
& diminue la solubilité de l’ADN
SPECTROPHOTOMETRIE à UV
QUANTITE DE L’ADN:
DO260nm =1 correspond à 50 ng/μL d’ADN Total
QUALITE DE L’ADN:
Abs260/Abs280 nm
QUANTITE & QUALITE DE L’ADN:
Electrophorèse sur gel d’agarose
44
ASPECT DE L'ADN GENOMIQUE SUR GEL D’AGAROSE
ADN natif non
digéré
=technique permettant d'isoler l‘ARN de cellules ou de tissus.
L‘ARN extrait  hybridation (Northern blot), banques ADNc, RT-PCR…
Différents protocoles pour extraire l‘ARN avec même schéma de principe :
Lyse cellulaire mécanique (congélation, billes de céramique ou détergents)
ou enzymatique (lysozyme ou la lyticase)+Protection des ARN de l’action des
ARNases.
2 grands principes:
1) les différences de propriétés physico-chimiques ARN/protéines ;
2) l’adsorption sélective des ARN sur support solide.
1.1.Extraction de l’ARN
+Phénol/Chlrf accélérer
la procédure d’extraction
(++ieurs séries/- cellules)
TD1.TECHNIQUES DE SEPARATION ET
D’ANALYSE DES ACIDES NUCLÉIQUES
46
Pour extraire l'ARN d'un tissu ou d‘ une suspension de cellules, il faut
impérativement inhiber toute trace d’ ARNase.
GuSCN: agent
puissant de
dénaturation des
protéines:Lyse
beta2-mercaptoéthanol
:rupture des ponts
disulfures protéiques
se caractérisent par la présence du côté 3'-terminal d'une
longue queue poly(A) synthétisée à la phase post-
transcriptionnelle.
Parmi les acides ribonucléiques extraits des cellules  les
ARN messagers = ARNm = classe la plus étudiée
chromatographie d'affinité entre cette queue poly(A) et une
colonne dont la phase fixe est pourvue de fragments
d'oligo(dT) de quelques dizaines de nucléotides qui peuvent
s'hybrider avec les RNA poly(A).
PURIFICATION
SPECTROPHOTOMETRIE à UV
QUANTITE DE L’ARN:
DO260nm =1 correspond à 40 ng/μL d’ARN Total
QUALITE DE L’ARN:
Abs260/Abs280 nm
QUANTITE & QUALITE DE L’ARN:
Electrophorèse sur gel d’agarose
ASPECT DES ARN SUR GEL D’AGAROSE
TD1.TECHNIQUES DE SEPARATION ET
D’ANALYSE DES ACIDES NUCLÉIQUES
Marqueur de
PM (1kb)
ARN totaux
dégradés
ARN totaux
non dégradés
ARN totaux
non dégradés
Petites molécules d’ADN habituellement circulaire
Existant indépendamment des chromosomes de l’hôte
Présents chez nombreuses bactéries (qques levures et
mycètes)
A réplication autonome (=réplicons) indépendamment des
chromosomes
Portent un nombre de gènes très réduit (≤30)
A information génétique non-essentielle pour l’hôte
En nbr. variable:
1.3.Extraction des plasmides
1.3.1. Les plasmides: Rappel
Plasmide à copie unique
(1 seul/cellule hôte)
Plasmides à copies multiples
(40 ou + /cellule hôte)
Les plasmides peuvent être éliminés des cellules
hôtes=CURAGE (curing)
Spontané/Induit
Principe: traitements inhibant la réplication des
plasmides sans affecter la reproduction des cellules
hôtes  Plasmides inhibés progressivement & dilués au
cours de la multiplication bactérienne
≠ Méthodes de curage:
Mutagènes dérivés de l’acridine
Radiations UV ou ionisantes
Privation de thymine
Températures supra-optimales
Différentes formes d'un plasmide
L'axe de la double hélice d'ADN peut
lui-même s'enrouler en une super
hélice droite ou gauche. Cette forme
superenroulée de l'ADN joue un
rôle biologique très important
(compaction, stabilité de l'ADN).
Une coupure sur un seul des deux
brins d'ADN superenroulé (forme I)
déverrouille la superhélicité et
permet le relâchement spontané de
la molécule sous forme circulaire
ouverte (forme II).
La réparation de cette coupure par
une ligase produit une forme
circulaire fermée (forme Ir).
Une coupure sur les deux brins
d'une molécule superenroulée ou
d'une molécule circulaire fermée
produit une molécule linéaire
(forme III).
1.3.2. Purification par Lyse alcaline
Parmi les techniques les plus courantes de la biologie moléculaire =
noms abrégés: miniprep, midiprep et maxiprep (volume de la culture
bactérienne).
