DNA Fingerprinting - Principle and Methods

1. Elements of Biotechnology
Unit 4
DNA Fingerprinting
B.Tech Biotechnology II
Forensic & Parental
1

2. DNA Fingerprinting & Forensics
• History
• Uses of DNA Profiling
• Hypervariable DNA sequences examined (RFLPs, VNTRs,
STRs, SNPs, mitochondrial DNA, Y chromosomal DNA)
• Methods (Southerns & PCR)
• Statistical considerations
• Technical considerations
• Databases and Privacy
2

3. DNA Fingerprinting
• You're 99.9% identical
• But of course, you are unique--in a genome of three
billion letters, even a 0.1 % difference translates into
three million differences.
• These differences (or polymorphisms) reside in
several places in the genome, often in microsatellites
• Examples of such polymorphisms include VNTRs,
STRs, RFLPs and SNPs
3

4. DNA Fingerprinting
• Focuses on the 0.1-1.0% of human DNA that is
unique
• First described in 1985 by Dr. Alec Jeffreys in England
• DNA evidence is admissible in courts
• Labs such as Cellmark Diagnostics and Lifecodes
Corporation are examples of companies which
provide such DNA evidence to courts, but states and
many U.S. cities have labs for DNA fingerprinting
• Have any of you worked in a crime lab?
4

5. Uses of DNA fingerprinting
• Paternity testing
• Identification of criminals (e.g. murderers, rapists,
letter bombers)
• Immigration disputes (family relationships)
• Identification of deceased individuals with mutilated
or decomposed bodies (e.g., the military, 9/11 victims)
• Identifying the sperm donor who “decorated” Monica
Lewinsky’s blue dress
5

6. How is DNA fingerprinting done?
• DNA obtained from hair, semen, blood, sweat, saliva,
bone or any other tissue (often found at a crime scene)
• Can be done by southern blotting with an appropriate
probe or by a PCR method using appropriate primers
• Can use single locus probes/primers or multilocus
probes/primers
• DNA can be resolved on a gel or by a capillary
electrophoresis system
6

7. Sequences examined in DNA fingerprinting
• VNTRs-variable number tandem repeats; composed of 8-
80 bp repeat units (e.g., [GCGCAATG]n) which are
tandemly repeated so that the overall length is 1-30 kb
• STRs-short tandem repeats; composed of 2-7 bp repeat
units (e.g., [AC]n) which are tandemly repeated so that
the overall length is less than 1 kb
• RFLPs-restriction fragment length polymorphisms
• SNPs-single nucleotide polymorphisms
• Mitochondrial DNA-maternal inheritance, tends to be
more stable than nuclear DNA
• Y chromosome DNA- passed from father to son
7

8. DNA fingerprinting: an example
• D1S80, a VNTR located on human chromosome 1,
contains a 16 bp repeat unit
• The number of repeats varies from one individual to the
next, and is known to range from 14-41
8

9. Some examples of DNA fingerprinting
• Paternity cases
• Crime scenes
9

10. Determining the probability of a match
• Relies on statistics
• Analysis depends upon your ethic background
(i.e. African American, Caucasian, Hispanic
Asian, etc.)
10

11. 11

12. Technical Considerations
• Preserve the integrity of DNA sample
• Avoid DNA contamination & degradation
• Avoid incomplete digestions if REs are used
• Use standard hybridization conditions
• Use standard PCR primers and procedures
• Gel analysis is less reproducible than capillary
electrophoresis of PCR products
• Difficulties in interpreting bands on a gel or X-ray film
12

13. DNA databases
• Already in place in the FBI for convicted felons (i.e.,
CODIS-COmbined DNA Index System, involves 13 STR
loci) and the Dept. of Defense for armed service
personnel and the Virginia saliva and blood bank of
convicted felons
• A national DNA database has been suggested. What
do you think?
• Could current or potential employers or insurance
companies base decisions they make on this kind of
data?
13

14. Fig. 9.18 Random Amplified Polymorphic DNA (RAPD)
• Use of arbitrary oligonucleotide primers,
usually 9-10 nucleotides long, in a PCR of total
DNA to distinguish plant cultivars, animal
varieties, and microbe isolates
• A PCR product will be produced whenever two
of the oligonucleotide primers face one
another and are 100-3,000 bp apart
Chromosomal DNA Region of amplified DNA
14

