5 décembre 2008

Nicole Mounier

Université Claude Bernard Lyon 1
CGMC, bâtiment Gregor Mendel
43, boulevard ...
Organismes Génétiquement Modifiés

Transfert de gènes


Comment fonctionne un gène ?
Comment manipuler l’ADN et les gènes ?

Effet attendu au niveau du produit du gène dans
      la cellule
Couper un ADN
       par une enzyme de restriction

Copier, recopier un ADN
grâce à une ADN polymérase
Coller deux fragments d’ADN

5’... TCGCATCACG           AATTCCGATCA ...3’
3’... AGCGTAGTGCTTAA           GGCTAGT ...5’
Hybridation moléculaire
Le clonage
Comment cloner un fragment d’ADN ?
Bactérie transformée


Protéines produites par des bactéries
génétiquement modifiée...
Enzymes impliquées dans
     la fromagerie
     la boulangerie
     la pâtisserie

      la dégradation des graisses
Transfert de gènes

         chez les eucaryotes

Transfert de gènes dans des cellules en culture

Expression du gène transfecté

Clones cellulaires
Analyse de l’ARNm, ou de la protéine,
ou de l’effet sur la cellule

-  gène d’intérêt, avec ou non
ses propres séquences régulatrices

- gène rapporteur
Vecteur d’expression : un exemple

Phosphate de calcium
Vecteurs viraux
      virus Herpès

Canon à
Micro injection dans le noyau
Expression transitoire

ou expression stable

du gène transfecté

                     Expression du gène transfecté

24h après transfection

correction génique
Severe Combined ImmunoDeficiency
liée à X

Avril 2000
Hôpital Necker
sur 630 essais de thérapie génique (somatique) :
Thérapie génique
      ex vivo
      in vivo
      in situ

Beaucoup d’espoir
Peu de réussite à ce jour …
      Transfert d’un gène
dans un organisme pluricellulaire
          Transfert d’un gène
    dans un organisme pluricellulaire

Organismes génétique...
Exemple : chez la souris

Transfert de gènes : souris transgéniques
Animaux transgéniques

-  Amélioration

-  « bioréacteurs »

-  Xénogreffes

-  Lutte contre certaines pandémies

- Modèle...
production de molécules
      à intérêt
Janvier 2007
Poules transgéniques

Transgène sur-exprimé dans le blanc d’oeuf
-  interféron
- un anticancéreux potentiel
par transformation
de cellules souches embryonnaires
The Nobel Prize in Physiology or Medicine 2007

"for their discoveries of principles for introducing specific gene
Développement embryonnaire
Invalidation ciblée de gène

Construction d’une version invalidée
du gène d’intérêt dans un vecteur de ciblage

Obtention de cellules ES recombinées
(par ciblage génétique, recombinaison homologue)
Injection des cellules ES KO dans un blastocyste et
implantation dans une souris receveuse
KO conditionnels

 Knock out


 Knock in
Transgenèse chez la drosophile

Transposon : élément P
Transgenèse chez les plantes

Canon à particules
Plasmide Ti d’Agrobacterium tumefaciens
Plasmide Ti
(Tumor inducing)

- 206 kb
- 196 gènes
- ADN-T :
Interaction plante-Agrobacterium
Si blessure, induction de l’expression des gènes vir.
Les protèines vir excisent l’ADN-T ...
Résistance   aux herbicides
             aux insectes nuisibles

Amélioration nutritionnelle

Production de molécules à us...
USA : 2/3 de la production mondiale
Riz doré

du beta-carotène
(précurseur de
la vitamine A)

Clonage par transfert nucléaire
Clonage reproductif

Clonage thérapeutique

Interdit en France
(chez l’homme)
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Conference OGM Mounier
Prochain SlideShare
Chargement dans…5

Conference OGM Mounier

2 904 vues

Publié le

Publié dans : Formation
0 commentaire
1 j’aime
  • Soyez le premier à commenter

Aucun téléchargement
Nombre de vues
2 904
Sur SlideShare
Issues des intégrations
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Conference OGM Mounier