Préparation sélective de l'ADN du plasmide contenu dans les
bactéries, tout en éliminant l'ADN du chromosome bactérien.
Différentes variantes ou améliorations de cette méthode
existent
kits commerciaux (grd nbr) avec petites colonnes de résine
chromatographique échangeuse d'ion  améliorer la pureté de
l'ADN.
BUT : Extraire de façon rapide l'ADN plasmidique afin de l'analyser avec des
enzymes de restriction et électrophorèse en gel d'agarose. Obtenir plusieurs
mg d'ADN partiellement purifié et Réaliser plusieurs digestions enzymatiques
pour vérifier un clone, ou établir une carte de restriction.
Suspension de l’ADN plasmidique dans TE ou Eau pure
Elimination des ARN/ribonucléases (hydrolyse sélective des ARN/ ADN intact)
Concentration de l'ADN plasmidique par précipitation à l'alcool
Récupération de l’ADN par centrifugation
Neutralisation rapide /acétate de potassium (pH 5,5)
Renaturation de l’ADN plasmidique Précipitation de l’ADN Chromosomique
Lyse des cellules /détergent (SDS) en présence de soude (pH 13)
Dénaturation de l'ADN total
Préparation d'ADN plasmidique
1.3.3. Purification par Gradient de chlorure de césium
= technique basée sur la centrifugation en gradient de densité.
PRINCIPES DE BASE
La centrifugation = méthode couramment utilisée en biochimie pour
séparer ou analyser des fractions ou des structures cellulaires, des
macromolécules, etc.
On peut accentuer ou raffiner les méthodes de séparation en
faisant cette centrifugation dans un gradient de concentration:
On peut donc moduler cette vitesse en faisant varier de
façon continue uo par étape (discontinue) cette différence de
densité en créant un gradient de concentration.
la différence entre la densité ellec te elucitrap al ed
ud
tnavlos influence la vitesse de sédimentation.
Comment?
Densité de la
particule >celle du
milieu
La particule
sédimente
Densité de la
particule = celle du
milieu
La particule ne
sédimente pas
Densité de la
particule <celle du
milieu
La particule
s’élève  flotte
Les variations de densités sont obtenues en faisant varier la
concentration d'un produit chimique dans la solution.
Divers produits peuvent être utilisés pour faire ces gradients:
Ils doivent être:
très solubles en solution aqueuse  des densités
suffisantes.
inertes, peu coûteux, faciles à manipuler, non
toxiques, etc.
Fabrication des gradients
Le produit couramment utilisé, particulièrement
dans la séparation des acides nucléiques: le
chlorure de césium (CsCl).
Ce sel peut atteindre une densité très élevée, de
l'ordre de 1.9 g/mL à 7.5 mol/L.
Cette possibilité d'atteindre des densités si
élevées en solution aqueuse est son principal
avantage.
Gradients discontinus
La juxtaposition un par-dessus
l'autre des solutions ayant des
différences suffisantes de
densités .
Gradients continus
La variation de densité est
graduelle le long du tube à
centrifuger.
TD1.TECHNIQUES DE SEPARATION ET
D’ANALYSE DES ACIDES NUCLÉIQUES
Purification sur gradient de Chlorure de Césium
TD1.TECHNIQUES DE SEPARATION ET
D’ANALYSE DES ACIDES NUCLÉIQUES
2.Séparation des acides nucléiques
La technique la plus utilisée pour la séparation
des acides nucléiques: L’électrophorèse
Principe général:
Dans un milieu donné, la séparation des particules se fait en
fonction de leur charge électrique et pour des charges
identiques, en fonction de leur taille.
ELECTROPHORESE DE L’ADN
Cette technique est assez simple à mettre en œuvre si on dispose des bons
outils et de quelques astuces.
= technique de biologie moléculaire  séparer des fragments d’ADN
de différentes tailles en les faisant migrer dans un gel en les
soumettant à un courant électrique.
Le gel est constitué d'une matrice de polymère baignant dans un
tampon conducteur.
Deux principaux polymères sont utilisés : l'agarose et le
polyacrylamide.