15. Fig. 9.20 Real Time PCR
• A way to quantitate
DNA in a PCR
• Involves the use of
SYBR green dye
• SYBR green only
binds to and
fluoresces with
dsDNA
15

16. Fig. 9.16 Bacterial biosensors
• One example involves using Pseudomonas
fluorescens (genetically engineered for
bioluminescence) to monitor pollutants
• If pollutants are present in a sample, then cell
death occurs and “the light goes out”
lux genes in the
chromosomal DNA
16

17. Fig. 9.5 Bacterial biosensors (another example)
• Green fluorescent protein (GFP) can be used a
reporter gene under the control of some inducible
promoter (e.g., one that responds to some
environmental signal such as a toxin)
• If the signal is present GFP will be produced
17

18. Molecular Diagnosis of Genetic Disease
• Cystic fibrosis
• Sickle-cell anemia
18
1

19. What Is GM
FOOD?
• = genetically modified
• = changing the gene
19

20. GENES = information
in the cells that
tell the cells
what to do
20

21. Genetically Modified Organism-GMO
• A genetically modified organism (GMO) is any
organism whose genetic material has been
altered using genetic engineering techniques.
• GMOs are the source of genetically modified
foods and are also widely used in scientific
research and to produce goods other than
food.
21

22. • Genetic modification involves the mutation, insertion, or deletion
of genes. Inserted genes usually come from a different species in a
form of horizontal gene-transfer. In nature this can occur when
exogenous DNA penetrates the cell membrane for any reason. To
do this artificially may require:
• attaching the genes to a virus
• physically inserting the extra DNA into the nucleus of the intended
host with a very small syringe
• with the use of electroporation (that is, introducing DNA from one
organism into the cell of another by use of an electric pulse)
• with very small particles fired from a gene gun.
• Other methods exploit natural forms of gene transfer, such as the
ability of Agrobacterium to transfer genetic material to plants, or
the ability of lentiviruses to transfer genes to animal cells.
22

23. Uses of GMO
• GMOs are used in biological and medical research, production of
pharmaceutical drugs, experimental medicine (e.g. gene therapy),
and agriculture (e.g. golden rice, resistance to herbicides).
• The term "genetically modified organism" does not always imply,
but can include, targeted insertions of genes from one species into
another. For example, a gene from a jellyfish, encoding a
fluorescent protein called GFP, can be physically linked and thus co-
expressed with mammalian genes to identify the location of the
protein encoded by the GFP-tagged gene in the mammalian cell.
• Such methods are useful tools for biologists in many areas of
research, including those who study the mechanisms of human and
other diseases or fundamental biological processes in eukaryotic or
prokaryotic cells.
23

24. Genetically Modified Foods
Bt brinjal
Bt cotton
24

25. Background
Bt Brinjal, India’s (and the world’s) first genetically
modified food crop has been temporarily stopped
in India, thanks to a massive grassroots campaign.
Bt Cotton, however, is being cultivated in many
parts of India. Benefits are doubtful, though
Doubts exist about its productivity, and has been
implicated with negative effects, like resistant
test, high water consumption, farmer suicides,
etc.
25

26. Definition
What does Bt stand for?
Bt stands for Bacillus thuringiensis, which is a
natural soil bacteria, which secretes a toxin
that is deadly to two pests - fruit and shoot
borer (FSB, Leucinodes orbonalis) and fruit
borer (Helicoverpa armigera).
Eggplant
borer :
Helicoverpa
armigera
Cotton
bollworm:
Leucinodes
orbonalis 26

27. Definition
What is a genetic modification?
Insertion of
Bt gene in the
Brinjal
genetic code
Produce the
Bt Toxin to
kill the pest
But is only the gene introduced? No, a
PROMOTER and an antibiotic resistance MARKER
GENE are also introduced! 27

28. Definition
Protein production occurs at specific times and places
GENE EXPRESSION: A gene creates proteins only
at specific times and locations in an organism,
and in very tightly regulated amounts.
Example: Pancreatic cells have genes for
producing the insulin protein, and so do cells
in the eye.
Specific
location
Specific
amount
Specific
time
Expression is tightly regulated 28

29. Definition
Regulation
How does regulation occur?
For a gene to be expressed, specific chemical
factors need to bind to a PROMOTER region
and other regulatory region in the genetic
code upstream of the gene.
AAACCGGTATAATCCCCTGAGTTTGCCGTTAGTAG
Factor
binds
promoter
Factor binds
regulatory
region Promoter
GeneRegulatory
region
29

