Chromosome and Gene Mutations Guide

ChromosomaI Aberrations (Genome
mutation) & Gene mutation
Jigar V. Patel
Lecturer
Department of Zoology
Government Science Collage, Vankal
Ta. Mangrol, Di. Surat-394430
Email. pateljigar1818@gmail.com

Mutation
Mutation is a spontaneous change of a gene or
chromosome (Genetic code) from one form to
another. It produces an alteration in the character
under its control.
Dobzhansky stated that mutation is a mistake in cell
division.
 The term mutation was introduced by De Vries.

 Genes are exceedingly stable units. They are
reproduced and copied exactly during meiosis or
gamete formation.
 Nevertheless mistakes occasionally occur during the
copying or replication of genes during meiosis.
 These mistakes represent mutation. Once a mutation
occurs, it is then reproduced and copied exactly
during meiosis.
 Mutations are the basis of discontinuous variation in
population. Mutations may occur at chromosomal
level or gene level.

1. Genome Mutations (Chromosomal
Mutations)
 The changes in the structure and number of
chromosomes (genome) are called genome
mutations. Since these mutations occur at the
chromosomal level, they are also called chromosomal
aberrations. The genome is defined as the total
genetic material contained within the chromosomes
of an organism. Humans have 46 chromosomes.

 Our 46 chromosomes represent our genome. Genome
mutations occur at a frequency of 1/10000 to
1/1000000. Genomic mutations take place due to
abnormalities in cell divisions, especially during
gametogenetic meiosis.
 Chromosome abnormalities are changes resulting in a
visible alteration of the chromosomes.
 Most chromosomal aberrastions are produced by
misrepair of broken chromosomes, by improper
recombination or by malsegregation of chromosomes
during mitosis or meiosis.

Types of Chromosomal Abnormalities
 A chromosomal abnormality present in all cells of the
body is called constitutional abnormality.
 If it is present in only certain cells or tissues it is
called somatic or acquired abnormality.
 Constitutional abnormalities are the result of an
abnormal sperm or egg or maybe abnormal
fertilization or an abnormal event in the early
embryo.

 They may occur due to change in structure of
chromosomes or due to change in the chromosome
number. Any change in individual genes has not
been considered in genome mutations. Genomic
mutations are analyzed with cytological
investigations of cells. Genome mutation is of two
types, namely
1. Changes in the structure of chromosomes.
2. Changes in the number of chromosomes.

1. Change in the Structure of
Chromosome
 The chromosome contains genes. The change in the
structure of chromosome bring about changes in the
number and arrangement of genes. These are of 4
types, namely
1. Deletion
2. Duplication
3. Inversion
4. Translocation

Deletion
 Deletion is a chromosomal aberration where a
segment of the chromosome is lost.
 Here some genes are lost. Deletion is of two types,
namely terminal deletion and intercalary deletion.
 In terminal deletion, a terminal segment is lost. In
intercalary deletion, an intermediate segment of the
chromosome is lost.
 When deletion occurs in one member of a
homologous chromosome, a deletion loop is
produced in the normal homologous chromosome.

 The deletion loop is formed by the segment opposite
to the deleted segment. It occurs during pairing in
meiosis.
 In human babies, deletion of a segment of
chromosome number 5 causes a disease called cridu-
chat syndrome. The baby cries like a cat; it is
mentally retarded with small head.

Duplication
• Duplication is a chromosomal aberration where a
segment is repeated. Hence a set of genes is present in
double doses.
• Duplication produces position effect (A phenotypic
effect produced by change in position of a gene or a
group of genes is call position effect).

Inversion
 Inversion is a chromosomal aberration where a
segment of chromosome breaks and reunites in the
reverse order.
 In inversion, there is no loss or gain of genes. But the
genes are rearranged in reverse order.

 Inversion is of two types, namely pericentric
inversion and paracentric inversion. In pericentric
inversion, the centromere is included in the inverted
segment. In paracentric inversion, the centromere is
not included in the inverted segment.
 The chromosome with the inverted segment
produces an inversion loop. Inversion prevents
crossing over. It brings about position effect.
Inversion produces variation and speciation.

Translocation
 Translocation is a chromosomal aberration where
non- homologous chromosomes exchange segments.
 Translocation produces a cross-shaped structure
during pairing. Translocation causes position effect.
Translocation alters the linkage groups.