Contenu connexe

Similaire à Biologie moléculaire_S6_ première partie .pptx

Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
BoutainaAddoum2
 
Projet de recherches1f
Projet de recherches1fProjet de recherches1f
Projet de recherches1f
pmasson02
 
Licence - Programme Paris Descartes
Licence - Programme Paris DescartesLicence - Programme Paris Descartes
Licence - Programme Paris Descartes
Corentin CALLON
 
Poly physio qcm 10 11
Poly physio qcm 10 11Poly physio qcm 10 11
Poly physio qcm 10 11
bigwar
 
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
GROUPENUMERO8
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
kristinacraft1
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
balamane
 

Similaire à Biologie moléculaire_S6_ première partie .pptx (20)

Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
Université Hassan II Faculté de Médecine et de Pharmacie Casablanca - Cours d...
 
Projet de recherches1f
Projet de recherches1fProjet de recherches1f
Projet de recherches1f
 
De l'ADN à la protéine
 De l'ADN à la protéine De l'ADN à la protéine
De l'ADN à la protéine
 
Licence - Programme Paris Descartes
Licence - Programme Paris DescartesLicence - Programme Paris Descartes
Licence - Programme Paris Descartes
 
Tp histo
Tp histoTp histo
Tp histo
 
Poly physio qcm 10 11
Poly physio qcm 10 11Poly physio qcm 10 11
Poly physio qcm 10 11
 
Biologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdfBiologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdf
 
genetique2an-acides_nucleiques2020sifi.pptx
genetique2an-acides_nucleiques2020sifi.pptxgenetique2an-acides_nucleiques2020sifi.pptx
genetique2an-acides_nucleiques2020sifi.pptx
 
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
La composition du nucléole réaliser par les étudiants de l'unigom g2 médecine
 
Organisation nucléaire et régulation des activités transcriptionnelles
Organisation nucléaire et régulation des activités transcriptionnellesOrganisation nucléaire et régulation des activités transcriptionnelles
Organisation nucléaire et régulation des activités transcriptionnelles
 
Copie de Etudes_Biomoles_S6.pptx
Copie de Etudes_Biomoles_S6.pptxCopie de Etudes_Biomoles_S6.pptx
Copie de Etudes_Biomoles_S6.pptx
 
Biotec06_final (1).ppt
Biotec06_final (1).pptBiotec06_final (1).ppt
Biotec06_final (1).ppt
 
02.bases_de_donnes_FR.ppt
02.bases_de_donnes_FR.ppt02.bases_de_donnes_FR.ppt
02.bases_de_donnes_FR.ppt
 
Interaction rayonnement et ADN.pdf
Interaction rayonnement et ADN.pdfInteraction rayonnement et ADN.pdf
Interaction rayonnement et ADN.pdf
 
Exposé de TP Biologie Cellulaite.pptx
Exposé de TP Biologie Cellulaite.pptxExposé de TP Biologie Cellulaite.pptx
Exposé de TP Biologie Cellulaite.pptx
 
COURS 2 PCR.ppt
COURS 2 PCR.pptCOURS 2 PCR.ppt
COURS 2 PCR.ppt
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
 
Cinetique enzymatique
Cinetique enzymatiqueCinetique enzymatique
Cinetique enzymatique
 
Nothern blot
Nothern blotNothern blot
Nothern blot
 

Plus de rababouerdighi

Plus de rababouerdighi (13)

Dynamique des populations animale (1).pptx
Dynamique des populations animale (1).pptxDynamique des populations animale (1).pptx
Dynamique des populations animale (1).pptx
 
5 PPT sur le projet de fin d'étude .pptx
5 PPT sur le projet de fin d'étude .pptx5 PPT sur le projet de fin d'étude .pptx
5 PPT sur le projet de fin d'étude .pptx
 
7 PPT sue le project de fin d'étude.pptx
7 PPT sue le project de fin d'étude.pptx7 PPT sue le project de fin d'étude.pptx
7 PPT sue le project de fin d'étude.pptx
 
exposé rep.sexuée et la rep.asexuée.pptx
exposé rep.sexuée et la rep.asexuée.pptxexposé rep.sexuée et la rep.asexuée.pptx
exposé rep.sexuée et la rep.asexuée.pptx
 
Histologie cours des muscles S4 2012-1-1.pptx
Histologie cours des muscles S4 2012-1-1.pptxHistologie cours des muscles S4 2012-1-1.pptx
Histologie cours des muscles S4 2012-1-1.pptx
 
Histologie contraction_musculaire_cours.pptx
Histologie contraction_musculaire_cours.pptxHistologie contraction_musculaire_cours.pptx
Histologie contraction_musculaire_cours.pptx
 
Biologie cellulaire le Chloroplastes.pptx
Biologie cellulaire le Chloroplastes.pptxBiologie cellulaire le Chloroplastes.pptx
Biologie cellulaire le Chloroplastes.pptx
 
Biologie cellulaire organite Mitochondries.pptx
Biologie cellulaire organite Mitochondries.pptxBiologie cellulaire organite Mitochondries.pptx
Biologie cellulaire organite Mitochondries.pptx
 
les écosystèmes biotope et biocénose - final vrsion.pptx
les écosystèmes biotope et biocénose - final vrsion.pptxles écosystèmes biotope et biocénose - final vrsion.pptx
les écosystèmes biotope et biocénose - final vrsion.pptx
 
Présentation_ Didactique 1_SVT (S4) complet.pptx
Présentation_ Didactique 1_SVT (S4) complet.pptxPrésentation_ Didactique 1_SVT (S4) complet.pptx
Présentation_ Didactique 1_SVT (S4) complet.pptx
 
Cours_Epistémologie et Histoire des Sciences de la Vie_S6.pptx
Cours_Epistémologie et Histoire des Sciences de la Vie_S6.pptxCours_Epistémologie et Histoire des Sciences de la Vie_S6.pptx
Cours_Epistémologie et Histoire des Sciences de la Vie_S6.pptx
 
Présentation_ Didactique 1_SVT (S4).pptx
Présentation_ Didactique 1_SVT (S4).pptxPrésentation_ Didactique 1_SVT (S4).pptx
Présentation_ Didactique 1_SVT (S4).pptx
 
ARN protocole d'extraction en biologie moléculaire.pptx
ARN protocole d'extraction en biologie moléculaire.pptxARN protocole d'extraction en biologie moléculaire.pptx
ARN protocole d'extraction en biologie moléculaire.pptx
 