30. Definition
Regulatory region
Therefore a gene is expressed only when specific
agents bind to promoter and regulatory
regions at specific time and at specific cell
types (eye cell vs pancreatic cell).
Though promoter sequence are known,
information about regulatory regions and
what factors binds to them is mostly
unknown.
30

31. Definition
BT Gene insertion
A BT modified brinjal has a BT gene inserted,
along with a promoter element(Cauliflower
Mosaic Virus (CaMV) promoter)
The promoter is so powerful that it keeps the BT
gene expression turned on at full volume at all
times in BT Brinjal!
This could lead to metabolic stress as the plant
has to keep producing this toxin despite the
external conditions.
31

32. Definition
BT Gene insertion
A BT modified brinjal has a BT gene inserted,
along with a promoter element(Cauliflower
Mosaic Virus (CaMV) promoter)
ACTGTCTATGTA + TACGTATAATGGTAGATTTATATGGG
TAACTGTCTATGTACGTATAATGGTAGATTTATATGGG
Gene
Promoter
BT Gene
BT Gene
Promoter
Insertion point
32

33. The insertion is carried out using an mobile
microbial DNA which infects the host cell (for
dicotyledons like lugumes, or by a gene gun
(gold pellets carrying fragments of DNA),
either which performs the random insertion in
some of the target cells.
Target
cell
Target
cellTarget
cell
Microbial
Vector
Gene
gun
Definition
Insertion process
Create primary
transformant
33

34. Definition
BT Gene insertion
Microbial Vector has the genetic sequence of
toxin present in a part of an insertion
sequence.
AACCGTGGTGGGTCCCAATTAGGGTTACCGGGG
Gold Pellet
AACGTTCCGTT
The gene gun shoots gold pellets having the sequence of interest
34

35. Target
cell
Target
cellTarget
cell
Definition
Result of insertion process
Only some of the target cells successfully incorporate the gene
To identify the successfully converted viable cells, an
antibiotic resistance marker gene IS ALSO INSERTED
35

36. Definition
Resistance marker gene
AACCGGTTGGTTGGGTTTGGGGGGGCCGGTTAAA
Insertion sequence
Resistance marker gene
Bt genePromoter
Sequence
The target cells which successfully incorporate the insert
sequence are selected on the basis of their resistance to an
antibiotic
36

37. Definition
Result of insertion process
Target
cell
Target
cellTarget
cell
Antibiotic
Target
cell
Only target cells
survive based on
resistance to
antibiotics
37

38. Definition
Create final hybrid variety
Primary
transformant
bacterial plasmid
DNA
(pMON10518)
Hybrid variety
MHB 4, 9, 10,
80, 99
Backcross
Final variety
Bt MHB
Final variety needs high amounts water and
fertilisers . 38

39. Effects
Random
insertion
Transformation-induced “unexpected” changes might
lead to unexpected production of toxins, allergens,
carcinogens (rotenone – Parkinson’s) or teratogens in
the transformed cells.
Domingo, J.L., Toxicity Studies of Genetically Modified
Plants, Critical Rev Food Sc and Nutrition 47: 721-33
(2007)
Antibiotic
marker
Can confer antibiotic resistance to gut bacteria and
other organisms.
Jumping
gene
(plants)
Transgene-vector recombinant DNA had the capacity of
‘jumping into' alien species, it could also ‘jump out' of a
transgenic crop and ‘jump into' another species causing
gene contamination.
Jumping
gene
(animals)
Evidences are now available that show that DNA from
GM plants can survive in the human gastrointestinal
tract.
Netherwood,T. et al Nature Biotechnology 22, 204 - 209 (2004)
39

40. Advantages?
Yield not shown to
increase in Bt
Cotton or GM Soy
Increased use of
water for Bt cotton
Increase use of
pesticides
Mahyco admits
unable to control
pests in Gujarat
with Bt Cotton
40

41. Disadvantages
Could lead to
genetic
contamination
Will make us
dependent on
Monsanto for food
Monoculture will
wipe out diversity
Farmers suicides
have doubled in Bt
cotton belt in
Vidarbha
41

42. Evidence
Long terms lab
tests on rats have
all shown ill-
effects
Monsanto /
Mahyco uses their
own datasets to
show yield
increase
Long term human
tests not done
Monsanto made
tests only on few
rats (10) for only 3
months
42