2. Change in the Number of Chromosomes
 Change in the number of chromosomes is called
ploidy.
 Ploidy may be due to a loss or gain of a chromosome
of a set or changes in the number of chromosome
sets. Based on this, there are two kinds of ploidy,
namely
1. Aneuploidy
2. Euploidy

1. Aneuploidy
 Aneuploidy is a chromosomal aberration where there
is a Bam or loss of one or more chromosomes in a
set. Aneuploidy is caused by non-disjunction(failure
of homologous chromosomes or sister chromatids to
separate properly during cell divisions) of
chromosomes. It is of three types, namely,
1. Monosomy
2. Nullisomy
3. Trisomy

Monosomy
• Monosomy is a chromosomal aberration where one
chromosome is lost from a pair. It is represented by
2n-1. The monosomic individual has one
chromosome less from the normal number of
chromosomes. A monosomic Drosophila has 8-1=7
chromosomes. A monoSomic man has 46-1=45
chromosomes.
• It is an aneuploidy.
• It is produced in woman when an egg without an X
chromosome fuses with a sperm containing an X
chromosome. It causes a syndrome called Turner’s
syndrome.

Nullisomy
• Nullisomy is a chromosomal aberration where both
chromosomes of a pair are lost. It is represented by
2n-2.
• It is an aneuploidy.
• A nullisomy is produced by the fusion of gametes
having one chromosome less. Nullisomic individuals
cannot survive.
• Nullisomy with the loss of a pair of chromosomes.

Nullisomic cell-
without 1
chromosomal pair

Trisomy
 Trisomy is a chromosomal aberration where one
chromosome is added to a pair. It is represented by
2n+1. A trisomic individual has an additional
chromosome from the normal number. Thus a
trisomic Drosophila has 8+1=9 chromosomes. A
trisomic man has 46+1=47 chromosomes.
 It is an aneuploidy.
 Trisomy is caused by non-disjunction.

• There are two types of trisomy, namely trisomy of
autosomes and trisomy of sex chromosomes.
• Trisomy of autosome is due to the addition of one
chromosome to any one homologous pair of
autosome. When a chromosome is added to 21st
pair of autosome, it is called trisomy-21.
• Trisomy-21 in man causes a syndrome called Down’s
syndrome (Mongolism). A trisomic man has 47
chromosomes instead of 46. They are mentally
retarded. They have broad face and flat stubby nose.
Trisomy of sex chromosome is due to the addition of
one sex chromosome.

• When an X chromosome is added to a man, he
has 47 chromosomes, 22AA+XXY. It causes a
syndrome called Klinefelter’s syndrome.

2. Euploidy
 Euploidy is a chromosomal aberration involving
change in the number of chromosome sets. It is of
two types, namely
1. Haploidy
2. Polyploidy
 Haploidy or Monoploidy The basic set of
chromosome in any species is haploid; each
chromosome is represented singly; that is (N)
number.

• The gametes carry haploid number of chromosomes.
During fertilization the parental chromosomes unite
together by the fusion of gametes forming diploid
number (2N) of chromosomes.
• Sometimes in the life of an animal a set of
chromosomes will be lost and this leads to haploidy.
So some characters which are present in any parent,
will be lost from the resulting individual.

Polyploidy
 Polyploidy is the condition in which an organism
contains more than the usual two sets of
chromosomes. Such animals are said to be polypłoid.
 Polyploid organisms may have three, four or more
sets of chromosomes and they are called triploids
(3N); tetraploids (4N); pen- taploids (5N); hexaploids
(6N) hectaploids (7N); octoploids (SN); nanoploids
(9N); decaploids (10N) and so on.

 Połyploidy may be autopolyploidy or
allopolyploidy.
 In autopolyploidy, the chromosome sets are derived
from the same species so no addition of new genes
occurs but in allopolyploidy the chromosome sets are
derived from distinct species it involves the addition
hew genes hence much variations occur in organisms.
 These variations are inherited by the offspring which
seem to be different from their parents.

Origin of Polyploidy
 The polyploid condition arises owing to the
abnormalities in division, During gametes formation,
the homologous chromosomes may not separate
completely; hence one cell is formed with the diploid
number of chromosomes and the other cell without
any chromosome.
 During fertilization, such a gamete with two sets of
chromosomes pair with a gamete having haploid (N)
number of chromosome.