Biologie moléculaire_S6_ première partie .pptx

  • 1. BIOLOGIE MOLÉCULAIRE 2023/2024 (S6) Préparé et présenté par Pr. Nihal Abitiu Université Ibn Tofail de Kenitra Ecole Supérieure de l’Education et de la Formation (ESEF) Licence d’éducation : Spécialité Enseignement Secondaire- Sciences de la vie et de la terre ‫التربية‬ ‫في‬ ‫اإلجازة‬ : ‫الثانوي‬ ‫التعليم‬ ‫تخصص‬ - ‫واألرض‬ ‫الحياة‬ ‫علوم‬ Biologie moléculaire 1ère partie
  • 2. Descriptif du module N° d’ordre du module M34 Intitulé du module BIOLOGIE MOLECULAIRE Nature du module Disciplinaire Langue FRANÇAIS Semestre d’appartenance du module S6 Etablissement dont relève le module ESEF DE KENITRA 1ère partie
  • 3. 1.1. COMPÉTENCES ET OBJECTIFS DU MODULE  COMPÉTENCES VISÉES Au terme du module de Biologie moléculaire, les étudiants s’approprient les savoirs et savoir-faire liés à la réplication du DNA, à l’expression de l’information génétique et au génie génétique et seront en mesure de les réinvestir pour résoudre des problèmes scientifiques liés à ce contenu.  OBJECTIFS Au terme de ce module, l'étudiant sera en mesure de :  Expliquer le processus de réplication du DNA chez les procaryotes et les eucaryotes ;  Expliquer les étapes de l’expression de l’information génétique ;  Expliquer les mécanismes moléculaires de régulation de l’expression de l’information génétique, chez les procaryotes et les eucaryotes ;  Dégager les voies moléculaires d’adressage des protéines ;  Extraire et visualiser le DNA à partir de cellules végétales ;  Expliquer les outils et les processus du génie génétique, ainsi que ses applications. Descriptif du module 1ère partie
  • 4. Descriptif du module 1.2. PRÉ-REQUIS PÉDAGOGIQUES AVOIR DES CONNAISSANCES DE BASE EN RELATION AVEC LES MODULES SUIVANTES: M01: Biologie cellulaire (S1) M15: Génétique (S3) M16: Biochimie (S3) M17: Microbiologie (S3) M21: Biochimie métabolique (S4) 1.3. VOLUME HORAIRE Composante(s) du module Volume horaire (VH) Cours TD TP Activités Pratiques Travail personnel Evaluation (évaluation des connaissances et examen final) VH global 26h 8h 12h 4h 50 h VH global du module 26h 8h 12h 4h 50 h % VH 52% 16% 24% 8% 100% 1ère partie
  • 5. Descriptif du module 1.4. DESCRIPTION DU CONTENU DU MODULE Fournir une description détaillée des enseignements et/ou activités pour le module : Cours, TD, TP (Tavaux du laboratoires, table ronde, séminaires,), Activités Pratiques (Travaux de terrain, Stages, …). Pour le cas des Licences d’Education, se conformer au contenu des filières types nationales. Cours : Partie 1 :Initiation aux techniques usuelles de biologie moléculaire 1. Méthodes d’étude des Acides nucléiques (extraction et purification) 2. Séparation des acides nucléiques et électrophorèse (Southern ou Northern blots) 3. Enzymes de restriction 4. Vecteurs de clonage (plasmides) 5. Marquage des acides nucléiques 6. Amplification par PCR 7. Séquençage du DNA 1ère partie
  • 6. 1ère partie Partie 2 :Information génétique et Dogme Central 1. Acides nucléiques et matériel génétique 2. Réplication et réparation du DNA chez les procaryotes et les eucaryotes 3. Transcription et régulation de l’expression des gènes chez les procaryotes : RNA polymérase (a2bb's), définition du promoteur et des éléments de régulation Initiation, élongation et terminaison (facteur Rho), Contrôle de la transcription: opéron 4. Transcription et régulation de l’expression des gènes chez les eucaryotes : Transcription par la RNA pol II: initiation, élongation, terminaison, promoteur, facteurs de transcription, Régulation de la transcription, transduction du signal, Epissage du mRNA, capping et polyadénylationTranscriptomique, micro-arrays Transcription par la RNA pol I Transcription par la RNA pol III 5. Régulation génétique chez les bactéries (opéron lactose et opéron tryptophane) 6. Traduction et mécanismes de la régulation de la traduction -code génétique : Traduction -tRNA -Ribosomes - Initiation, élongation et terminaison 7. Recombinaisons génétiques chez les bactéries: Transformation, Conjugaison, Transduction Descriptif du module
  • 7. Travaux dirigés : 1. Techniques de séparation et d’analyse des acides nucléiques : ADN nucléaires et ARN, Plasmides (Complément du cours). 2. Analyse de séquences d’ADN pour déterminer les signaux importants, faire des mutations et prédire leur(s) conséquence. 3. Mutations de l’opéron lactose et leurs caractérisations via les diploïdes partiels (cis et trans dominance) Travaux pratiques : Extraction d`ADN génomique à partir d`échantillons eucaryotes (pour simplification, chez les végétaux) et visualisation de l`ADN. Extraction par lyse alcaline d’un plasmide à partir d’une bactérie Séparation par électrophorèse en gel d’agarose. 1ère partie Descriptif du module
  • 8. 2. PROCEDURES D’EVALUATION 2.1. Modes d’évaluation  Examen de fin de semestre : épreuve écrite ;  Contrôles continus : tests, épreuves orales, devoirs, exposés ; ou autre moyen de contrôle;  Travaux pratiques : rapports de TP. 2.2. Note du module (Préciser le pourcentage des différentes évaluations de module pour obtenir la note du module.)  Contrôles continus : 20%  Examens des travaux pratiques : 20%  Examen final : 60% 1ère partie Descriptif du module