43. Evidence
Non-target effects of GM food crops
•21 reported harmful environmental effects;
•44 reported unexpected changes in plant physiology;
•20 reported unpredicted changes in plant morphology;
•6 reported a decrease in the food or feed quality
•4 reported scrambling of both the transgene and host DNA
Effect on animals
(a) Arpad Putszai paper in the Lancet, showed the unpredicted changes
(b) in the gastro-intestinal mucosa of rats fed with GM potato;
(c) A 90-day internal company study on rats fed with MON863 Bt-maize showed
decreased body-weight and severe toxic effects in the liver and kidneys;
(c) a 20-week feeding study by the Austrian Federal Ministry of Health revealed
lower fertility and reduced birth weight in mice fed with Bt-maize;
(d) a study carried out in the Italian government’s National Institute of Research on
Food and Nutrition showed that very young and old mice fed with Bt-maize
(MON810) for 90 days were immunologically compromised
43

44. Future Directions
Do we really need this?
We already have
varieties
Benefit to
corporations
Danger to
consumers
Negative effects on
farmers
44

45. Future Directions
Tissue specific
expressions
(instead everywhere
like root)
Chloroplast
transformation
(instead of nuclear
transformation)
Use safer
promoters
(CaMV promoter
aggressive, similarity
to HIV)
Site-directed, non-
random insertion
(Gene stacking
Golden rice)
45

46. Future Directions
GM potato,
tomato, rice,
everything in the
waiting
BRAI act will make
it illegal for ‘non-
scientists’ to
question GM
Loss of diversity
will make crops
susceptible
Control of food for
the world
46

47. Dolly
The first successful cloned animal
47

48. What was Dolly?
• In 1997 Dolly the sheep became the first
vertebrate cloned from the cell of an adult
animal. Not only was this a remarkable
scientific breakthrough but it immediately
gained interest and concern from around the
world on the future of cloning technology as it
would effect humans.
48

49. • Dolly the sheep was successfully cloned in Britain in 1996 by the scientist
“Ian Wilmut” and was put down in February 2003 after developing a lung
infection and arthritis.
• Dolly was a genetic copy of the Finn Dorset ewe.
• Her birth, more than 10 years ago showed that nuclei from specialized
adult cells can be reprogrammed into all the cells of an organism.
• The technique that led to Dolly is called
• somatic cell nuclear transfer and has
• remained essentially unchanged over
• the last decade.
Dolly: The Cloning of a Sheep
49
2

50. Topics of Discussion
• What is cloning?
• Methods of cloning
• Dolly in detail
• Dolly’s probability
• Today’s legality
• The future of cloning
• Ethical final questions
50

51. What is cloning?
• Reproductive cloning- The entire animal is produced
from a single cell by asexual reproduction. This would
allow for the creation of a human being who is
genetically identical to another.
• Therapeutic cloning- Broader use of the term “cloning.”
Does not create a new genetically identical individual.
Research includes therapy for human mitochondria
disease and others that could replace damaged or
diseased tissues without the risk of rejecting another’s
tissue. Could create new skin tissue for burn patients.
51

52. Other types of cloning
– Multiple copies of genes or gene fragments,
repeating nucleotide sequences
– Single cell organisms, like bacteria and fungi. This
includes fermentation processes for production of
bread, beer, and wine.
– Entire plant asexual replication
– Natural cloning occurs in sexual reproduction,
when the embryo splits in two to produce twins.
52

53. Methods of cloning
– Embryo splitting- Artificially splitting a single
embryo at a very early stage of development. In
the natural process this would create twins.
However, because this is done at an early stage
and there are usually less than eight cells you can
only make a few clones. Both the nuclear genes
and mitochondria genes would be identical.
53

54. Methods of cloning
– Nuclear replacement- Genetic material (nucleus from
embryonic, fetal, or adult cell) is removed and placed
into an unfertilized egg or embryo, whose nucleus has
been removed. In this case the nuclear genes remain
the same but the mitochondria DNA would be
different. This has the potential to create the clone of
an adult organism as well as many clones at once.
54

55. Dolly in detail
– Dolly was cloned using the nuclear replacement method. Again
the nucleus with chromosome sets is fused with an unfertilized
egg whose nucleus has been removed.
– Motivating factor was that it could help to improve certain
qualities in livestock.
– Dolly was not the first sheep to be created from nuclear
replacement. Two genetically identical sheep, Megan and
Morag were born in 1996 using the technique. The difference
was that Dolly was derived from an adult sheep, and Megan and
Morag were from a sheep embryo.
55