  1. 1. Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex
  2. 2. OGM Organismes Génétiquement Modifiés Transfert de gènes Bactéries Eucaryotes Microorganismes Animaux Végétaux Transfert nucléaire
  3. 3. Rappels
  4. 4. Comment fonctionne un gène ?
  5. 5. Comment manipuler l’ADN et les gènes ? Effet attendu au niveau du produit du gène dans la cellule l’organisme la population d’organisme Les outils enzymatiques Couper, copier, coller l’ADN
  7. 7. Copier, recopier un ADN grâce à une ADN polymérase
  8. 8. Coller deux fragments d’ADN 5’... TCGCATCACG AATTCCGATCA ...3’ 3’... AGCGTAGTGCTTAA GGCTAGT ...5’  + ADN ligase 5’... TCGCATCACGAATTCCGATCA ... 3’ 3’... AGCGTAGTGCTTAAGGCTAGT ... 5’
  9. 9. Hybridation moléculaire
  10. 10. Sonde
  11. 11. Le clonage
  12. 12. Comment cloner un fragment d’ADN ?
  13. 13. Bactérie transformée = OGM Protéines produites par des bactéries génétiquement modifiées : Insuline Hormone de croissance Erythropoïétine Facteur VIII Interféron gamma Facteurs de croissance Activateur tissulaire du plasminogène Interleukine-2 …
  14. 14. Enzymes impliquées dans la fromagerie la boulangerie la pâtisserie la dégradation des graisses le blanchiment du papier, des textiles la dépollution la manipulation de l’ADN Taq polymérase séquenase
  15. 15. Transfert de gènes chez les eucaryotes Transfert de gènes dans des cellules en culture = transfection
  16. 16. Expression du gène transfecté Clones cellulaires
  17. 17. Analyse de l’ARNm, ou de la protéine, ou de l’effet sur la cellule
  18. 18. Transgènes -  gène d’intérêt, avec ou non ses propres séquences régulatrices - gène rapporteur CAT lacZ GFP luciférase
  19. 19. Vecteur d’expression : un exemple
  20. 20. Méthodes chimiques biologiques mécaniques
  21. 21. Phosphate de calcium
  22. 22. liposomes
  23. 23. Vecteurs viraux SV40 adenovirus virus Herpès retrovirus baculovirus …
  24. 24. électroporation
  25. 25. Canon à particules
  26. 26. Micro injection dans le noyau
  27. 27. Expression transitoire ou expression stable du gène transfecté Expression du gène transfecté Clones cellulaires
  28. 28. Fibroblastes 24h après transfection
  29. 29. Application correction génique
  30. 30. (SCID)-X1 Severe Combined ImmunoDeficiency liée à X Avril 2000 Hôpital Necker
  31. 31. sur 630 essais de thérapie génique (somatique) :
  32. 32. Thérapie génique (somatique) ex vivo in vivo in situ Beaucoup d’espoir Peu de réussite à ce jour …
  33. 33. Transgenèse = Transfert d’un gène dans un organisme pluricellulaire
  34. 34. Transgenèse = Transfert d’un gène dans un organisme pluricellulaire Organismes génétiquement modifiés OGM Bactéries Levures Animaux mammifères oiseaux poissons … Plantes
  35. 35. Exemple : chez la souris Transfert de gènes : souris transgéniques
  36. 36. 1982
  37. 37. Animaux transgéniques -  Amélioration -  « bioréacteurs » -  Xénogreffes -  Lutte contre certaines pandémies - Modèle animal pour étude des maladies humaines
  38. 38. production de molécules à intérêt pharmaceutique industriel
  39. 39. Janvier 2007 Poules transgéniques Transgène sur-exprimé dans le blanc d’oeuf -  interféron - un anticancéreux potentiel
  40. 40. Transgenèse par transformation de cellules souches embryonnaires
  41. 41. The Nobel Prize in Physiology or Medicine 2007 "for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells" Mario R. Capecchi Sir Martin J. Evans Oliver Smithies 1/3 of the prize 1/3 of the prize 1/3 of the prize USA United Kingdom USA
  42. 42. Fécondation Développement embryonnaire
  43. 43. Invalidation ciblée de gène Construction d’une version invalidée du gène d’intérêt dans un vecteur de ciblage Intégration du gène invalidé à la place du gène « normal » dans les cellules ES: - Transformation des cellules ES avec le vecteur de ciblage contenant le gène invalidé - Sélection des cellules ES knock out (KO) pour le gène d’intérêt Injection des cellules ES KO dans un blastocyste et implantation dans une souris receveuse Souris KO pour le gène d’intérêt
  44. 44. Obtention de cellules ES recombinées (par ciblage génétique, recombinaison homologue)
  45. 45. Injection des cellules ES KO dans un blastocyste et implantation dans une souris receveuse
  46. 46. KO conditionnels Knock out et Knock in
  47. 47. Transgenèse chez la drosophile Transposon : élément P
  48. 48. Transgenèse chez les plantes Protoplastes Canon à particules Plasmide Ti d’Agrobacterium tumefaciens
  49. 49. Plasmide Ti (Tumor inducing) - 206 kb - 196 gènes - ADN-T : transfert
  50. 50. Interaction plante-Agrobacterium Si blessure, induction de l’expression des gènes vir. Les protèines vir excisent l’ADN-T (= brin T) qui est transféré dans la plante
  51. 51. Résistance aux herbicides aux insectes nuisibles Amélioration nutritionnelle Production de molécules à usage thérapeutique
  52. 52. USA : 2/3 de la production mondiale
  53. 53. Riz doré produit du beta-carotène (précurseur de la vitamine A)
  54. 54. Risques http://www.ogm.gouv.fr
  55. 55. http://www.ogm.gouv.fr
  56. 56. Clonage par transfert nucléaire
  57. 57. 1997
  58. 58. Clonage reproductif Clonage thérapeutique Interdit en France (chez l’homme)