  • 9. A : rappels sur le génome Les acides nucléiques Le DNA circulaire La chromatine B: Les outils de la biologie moléculaire Enzymes qui coupent les acides nucléiques Enzymes qui changent les contraintes des AN Enzymes qui travaillent sur les phosphates Enzymes qui recopient les acides nucléiques C: Les techniques de la biologie moléculaire Purification des acides nucléiques Dosage spectrophotométrique des AN Dénaturation thermique des acides nucléiques Electrophorèse sur gel Qu’est ce que la biologie moléculaire ? Plan du cours : première partie Partie 1 :Initiation aux techniques usuelles de biologie Moléculaire 1ère partie
  • 10. Pr. Jacques PAOLETTI SC-L3BH-01 Plan du cours : deuxième partie D : Réplication de l’ADN Définitions élémentaires Mécanismes de la réplication chez EColi Mécanisme de la réplication chez les eucaryotes Mécanismes de la réparation E: La Transcription Les procaryotes Les eucaryotes F: La Traduction Le Code génétique L’initiation L’élongation La terminaison G : De l ’ADN aux protéines Comment cela a-t-il commencé ? ?? !! 1ère partie
  • 11. Pr. Jacques PAOLETTI SC-L3BH-01 Du gène à la protéine 1ère partie
  • 12. Pr. Jacques PAOLETTI SC-L3BH-01 Du gène à l’organisme 1ère partie
  • 13. Les acides nucléiques  La chaîne d’ADN  La chaîne d’ARN  La polarité d’une chaine d’acide nucléique  Conformation du brin d’AN  Appariement des bases (règle de complémentarité)  La double hélice - Structure - Sens de rotation - L’ADN - L’ARN  Tableau récapitulatif de la structure des AN 1ère partie
  • 14. Les acides nucléiques: l ’ADN 1ère partie
  • 15. Les acides nucléiques: l ’ARN La chaîne (ou brin) d’ARN est formée par l ’enchaînement de ribonucléotides GMP, AMP, CMP et UMP. Reliés par des liaisons phosphodiester entre le carbone 3 ’ d ’un nucléotide et le carbone 5 ’ du suivant. 1ère partie
  • 16. Extrémité 5’ Liaison phosphodiester Liaison phosphodiester Extrémité 3’ Polarité de la chaîne d’Acide Nucléique Représentation schématique du fragment 5’- C-A-G-3’ 5’Phosphate – C – A – G - 3’OH 1ère partie
  • 17. P-5 ’CGTGAATTCACG-3 ’OH Brin d’ADN (sens) 1ère partie
  • 18. Les appariements de nucléotides Vus par un modélisateur Vus par un chimiste 1ère partie
  • 19. Brin d ’ADN (antisens) P-5’CGTGAATTCACG-3 ’OH 1ère partie
  • 21. 5 ’ 3 ’ 5 ’ 3 ’ La double hélice d ’ADN 1ère partie
  • 22. Deux chaînes hélicoïdales Deux chaînes polynucleotidiques à polarité inversée (antiparallèles). Pourquoi antiparallèles ? 5 ’ 5 ’ 5 ’ 3 ’ 3 ’ 3 ’ 3 ’ 5 ’ La double hélice d ’ADN La forme B 1ère partie
  • 23. La projection d'une hélice selon son axe est un cercle Hélice droite: rotation anti horaire Hélice gauche: rotation horaire Hélices droites et hélices gauches 1ère partie
  • 28. Pr. Jacques PAOLETTI SC-L3BH-01 Les sillons de l ’ADN Observer la différence entre le grand sillon le petit sillon Intéressant pour la reconnaissance des protéines L’ ADN sous forme B 1ère partie
  • 29. 5 ’- CAAGAGCCUAAUAACUCGGGCUAUAAACUAAGGAAU - 3 ’ La chaîne d ’ARN L ’ARN est structuré en simple brin... ...qui peut se replier en suivant la règle de complémentarité des bases. 5 ’- - 3 ’ L’un des éléments de structure ainsi formé, qui joue un rôle important dans les fonctions biologiques des ARN, est l ’épingle à cheveux ( hairpin ) ou tige boucle. Tige Boucle 1ère partie
  • 30. Pr. Jacques PAOLETTI SC-L3BH-01 La double hélice d ’ARN Deux chaînes hélicoïdales à rotation droite Deux chaînes polynucleotidiques à polarité inversée. (antiparallèles). Conformation A 1ère partie
  • 31. Pr. Jacques PAOLETTI SC-L3BH-01 L’ ARN sous forme A Les sillons de l ’ARN le petit sillon le grand sillon Large et peu profond Étroit et profond donc propriétés de reconnaissance complètement différentes de celles de l’ADN. 1ère partie
  • 32. Les différentes catégories d ’ARN Les ARN participent à toutes les étapes de l ’expression des gènes et de la biosynthèse des protéines Dans les cellules on trouve essentiellement quatre types d ’ARN. Les ARN ribosomiques (rARN) Les ARN de transfert (tARN) Les ARN messagers (mARN) des ARN nucléaires de petite taille(snARN) 5’ 3’ rRNA 16S rRNA 5S 3’ 5’ mRNA tRNA snRNA 1ère partie
  • 33. Forme Nombre de paires de bases par tour Angle de torsion par paire de base Pas de l'hélice Distance axiale entre les paires de bases Angle de basculement Largeur des sillons Grand Petit Distance du phosphore à l'axe de l'hélice B 10 (10,4) 36° 34 Å 3,4 Å voisin de 0 11,4 Å 6,0 Å 9,3 Å A 11 32,7° 29 Å 2,6 Å à peu près 20 2,4 Å 11,0 Å 9,5 Å Caractéristiques des formes canoniques A et B des AN 34Å 3,4Å Forme B 1ère partie
  • 34. Cours 1:TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES: ADN, ARN & PLASMIDES 1ère partie
  • 35. Connaître les principes des techniques de base de la biologie moléculaire. Savoir décrire les procédés employés et leur utilité. Connaître les outils utilisés dans ces techniques. Savoir analyser les résultats de ces techniques.