56. Dolly’s probability
– Cells taken from a six-year-old Finnish Dorset ewe and
cultured in a lab.
– 277 cells then fused with 277 unfertilized eggs (each
with the nucleus removed)
– 29 viable reconstructed eggs survived and were
implanted in surrogate Blackface ewes.
– 1 gave birth to Dolly
– 0.361% chance at onset, 3.4482% once implanted. In
nature between 33-50% of fertilized eggs develop.
56

57. Cloning Dolly
• Enucleate the eggs produced by Scottish Blackface
ewes (female sheep).
– Treat the ewes with gonadotropin-releasing hormone
(GnRH) to cause them to produce oocytes ready
to be fertilized. Like all mammals, these are
arrested at metaphase of the second meiotic
division (meiosis II).
– Plunge a micropipette into the egg over the polar
body and suck out not only the polar body but the
haploid pronucleus within the egg.
57

58. • Fuse each enucleated egg with a diploid cell growing in
culture.
– Cells from the mammary gland of an adult Finn Dorset ewe (they have
white faces) are grown in tissue culture.
– Five days before use, the nutrient level in the culture is reduced so
that the cells stop dividing and enter G0 of the cell cycle.
– Donor cells and enucleated recipient cells are placed together in
culture.
– The cultures are exposed to pulses of electricity to
• cause their respective plasma membranes to fuse;
• stimulate the resulting cell to begin mitosis (by mimicking the stimulus of
fertilization).
58

59. • Culture the cells until they have grown into a morula
(solid mass of cells) or even into a blastocyst (6 days).
• Transfer several of these into the uterus of each (of
13, in this case) Scottish Blackface ewes (previously
treated with GnRH to prepare them for implantation.
• Wait (with your fingers crossed).
• The result: one ewe gave birth (148 days later) to
Dolly.
59

60. 60

61. How do we know that Dolly is not the
progeny of an unsuspected mating of the
foster mother?
• She has a white face and the foster mother is
a Scottish Blackface
• DNA fingerprinting reveals bands found in
Finn Dorset sheep (the breed that supplied
the mammary cells), not those of Scottish
Blackface sheep
61

62. What about Dolly's telomeres?
• It turns out that her telomeres are only 80% as long
as those in a normal one-year-old sheep.
• The examination of DNA from Dolly's cells revealed
that her telomeres were abnormally short.
• It is known that telomeres are sequences located at
the end of each chromosome. These sequences
protect DNA from degradation by exonucleases. In
fact, telomeres are constantly degraded and
restored.
62

63. • The balance becomes negative as the cells age,
• leading to a degradation of chromosomes and to cell
death after about 50 multiplications.
• Dolly's telomeres were short but this was also the
case for the donor cell line, which was derived from
an old sheep and was cultured over a long period of
time.
63

64. • It was prematurely suggested that cloning
might generate old newborns.
• In all the cloned animals obtained after
Dolly and in which DNA was examined, the
length of telomeres was normal or longer
than normal.
• This was also true for clones derived from a
17-yearold bull.
• It is also interesting to note that the two
lambs born after Dolly was naturally
fertilized have normal telomeres.
64

65. What about Dolly's mitochondria?
• Although her nuclear genome came from the
Finn Dorset ewe, her mitochondria came from
cytoplasm of the Scottish Blackface ewe.
Mitochondria carry their own genome and so
with respect to the genes in mitochondrial
DNA, she is not a clone of the Finn Dorset
parent.
65

66. Golden Rice technology

67. • Golden rice is a variety of Oryza sativa
rice produced from genetic engineering
• Biofortification-noun. The creation of
plants that make or accumulate
micronutrients
• Main purpose is to provide pro-vitamin
A to third world, developing, countries
where malnutrition and vitamin A
deficiency are common
Introduction
3

68. Classification of Oryza sativa
• Common Name: Asian Rice
• Kingdom: Plantae
• Phylum: Anthophyta
– Monocot
• Class: Commelinids
• Order: Poales
• Family: Poaceae
• Genus: Oryza
• Species: O. sativa
• Binomial Nomenclature: Oryza sativa