 Resulting individual is a Tetraploid (4N).
 When both diploid gametes belong to the same
species, the resulting tetraploid is called
autotetraploid.
 When the two diploid gametes belong to two
different species the resulting tetraploid is called
allotetraploid.

II. Gene Mutations
 The change in the base sequence of genes is called
gene mutation. Mutation produces an altered gene.
The organism carrying the altered gene is called a
mutant. The organism carrying the normal
(unaltered) gene is called wild type.
 The process of producing mutation is called
mutagenesis. Mutation is classified into the following
types:

Spontaneous Mutation
 The mutation occurring naturally is called
spontaneous mutation. It is due to normal cellular
operations or due to random interactions with the
environment.

Induced Mutation
 Artificially produced mutations are called induced
mutations. They are caused by certain factors called
mutagens. Mutagens may be physical or chemical
factors. Eg. X-rays, nitrous acid, etc.

Point Mutation
 When a single base pair is altered, the mutation is
called point mutation. A point mutation is classified
into three types, namely
• Base substitution
• Base insertion
• Base deletion
• Base inversion
•
• In base substitution, a base is replaced py another base.
• In base insertion, a new base is inserted.
• In base deletion, a base is missing.
• In base inversion, the base sequence reversed.

Missense Mutation
 Sometimes in a polypeptide chain, an amino acid is
substituted by another amino acid. This is due to
substitution of three bases (a codon) in the DNA. This
mutation is called missense mutation.

Temperature Sensitive Mutation
 In some cases, substitution of bases produces a
protein that is active at one temperature (typically 30°
C) and inactive at a higher temperature (usually 40 –
42° C). This mutation is called temperature sensitive
mutation or Ts mutation.

Non-sense Mutation
 Sometimes mutation produces a base sequence that
does not code for any amino acid (non-sense codon).
 In such cases, termination of the synthesis of protein
occurs at this point. This mutation is called non-sense
mutation or chain termination mutation. There are
three kinds of non-sense mutations. They are amber,
ochre and opal.

Silent Mutation
 Substitution of 3 bases in the DNA may result in the
substitution of a new amino acid in the polypeptide
chain.
 When the substituted amino acid is closely related to
the original amino acid, mutation has no detectable
effect on the phenotype of the cell. This mutation is
called silent mutation.

Leaky Mutation
 When the substitution of an amino acid results in the
reduction in the activity of the protein or enzyme, the
mutation is called leaky mutation.
 For example, a bacterium carrying a leaky mutation
in the enzyme will grow very slowly, when the
enzyme controls the synthesis of an essential
substance.

Transition
 Transition is a point mutation where one purine base
is substituted by another purine or one pyrimidine
base is substituted by other pyrimidine.
 Eg. G-C pair is exchanged with an A-T pair vice
versa.

Transversion
 Transversion is a point mutation where a purine is
replaced by Pyrimidine or vice versa.
 Eg. An A-T pair is replaced by a T-A C-G pair.

Base-analogue Mutation
 Certain chemicals are similar to the bases of DNA.
These chemicals are called base- analogues.
 The base-analogue has the ability to pair with a base
of the DNA causing an alteration in the gene.
 The mutation caused by the pairing of a base-
analogue with a base the DNA is called base-
analogue mutation.
 The base 5-bromouracil (BU) is an analogue of
thymine.
 Hence BU functions like thymine and can easily pair
with adenine causing base-analogue mutation.

Frameshift Mutation
 A mutation that inserts or deletes a single base will
change the reading frame for the entire subsequent
sequence.
 A change of reading frame is called frameshift
mutation.
 When the genetic code is read in non-overlapping
triplets, there are three possible ways of translating a
nucleotide sequence into protein, depending on the
starting point. These are called reading frames For
example, the following sequence has three reading
frames:

 DNAsequence
ACGACGACGACGACGACGACGACG
 Reading frames
• ACG ACG ACG ACG ACG ACG ACG
• CGA CGA CGA CGA CGACGA CGA
• GAC GAC GAC GAC GAC GAC GAC
 The base shift mutation is induced by acridine
compounds that bind to DNA and distort the structure
of the double helix causing additional bases to be
incorporated or omitted during replication.

Back Mutation
 The regaining of normal (wild) gene by mutation is
called back mutation or reverse mutation or
reversion.
 A reverse mutant is called a revertant. As a result of
back mutation, the original wild type phenotype is
regained.