  • 36. 1.Purification des acides nucléiques 2.Séparation des acides nucléiques 3.Elaboration de Cartes de restrictions des plasmides 1.1.Extraction des ADN 1.2.Extraction des ARN 1.3.Extraction des plasmides 1.3.1. Rappel sur les plasmides 1.3.2. Purification par Lyse alcaline 1.3.3. Purification par Gradient de chlorure de césium 2.1.Electrophorèse sur gel d’agarose 2.2.Electrophorèse sur gel de polyarylamide
  • 37. =technique permettant d'isoler l'ADN de cellules ou de tissus. L'ADN extrait  digestion, hybridation (Southern blot), séquençage, PCR, clonage… Différents protocoles pour extraire l'ADN avec même schéma de principe : 1.Purification des acides nucléiques 1.1.Extraction de l’ADN •Lyse des cellules •Elimination des protéines •Elimination des autres acides nucléiques (ARN...) •Concentration de l'ADN par précipitation à l'alcool
  • 38. Différentes variantes employées: l'ADN génomique (issu du ou des chromosomes des cellules analysées) Ou l'ADN plasmidique (provenant de plasmides portés le plus souvent par des cellules bactériennes comme Escherichia coli). Kits commerciaux  extractions rapides à l'aide de réactifs prêts à l'emploi.
  • 39. lyse des cellules ou des tissus =broyage ou pas + extraction/détergents •disperser les bicouches lipidiques des membranes •dénaturer les protéines srtt celles associées à l'ADN dans la chromatine déprotéinisation de la solution =extraction / solvants organiques, en général du phénol +/-chloroforme protéines dénaturées  précipité à l'interface phénol-eau = « gâteau » l'ADN en solution dans la phase aqueuse Pour éliminer les ARNs Traitement par l’ARNase. Solution très visqueuse l'ADN : très longs filaments s'opposant aux écoulements hydrodynamiques. Préparation d'ADN génomique L’ADN collecté/centrifugation  dissous dans Tampon ou Eau pure. précipitation de l’ADN =addition d'éthanol ou d'isopropanol dans la phase aqueuse
  • 40. 40 tampon sans pression osmotique, faisant éclater les membranes fermées EDTA inhibe les nucléases en chélatant les ions Mg++ & Ca++ SDS dénature les lipoprotéines membranaires et les enzymes lysosomiales et libère ainsi l'ADN tout en préservant sa structure.
  • 41. 41 Phénol = agent déprotéinisant
  • 42. TD1.TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES 42 Pour éliminer les traces de phénol et d'autres contaminants (prot., enz…)  dialyse ou purification par chromatographie en colonne de gel dénaturant ou d'adsorption. Ethanol mobilise l’eau du milieu & diminue la solubilité de l’ADN
  • 43. SPECTROPHOTOMETRIE à UV QUANTITE DE L’ADN: DO260nm =1 correspond à 50 ng/μL d’ADN Total QUALITE DE L’ADN: Abs260/Abs280 nm QUANTITE & QUALITE DE L’ADN: Electrophorèse sur gel d’agarose
  • 44. 44 ASPECT DE L'ADN GENOMIQUE SUR GEL D’AGAROSE ADN natif non digéré
  • 45. =technique permettant d'isoler l‘ARN de cellules ou de tissus. L‘ARN extrait  hybridation (Northern blot), banques ADNc, RT-PCR… Différents protocoles pour extraire l‘ARN avec même schéma de principe : Lyse cellulaire mécanique (congélation, billes de céramique ou détergents) ou enzymatique (lysozyme ou la lyticase)+Protection des ARN de l’action des ARNases. 2 grands principes: 1) les différences de propriétés physico-chimiques ARN/protéines ; 2) l’adsorption sélective des ARN sur support solide. 1.1.Extraction de l’ARN
  • 46. +Phénol/Chlrf accélérer la procédure d’extraction (++ieurs séries/- cellules) TD1.TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES 46 Pour extraire l'ARN d'un tissu ou d‘ une suspension de cellules, il faut impérativement inhiber toute trace d’ ARNase. GuSCN: agent puissant de dénaturation des protéines:Lyse beta2-mercaptoéthanol :rupture des ponts disulfures protéiques
  • 47. se caractérisent par la présence du côté 3'-terminal d'une longue queue poly(A) synthétisée à la phase post- transcriptionnelle. Parmi les acides ribonucléiques extraits des cellules  les ARN messagers = ARNm = classe la plus étudiée chromatographie d'affinité entre cette queue poly(A) et une colonne dont la phase fixe est pourvue de fragments d'oligo(dT) de quelques dizaines de nucléotides qui peuvent s'hybrider avec les RNA poly(A). PURIFICATION
  • 48.
  • 49. SPECTROPHOTOMETRIE à UV QUANTITE DE L’ARN: DO260nm =1 correspond à 40 ng/μL d’ARN Total QUALITE DE L’ARN: Abs260/Abs280 nm QUANTITE & QUALITE DE L’ARN: Electrophorèse sur gel d’agarose
  • 50. ASPECT DES ARN SUR GEL D’AGAROSE TD1.TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES Marqueur de PM (1kb) ARN totaux dégradés ARN totaux non dégradés ARN totaux non dégradés
  • 51. Petites molécules d’ADN habituellement circulaire Existant indépendamment des chromosomes de l’hôte Présents chez nombreuses bactéries (qques levures et mycètes) A réplication autonome (=réplicons) indépendamment des chromosomes Portent un nombre de gènes très réduit (≤30) A information génétique non-essentielle pour l’hôte En nbr. variable: 1.3.Extraction des plasmides 1.3.1. Les plasmides: Rappel Plasmide à copie unique (1 seul/cellule hôte) Plasmides à copies multiples (40 ou + /cellule hôte)
