The document provides a 6-step guide to designing sgRNA-coding oligonucleotides for CRISPR experiments. It explains that the oligos are used to clone DNA sequences encoding sgRNA into plasmids. The 6 steps are: 1) determine the genomic target sequence, 2) add the PAM sequence, 3) design the spacer sequence, 4) add overhangs to the spacer for the top oligo, 5) design the bottom oligo as the complement, and 6) check that the oligos anneal correctly. Verification steps are also recommended to check for errors like confusing DNA and RNA sequences.

1. www.tupac.bio support@tupac.bio
0
Guide to sgRNA-coding
oligo design v1.0
By Elena Kayayan and Eli Lyons
www.tupac.bio

2. www.tupac.bio support@tupac.bio
1
Guide to sgRNA-coding oligo design v1.0
Background on sgRNA-coding oligo design
• sgRNA allows the endonuclease enzymes Cas9 and dCas9 to target specific genome
locations.
• sgRNA is commonly synonymous with ‘gRNA’.
• sgRNA-coding oligos are commonly used to clone DNA sequences that code for sgRNA
into CRISPR plasmids.
• The term ‘spacer’ refers to the DNA coding for the sgRNA. To avoid confusion, the term
‘sgRNA-coding oligo(s)’ is used in this document to describe what may be referred to as
‘gRNA oligos’ in other published work.
• The term proto-spacer may also be used to refer to the genomic target sequence
(pictured in red in Figure 1),
• DNA oligo design involves complex steps, is difficult to visualize and therefore prone to
error.
• Any mistakes in the design of the oligos results in incorrect targeting, therefore resulting in
sunk cost in the wet lab processes.
• sgRNA-coding oligo sequence verification is extremely important, as the cost of mistakes
is high.

3. www.tupac.bio support@tupac.bio
2
Outline of design steps
Step 1: Determine genomic target sequence..................................................................2
Step 2: Determine genomic target DNA sequence with PAM sequence at 3’
end......................................................................................................................................................3
Step 3: Design spacer sequence ...........................................................................................3
Step 4: Add overhang to sequence from step 3 to determine top oligo
sequence .........................................................................................................................................3
Step 5: Design the bottom oligo sequence .......................................................................3
Step 6: Check how the designed oligos would anneal................................................4
Verification ......................................................................................................................................4
Step 1: Determine genomic target sequence
The DNA sequence to be targeted (‘genomic target sequence’) can be found either by:
o Using a previously designed target sequence from a reference paper
o Using a tool to find a suitable target sequence
o Manually searching for a target sequence that is adjacent to a PAM sequence in
a target genomic region
If you are using a previously used target sequence (e.g from a paper):
o Determine which strand contains the actual PAM sequence (either NGG or NGA),
as opposed to the complement of the PAM sequence (NCC or NCT).
If you are not starting with a target sequence as a given:
o Ensure that one of the ends of your target sequence has a PAM sequence (either
‘NGG’ or ‘NGA’ when viewing the strand in the 5’ to 3’ direction, or ‘GGN’ or
‘AGN’ when viewing the strand in the 3’ to 5’ direction).
Example: The target sequence, the human genomic region chr4: 58110375-58110396 , has a
PAM sequence on the negative strand:
The target sequence on this strand is therefore 3’ – GGTTACCATGATACCCCCTCCGTTT – 5’
when read from the 3’ to 5’ direction. When read from the 5’ to 3’ direction, the sequence is
5’ – TTTGCCTCCCCCATAGTACCATTGG – 3’, where TGG is the PAM sequence (N = T).

4. www.tupac.bio support@tupac.bio
3
Step 2: Determine genomic target DNA sequence with PAM
sequence at 3’ end
If the PAM sequence isn't already at the end of the genomic target sequence when reading
in the 5’ to 3’ direction, determine the sequence of the strand containing the PAM when the
PAM is at the end (when reading from the 5’ to 3’ direction) by reversing the sequence.
Example: The reverse of the genomic target sequence from step 1 is
5’-TTTGCCTCCCCCATAGTACCATTGG –3’
Step 3: Design spacer sequence
Design the spacer sequence for the top oligo by removing the PAM sequence from the
sequence designed in step 2.
If the human U6 promoter is being used as the promoter for the sgRNA, then ensure that the
sequence is preceded by a ‘G’, or add one if there isn’t one already. This is because the
human U6 promoter prefers a ‘G’ at the transcription start site to have high expression. This
‘G’ is not found in the resulting expressed sgRNA.
The sequence designed in this step is part of the top oligo sequence.
Example: Continuing from the previous step, you would design the spacer sequence with a
‘G’ for high transcription to be GTTTGCCTCCCCCATAGTACCAT.
Step 4: Add to sequence from step 3 to determine top oligo
sequence overhang
Add the cloning overhang for the restriction enzyme you will be using (see Figure 2. b) to the
5’ end of the sequence designed in step 3. This step completes the design of the top oligo for
sgRNA.
Example: Zhang lab plasmids are often used for CRISPR experiments. They can be digested
at a BbsI restriction enzyme site, into which the oligos of interest can be cloned. This digestion
produces the following overhangs in the plasmid:
Therefore, if BbsI was used, the top oligo from the previous examples would need a
sequence at its 5’ end that is complementary to the left side ‘GTGG’ overhang. So the top
oligo would need an added ‘CACC’, like so: CACCGTTTGCCTCCCCCATAGTACCAT
Step 5: Design the bottom oligo sequence
The bottom oligo sequence is the sequence complementary to that designed in step 3, with
the cloning overhang (see Figure 2. b) added to its 3’ end.
Example: The sequence complementary to the example in step 4 would be
CAAACGGAGGGGGTATCATGGTA. Since the BbsI restriction enzyme is being used, the right
side overhang CAAA then needs to be added to the end of the sequence. The result is the
bottom oligo sequence, CAAACGGAGGGGGTATCATGGTACAAA.

5. www.tupac.bio support@tupac.bio
4
Step 6: Check how the designed oligos would anneal
Ensure that the sgRNA oligos’ spacer sequences (see Figure 2. b) align correctly by lining
them up and checking for base-pair complementarity.
Example: Based on the previous steps, the oligos would anneal like so:
CACCGTTTGCCTCCCCCATAGTACCAT
CAAACGGAGGGGGTATCATGGTACAAA
Verification
Further verification can be done by taking the following optional steps:
• One of the most common mistakes is to confuse the oligo sequence (DNA) with
the sgRNA sequence (RNA). This may occur because some papers use the same
terms to describe the DNA coding for the sgRNA, and the sgRNA and the target
DNA template sequence. In practice, this may not affect oligo design, but the
designed oligos should be checked to confirm that the spacer sequence is
composed of DNA nucleotides and identical in sequence to the genomic target
sequence, as opposed to complementary.
• Align the top oligo sequence to the target DNA template sequence and check
that the sgRNA transcribed from the oligos designed has equivalent bases to the
genomic target sequence, excluding the restriction enzyme site at the oligo’s end
(see Figure 2. c).
• Check that the annealed oligos can be cloned correctly into the destination
plasmid of interest (e.g by drawing out the DNA construction plan or using
software to simulate DNA construction).
• Check that neither the PAM sequence nor the reverse complement of the PAM
sequence are present in the oligos or the sgRNA transcribed from the oligos.

6. www.tupac.bio support@tupac.bio
5