Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.


4 819 vues

Publié le

Publié dans : Formation, Technologie
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci


  1. 1. L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES Ludovic ORLANDO Décembre 2008 Paléogénétique et Evolution moléculaire (33)4 72 72 84 65 [email_address] [email_address] Décembre 2008
  4. 4. INTRODUCTION GRANDS SINGES & HOMMES: DIVERSITE GENETIQUE <ul><li>>7 GINDIVIDUS </li></ul><ul><li>FAIBLE DIVERSITE GENETIQUE </li></ul>Xq13.3 mtDNA HVR-1 HOMMES MODERNES [email_address] Décembre 2008 70 30 5 10 14
  5. 5. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  6. 6. L’HOMO SAPIENS EVENT LES ORIGINES FOSSILES 400 - 30 KYA OMO-1 OMO-2 Herto [email_address] Décembre 2008 196 ±2 104 ±1 154±7 >160 Homo neanderthalensis Homo «erectus» Homo sapiens
  7. 7. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  8. 8. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  9. 9. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  10. 10. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  14. 14. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME [email_address] Décembre 2008
  15. 15. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » [email_address] Décembre 2008
  18. 18. L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’EVE AFRICAINE (PREDICTIONS #1 & #3) <ul><li>147 mtDNA </li></ul><ul><li>PROFILS DE RESTRICTION </li></ul><ul><li>DIVERSITE + DISTANCES ENTRE COUPLES </li></ul>[email_address] Décembre 2008
  19. 19. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTIONS #1 & #3) [email_address] Décembre 2008
  20. 20. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI GENEALOGIE DES GENES vs DES INDIVIDUS [email_address] Décembre 2008
  21. 21. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  22. 22. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>G 0 G 1 G 2 [email_address] Décembre 2008
  23. 23. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 G 2 G 3 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  24. 24. <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>1 LOCUS: P(Racine Africaine) ~ ¼ x ½ ~ 0.125 2 LOCI: P(Racine Africaine) ~ (¼ x ½)² ~ 0.016 L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI [email_address] Décembre 2008
  26. 26. L’HOMO SAPIENS EVENT LES OBSERVATIONS: PREDICTION #2 <ul><li>51 POPULATIONS </li></ul><ul><li>377 MICROSATELLITES </li></ul>INTRAPOP. [email_address] Décembre 2008
  29. 29. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) [email_address] Décembre 2008
  33. 33. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  42. 42. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
  44. 44. LIGNEES PATERNELLES LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS https://www3.nationalgeographic.com/genographic/atlas.html [email_address] Décembre 2008
  45. 45. LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS P. humanus capitis P. h. humanus P. h. corporis HABILLEMENT B H [email_address] Décembre 2008
  47. 47. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  57. 57. LES POPULATIONS D’HOMMES MODERNES DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? Feldhofer I Vindija 75 Vindija 80 El Sidron 1252 Mt. Lessini Mezmaïskaya Feldhofer II Okladnikov Scladina Teshik Tash Homo sapiens 0.005 HVR-1 660 KYA [email_address] Décembre 2008
  63. 63. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  64. 64. LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE A T A ? A 0.5MY Homme moderne AGCTCTAACTGCTTATAGTCGTATACGCGCTA Néandertal .........A...................... Australopithèque ???????????????????????????????? Chimpanzé .........A...................... Gorille .........A...................... ? T A ? A 6-8MY A A A A A ? ? A SANS GENOME NEANDERTALIEN AVEC GENOME NEANDERTALIEN ? ALIGNEMENT D’UNE REGION HOMOLOGUE DU GENOME [email_address] Décembre 2008
  69. 69. BONE #1253 BONE #1351c mtDNA 98 99 80 20 40 60 100 % % Homo PRIMERS <ul><li>FOUILLES MINISANT LA CONTAMINATION </li></ul><ul><li>ESTIMATION EXPERIMENTALE DU NIVEAU DE CONTAMINATION </li></ul>LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE [email_address] Décembre 2008 0 20 40 60 80 100
  71. 71. LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE n=98 n=18 n=18 n=57 n=16 n=53 EXTRACT #1253 FOX-P2 AFRICA WORLWIDE ANCESTRAL DERIVE % PCRs INDEPENDENTES C 911 A 977 C 911 A 977 A 911 G 977 A 911 G 977 A 911 G 977 [email_address] Décembre 2008
  77. 77. PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS MICROCEPHALES <ul><li>ANALYSES MULTIVARIEES </li></ul><ul><li>7 MESURES CRÂNIENNES </li></ul><ul><li>(97.1%,1.7%) – (72.7%,12.4%) </li></ul>H. ergaster H. habilis H. ergaster H. ergaster H. habilis 8/6 2/1 9 MICROCEPHALES 11 NON-MICROCEPHALES * * TOMOGRAPHIE 3D [email_address] Décembre 2008
  78. 78. PERSPECTIVES DE L’ADN D’AUTRES HOMMES PREHISTORIQUES ? Homo heidelbergensis Atapuerca (350-500 KYA) Homo floresiensis Flores (12-95 KYA) Larson et al. Proc Natl Acad Sci U S A. 2007 Sep 25 Valdiosera et al. Biol Lett. 2006 Dec 22 [email_address] Décembre 2008