  • 52. Les plasmides peuvent être éliminés des cellules hôtes=CURAGE (curing) Spontané/Induit Principe: traitements inhibant la réplication des plasmides sans affecter la reproduction des cellules hôtes  Plasmides inhibés progressivement & dilués au cours de la multiplication bactérienne ≠ Méthodes de curage: Mutagènes dérivés de l’acridine Radiations UV ou ionisantes Privation de thymine Températures supra-optimales
  • 53. Différentes formes d'un plasmide L'axe de la double hélice d'ADN peut lui-même s'enrouler en une super hélice droite ou gauche. Cette forme superenroulée de l'ADN joue un rôle biologique très important (compaction, stabilité de l'ADN). Une coupure sur un seul des deux brins d'ADN superenroulé (forme I) déverrouille la superhélicité et permet le relâchement spontané de la molécule sous forme circulaire ouverte (forme II). La réparation de cette coupure par une ligase produit une forme circulaire fermée (forme Ir). Une coupure sur les deux brins d'une molécule superenroulée ou d'une molécule circulaire fermée produit une molécule linéaire (forme III).
  • 54. 1.3.2. Purification par Lyse alcaline Parmi les techniques les plus courantes de la biologie moléculaire = noms abrégés: miniprep, midiprep et maxiprep (volume de la culture bactérienne). Préparation sélective de l'ADN du plasmide contenu dans les bactéries, tout en éliminant l'ADN du chromosome bactérien. Différentes variantes ou améliorations de cette méthode existent kits commerciaux (grd nbr) avec petites colonnes de résine chromatographique échangeuse d'ion  améliorer la pureté de l'ADN. BUT : Extraire de façon rapide l'ADN plasmidique afin de l'analyser avec des enzymes de restriction et électrophorèse en gel d'agarose. Obtenir plusieurs mg d'ADN partiellement purifié et Réaliser plusieurs digestions enzymatiques pour vérifier un clone, ou établir une carte de restriction.
  • 55. Suspension de l’ADN plasmidique dans TE ou Eau pure Elimination des ARN/ribonucléases (hydrolyse sélective des ARN/ ADN intact) Concentration de l'ADN plasmidique par précipitation à l'alcool Récupération de l’ADN par centrifugation Neutralisation rapide /acétate de potassium (pH 5,5) Renaturation de l’ADN plasmidique Précipitation de l’ADN Chromosomique Lyse des cellules /détergent (SDS) en présence de soude (pH 13) Dénaturation de l'ADN total Préparation d'ADN plasmidique
  • 56. 1.3.3. Purification par Gradient de chlorure de césium = technique basée sur la centrifugation en gradient de densité. PRINCIPES DE BASE La centrifugation = méthode couramment utilisée en biochimie pour séparer ou analyser des fractions ou des structures cellulaires, des macromolécules, etc. On peut accentuer ou raffiner les méthodes de séparation en faisant cette centrifugation dans un gradient de concentration: On peut donc moduler cette vitesse en faisant varier de façon continue uo par étape (discontinue) cette différence de densité en créant un gradient de concentration. la différence entre la densité ellec te elucitrap al ed ud tnavlos influence la vitesse de sédimentation.
  • 57. Comment? Densité de la particule >celle du milieu La particule sédimente Densité de la particule = celle du milieu La particule ne sédimente pas Densité de la particule <celle du milieu La particule s’élève  flotte
  • 58. Les variations de densités sont obtenues en faisant varier la concentration d'un produit chimique dans la solution. Divers produits peuvent être utilisés pour faire ces gradients: Ils doivent être: très solubles en solution aqueuse  des densités suffisantes. inertes, peu coûteux, faciles à manipuler, non toxiques, etc. Fabrication des gradients
  • 59. Le produit couramment utilisé, particulièrement dans la séparation des acides nucléiques: le chlorure de césium (CsCl). Ce sel peut atteindre une densité très élevée, de l'ordre de 1.9 g/mL à 7.5 mol/L. Cette possibilité d'atteindre des densités si élevées en solution aqueuse est son principal avantage.
  • 60. Gradients discontinus La juxtaposition un par-dessus l'autre des solutions ayant des différences suffisantes de densités . Gradients continus La variation de densité est graduelle le long du tube à centrifuger.
  • 61. TD1.TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES Purification sur gradient de Chlorure de Césium
  • 62. TD1.TECHNIQUES DE SEPARATION ET D’ANALYSE DES ACIDES NUCLÉIQUES 2.Séparation des acides nucléiques La technique la plus utilisée pour la séparation des acides nucléiques: L’électrophorèse Principe général: Dans un milieu donné, la séparation des particules se fait en fonction de leur charge électrique et pour des charges identiques, en fonction de leur taille.
  • 63. ELECTROPHORESE DE L’ADN Cette technique est assez simple à mettre en œuvre si on dispose des bons outils et de quelques astuces. = technique de biologie moléculaire  séparer des fragments d’ADN de différentes tailles en les faisant migrer dans un gel en les soumettant à un courant électrique. Le gel est constitué d'une matrice de polymère baignant dans un tampon conducteur. Deux principaux polymères sont utilisés : l'agarose et le polyacrylamide.