Hot Spot
 Hot spot is a site of DNA at which the frequency of
mutation is very high.
 Hot spots are not frequent.
 Some hot spots yield large deletions rather than point
mutations.
 The mutation frequency can be very high at a Me C
site. Hence Me C site is a hot spot.

 An individual with a somatic abnormality is a mosaic,
containing cells with two different chromosome
constitutions, with both cell types deriving from the
same zygote.
 Occasionally, abnormalities have been identified in
which chromosomes have the correct number and
structure, but represent unequal contributions from
the two parents.

Numerical Chromosomal
Abnormalities
 Three classes of numerical chromosomal
abnormalities can be distinguished. They are
1. Polyploidy
2. Aneuploidy and
3. mixoploidy.

Polyploidy
 In human pregnancies, about 3% are triploids.
 The most usual cause is two sperm fertilizing a single
egg (dispermy); sometimes the cause is a diploid
gamete. Triploids very seldom survive to term and the
condition is not compatible with life.

 Tetraploidy, is much rarer and always lethal. It is
usually due to failure to complete the first zygotic
division: the DNA has repliated to give a content of
4C, but cell division has not then taken place as
normal.
 Although constitutional polyploidy is rare and lethal,
all normal people have some polyploid cells.

Aneuploidy
• Euploidy means having complete chromosome sets
(n, 2n, 3n, etc.).
• Aneuploidy is the opposite, that is, one or more
individual chromosomes extra or missing from a
euploid set.
• Trisomy means having three copies of a particular
chromosome in an otherwise diploid cell, for example
trisomy 21 (47,XX or XY, +21) in Down syndrome.

• Monosomy is the corresponding lack of a
chromosome, for example monosomy X (45,X) in
Turner syndrome.
• Cancer cells often show extreme aneuploidy, with
multiple chromosomal abnormalities.
• Aneuploid cells arise through two main mechanisms:

Non disjunction
 Failure of paired chromosomes to separate (disjoin)
in anaphase of meiosis I or failure of sister
chromatids to disjoin at either meiosis Il or at mitosis.
 Nondisjunction in meiosis produces gametes with
22 or 24 chromosomes, which after fertilization by a
normal gamete make a triisomic or monosomic
zygote.
 Nondisjunction in mitosis produces a mosaic.

Anaphase lag
• Failure of a chromosome or chromatid to be
incorporated into one of the daughter nuclei
following cell division, as a result of delayed
movement (lagging) during anaphase.
• Chromosomes that do not enter a daughter cell
nucleus are lost.

Mixoploidy
 Mixoploidy includes mosaicism (an individual
possesses two or more genetically different cell
lines all derived from a single zygote) and
chimerism (an individual has two or more
genetically different cell lines originating from
different zygotes.
 Abnormalities that would be lethal in constitutional
form may be compatible With life in mosaics.
 Aneuploidy mosaics are common. For example,
mosaicism resulting in a proportion of normal cells
and a proportion of aneuploid (Eg. Trisomic) cells-

- can be ascribed to nondisjunction or chromosome lag
occurring in one of the mitotic divisions of the early
embryo (any monosomic cells that are formed usually
die out).
• Polyploidy mosaics (Eg. Human diploid/triploid
mosaics) are occasionally found.
• As gain or loss of a haploid set of chromosomes by
mitotic nondisjunction is most unlikely, human
diploid/triploid mosaics most probably arise by fusion
of the second polar body with one of the cleavage
nuclei of a normal diploid zygote.

structural chromosomal abnormalities result from
misrepair of chromosomal breaks or from
malfunction of the recombination system
• Chromosome breaks occur either as a result of
damage to DNA (by radiation or chemicals, for
example) or as part of the mechanism of
recombination.
• In G2 phase of the cell cycle, chromosomes consist
Of two chromatids.
• Breaks occurring at this stage are manifest as
chromatid breaks, affecting only one of the two sister
chromatids.

• Breaks occuring in G 1 phase, if not repaired before S
phase, appear later as chromosome breaks, affecting
both chromatids.
• Cells have enzyme systems that recognize and if
possible repair broken chromosome ends.
• Repair can be either by joining two broken ends
together or by capping a broken end with a telomere.
• Cell cycle checkpoint mechanisms normally prevent
cells with unrepaired chromosome breaks from
entering mitosis; if the damage cannot be repaired,
the cell commits suicide(apoptosis).