69. Why Rice?
• Other plants, such as sweet potatoes have varieties that are either
rich (orange-fleshed) or poor (white fleshed) in pro-vitamin A
• Carrots were originally white or purple in the 1600’s. A Dutch
horticulturist mutated the carrot to produce carotenes to symbolize
the color of the Dutch Royal House of Orange
• Global staple food. Cultivated for
over 10,000 years
• Rice provides as much as 80
percent or more of the daily caloric
intake of 3 billion people, which is
half the world’s population

70. Who Began the Golden
Rice Project?
• Started in 1982 by Ingo Potrykus-Professor emeritus of the Institute for Plant
Sciences
• Peter Beyer-Professor of Centre for Applied Biosciences, Uni. Of Freiburg,
Germany
• Funded by the Rockefeller Foundation, the Swiss Federal Institute of
Technology, and Syngenta, a crop protection company.
• Golden Rice Humanitarian Board-
responsible for the global development,
introduction and free distribution of Golden
Rice to target countries.

71. Effects of Malnutrition
• Symptoms of vitamin A deficiency (VAD) include;
night blindness, increased susceptibility to infection
and cancer, anemia (lack of red blood cells or
hemoglobin), deterioration of the eye tissue, and
cardiovascular disease
• Nearly 9 million children die from malnutrition each
year. A large proportion of those children die from
common illnesses that could have been avoided
through adequate nutrition
• The reduced immune competence increases the
morbidity and mortality rates of children

72. Goals: More is What We Aim For
• Mutate rice plants to produce carotenoids, or organic
pigments, specifically β-carotene (pro-vitamin A) in
the endosperm, the edible part of the grain
• Make Golden Rice accessible locally, free of charge to
farmers, who are able to grow, save, consume,
replant and locally sell Golden Rice
Vitamin A
(Retinol)

73. How Does It Work?
• The addition of 2 genes in the rice genome will complete the
biosynthetic pathway
– 1. Phytoene synthase (psy) – derived from daffodils
(Narcissus pseudonarcissus)
– (Phytoene synthase is a transferase enzyme involved in
the biosynthesis of carotenoids. It catalyzes the conversion
of geranylgerany pyrophosphate to phytoene.)
– 2. Lycopene cyclase (crt1) – from soil bacteria Erwinia
uredovora
• Produces enzymes and catalysts for the biosynthesis of
carotenoids (β-carotene) in the endosperm

74. • The end product of the engineered pathway
is lycopene, but if the plant accumulated
lycopene, the rice would be red.
• Recent analysis has shown the plant's
endogenous enzymes process the lycopene
to beta-carotene in the endosperm, giving
the rice the distinctive yellow color for which
it is named. The original golden rice was
called SGR1, and under greenhouse
conditions it produced 1.6 µg/g of
carotenoids.
4

75. ADVANTAGE
• Golden rice give more quantity vitamin-A
• Easy distribution when released to needy
• Cheaper option to supply vitamin A requirement compared to other
supplementary measures
• Sustainable option as once released for common cultivation can be
cultivated every growing season by farmer saved seeds, therefore no
need of yearly budgetary investment for distribution

76. • Health
– May cause allergies or fail to perform desired effect
– Supply does not provide a substantial quantity as the
recommended daily intake
• Environment
– Loss of Biodiversity. May become a gregarious weed and
endanger the existence of natural rice plants
– Genetic contamination of natural, global staple foods
• Culture
– Some people prefer to cultivate and eat only white rice
based on traditional values and spiritual beliefs
DISADVANTAGE

77. References
• Images references:
1.
https://lh5.ggpht.com/EdoHRei05BEjK96Qf0jwKaXPX_pWx4zLWbXQrf4Gl
yy2B5aBbKu4F6R0RSwcrVtVQ0MXzA=s85
2. https://lh6.ggpht.com/aD8KIJk82lKoSXzfALpHrOc7K6TnPYdRHXyQcvnvK
bCWYqWWZWRjIDuzxH8C5TDdRJBA=s149
3. https://lh6.ggpht.com/jkL6UjXwi_4Tlg21Pcs4Obgx-QRD6-
oDK1Mv9HJ_j8SMOY5tNT4MrJUuqNxMkPJDhLt6Lw=s85
4. https://lh3.ggpht.com/xFW64QK5okgeprEU-
2fDDAzRofcKksbPVIxCs3ieYE_vFd18NmXKJVGxTjOnJoXk39XckQ=s85
• Reading references:
• Gene cloning and DNA analysis by TA Brown