Notes de l'éditeur

  1. La purification d'une solution d'ADN se fait le plus souvent par précipitations répétées dans l'alcool. Une solution d'ADN, portée à haute force ionique par addition de NaCl 3 M (1/10 du volume), est additionnée d'un large excès d'éthanol absolu à -20°C. Au bout de quelques minutes au maximum, on voit apparaître un précipité blanchâtre, translucide et filamenteux (la « méduse ») constitué de longs filaments d'ADN précipité. On recueille ce précipité par centrifugation à 10000 g pendant un quart d'heure environ. Pour laver l'ADN on resuspend le précipité dans de l'éthanol à 75 % toujours à -20°C. puis on centrifuge à nouveau. Le culot de cette dernière centrifugation est égoutté, puis séché sous vide. On peut conserver l'ADN à sec ou le redissoudre immédiatement soit dans de l'eau pure stérile, soit dans un tampon Tris-EDTA.
  2. Une fois les cellules convenablement lysées, les ARN, protégés de l’action des RNAses, peuvent être extraits. L’extraction des ARN peut être réalisée selon deux grands principes : 1) les différences de propriétés physico- chimiques entre les différents acides nucléiques et les protéines ; 2) l’adsorption sélective des acides nucléiques sur un support solide.
  3. Après avoir lavé la colonne en milieu alcalin (potasse), on charge les RNA totaux à haute force ionique (KCl 0,5 M) puis on rince la colonne avec du KCl 0,1 M en surveillant l'absorbance de l'éluat à 260 nm pour s'assurer de l'élimination des RNA non retenus par la colonne (rRNA, tRNA,... ). Enfin, on élue la fraction retenue par la colonne en abaissant la concentration de KCl à 0,01 M et en élevant la température. Un micro essai avec la reverse transcriptase permet de s'assurer de la qualité de ce RNA poly(A) comme matrice pour la synthèse de cDNA. 
  4. On recherche aussi des produits qui sont relativement inertes, peu coûteux, faciles à manipuler, non toxiques, etc. Évidemment aucun produit ne réunit toutes ces qualités et on doit choisir en tenant compte des contraintes expérimentales