Down Syndrome (Trisomy 21)
 The "trisomy" is the presence of three chromosomes
in a homologous set, rather than the usual pair of
chromosomes. For example, if a baby is born with
three chromosomes of the 21st set, rather than the
usual pair, the baby would be said to have "trisomy
21.“
 Trisomy 21 is also known as Down syndrome.
 Other examples of trisomy include trisomy 18 and
trisomy 13.

 Again, trisomy 18 or trisomy 13 simply means there are
three copies of the 18th chromosome (or of the 13th
chromosome) present in each cell of the body, rather than
the usual pair.
 Down syndrome is a genetic disorder that includes a
combination of birth defects, including some degree of
mental retardation, characteristic facial features, heart
defects, visual and hearing impairment and other health
problems.
 The severity of these varies greatly among effected
individuals.
 Down syndrome is one of the most common genetic birth
defects, affecting approximately one in 800 to 1000
babies.
 Life expectancy among adults with down syndrome is
about 55 years, though average lifespan varies.

• The name "Down syndrome" comes from the
physician, Dr. Langdon Down, who first described
the collection of findings in 1866.
• It was not until 1959 that the cause of Down
syndrome (the presence Of an extra 21 chromosome)
was identified.

Causes of Down Syndrome
 Normally in reproduction, the egg cell of the mother
and the sperm cell of the father start out with the
usual number of 46 chromosomes.
 The egg and sperm cells undergo cell division where
the 46 chromosomes are divided in half and the egg
and the sperm cells end up with 23 chromosomes
each.
 When a sperm with 23 chromosomes fertilizes an egg
with 23 chromosomes, the baby ends up with a
complete set of 46 chromosomes, half from the father
and half from the mother.

• Sometimes, an error occurs when the 46
chromosomes are being divided in half and an egg or
sperm cell keeps both copies of the 21st chromosome
instead of just one copy.
• If this egg or sperm is fertilized the baby ends up
with three copies of the 21st chromosome and this is
called trisomy 21 or Down syndrome.
• The features of Down syndrome result from having
an extra copy of chromosome 21 in every cell in the
body.

• Ninety-five percent of Down syndrome results from
trisomy 21.
• Occasionally, the extra chromosome 21 or a portion
of it is attached to another chromosome in the egg or
sperm; this may result in what is called
”translocation" Down syndrome.
• This is the only form of Down syndrome that can
sometimes be inherited from a parent.
• Some parents have a rearrangement called a balanced
translocation, where the 21 chromosome is attached
to another chromosome, but it does not affect his/her
health.

• Rarely, a form of Down syndrome called
mosaic"Down syndrome” may occur when an error in
cell division occur as after fertilization.
• These persons have some cells with an extra
chromosome 21 and others with the normal number.

Symptoms of Down Syndrome in Children
 About percent to 50 percent of babies with Down
have heart defects. Some defects are minor and may
be treated with medications, while others may require
surgery
 Children with Down syndrome are at increased risk
for visual or hearing impairment. Common visual
problems include crossed eyes, near or far
sightedness and cataracts.
 Most visual problems can be improved with glasses,
surgery or other treatments.

• A pediatric ophthalmologist (a physician who
specializes in comprehensive eye care and provides
examinations, diagnosis and treatment for a variety of
eye disorders) should be consulted within the first
year of life.
• Children with Down syndrome may have hearing loss
due to fluid in the middle ear, a nerve defect or both.
• All children with Down syndrome should have
regular vision and hearing examinations so any
problems can be treated before they hinder
development of language and other skills.

• Children with Down syndrome are at increased risk
of thyroid problems and leukemia.
• They also tend to have many colds, as well as
bronchitis and pneumonia.
• Children with Down syndrome should receive regular
medical care including childhood immunizations.
• The National Down Syndrome Congress publishes a
"Preventative Medicine Checklist" which outlines
which checkups and medical tests are recommended
at various ages.

Chromosome and Gene Mutations Guide

Recommandé

Recommandé

Contenu connexe

Tendances

Tendances (20)

Similaire à Chromosome and Gene Mutations Guide

Similaire à Chromosome and Gene Mutations Guide (20)

Dernier

Dernier (20)

Chromosome and Gene Mutations Guide