This document describes the development of a PCR-RFLP assay to identify Plasmodium species and variants of P. vivax infecting Anopheles mosquitoes. Specific primers were designed that target regions of the circumsporozoite gene to distinguish P. falciparum, P. malariae, and P. vivax variants VK210, VK247, and P. vivax-like. The assay was tested on artificially infected mosquitoes and showed good agreement with nested PCR. The PCR-RFLP method provides a sensitive way to detect Plasmodium species and variants, which can help understand malaria transmission dynamics.

1. Acta Tropica 118 (2011) 118–122
Contents lists available at ScienceDirect
Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica
Development of PCR–RFLP assay for the discrimination of Plasmodium species
and variants of P. vivax (VK210, VK247 and P. vivax-like) in Anopheles mosquitoes
Gustavo Capatti Cassiano a,∗ , Luciane Moreno Storti-Melo a , Marinete Marins Póvoa b ,
Allan Kardec Ribeiro Galardo c , Andréa Regina Baptista Rossit d,e,f , Ricardo Luiz Dantas Machado d,e
a
Universidade de São Paulo, Rua Cristóvão Colombo 2265, 15054-000 São José do Rio Preto, São Paulo, Brazil
b
Laboratório de Pesquisas Básicas em Malária, Secão de Parasitologia, Instituto Evandro Chagas, Secretaria de Vigilância em Saúde, BR316 Km 7, 67030-000 Ananindeua, Pará, Brazil
¸
c
Departamento de Zoologia, Secão de Entomologia Médica, Instituto de Pesquisas Científicas e Tecnológicas do Estado do Amapá, Rodovia J.K. Km10, 68912-250 Macapá,
¸
Amapá, Brazil
d
Centro de Investigacão de Microrganismos, Departamento de Doencas Dermatológicas, Infecciosas e Parasitárias, Faculdade de Medicina de São José do Rio Preto, Avenida Brigadeiro
¸ ¸
Faria Lima 5416, 15090-000 São José do Rio Preto, São Paulo, Brazil
e
Fundacão Faculdade de Medicina de São José do Rio Preto, Avenida Brigadeiro Faria Lima 5544, 15090-000 São José do Rio Preto, São Paulo, Brazil
¸
f
Departamento de Microbiologia e Parasitologia, Instituto Biomédico, Universidade Federal Fluminense, Rua Prof. Hernani de Melo, 101, 24210-130 Niterói, Rio de Janeiro, Brazil
a r t i c l e i n f o a b s t r a c t
Article history: The identification of Plasmodium species in Anopheles mosquitoes is an integral component of malaria
Received 7 May 2010 control programs. We developed a new assay to identify Plasmodium falciparum, Plasmodium malariae,
Received in revised form 18 February 2011 and Plasmodium vivax variants. Specific primers were designed to hybridize to CS gene-specific regions.
Accepted 22 February 2011
Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) were used to dis-
Available online 21 March 2011
tinguish the P. vivax variants VK210, VK247, and P. vivax-like. The new PCR–RFLP assay revealed good
agreement when compared with a nested PCR using artificially infected Anopheles mosquitoes. This sen-
Keywords:
sitive PCR–RFLP method can be useful when detection of Plasmodium species and P. vivax variants is
Malaria diagnosis
Circumsporozoite gene
required and may be employed to improve the understanding of malaria transmission dynamics by
P. vivax variants Anopheles species.
Anopheles © 2011 Elsevier B.V. All rights reserved.
1. Introduction For many years, detection of malaria parasites in mosquitoes
was performed by dissection and visualization of the midgut
The correct identification of human-specific Plasmodium species and salivary glands under a microscope. Although microscopic
in the mosquito host is an essential component for planning and examination is reliable, it requires fresh material, experienced
monitoring of malaria control activities. Plasmodium vivax is the microscopists, and time (Lulu et al., 1997). Another limitation of
predominant species in Brazil (83.5% of all cases), followed by Plas- this methodology is that it cannot distinguish among the different
modium falciparum (15.47%), P. vivax–P. falciparum mixed species Plasmodium species. The discovery of the specific CS protein anti-
infections (1.0%), and Plasmodium malariae (0.03%) (Ministério da gen was a major breakthrough in this field. The sequencing of this
Saúde, 2009). Additionally, the P. vivax circumsporozoite protein protein and its corresponding gene revealed the existence of spe-
(CS) genotypes VK210, VK247, and P. vivax-like were reported in cific repetitive sequences for some species of Plasmodium (Ozaki
several areas of the Brazilian Amazon, as were both mono and et al., 1983; Dame et al., 1984; Arnot et al., 1985; Lal et al., 1988),
mixed infections (Machado and Póvoa, 2000; Storti-Melo et al., allowing their discrimination by enzyme-linked immunosorbent
2009). The different human malaria species may differ in infectivity assay (CS-ELISA) using monoclonal antibodies (Wirtz et al., 1987).
ability of anophelines (Gonzalez-Ceron et al., 1999), transmission Although CS-ELISA has been widely used because of its high sensi-
potential, and response to antimalarial drugs (Machado et al., 2003). tivity and specificity (Sattabongkot et al., 2004; Hasan et al., 2009),
Information about the geographical distribution of the parasite and there are some limitations, such as overestimation of true salivary
vector species is important for accurate interpretation of epidemi- gland infection rates (Robert et al., 1988; Fontenille et al., 2001)
ological data. and false–positive results (Hasan et al., 2009). Ryan et al. (2001)
developed a rapid dipstick assay (VecTestTM Malaria), which deter-
mines the presence or absence of specific CS peptide epitopes of
P. falciparum and VK210 and VK247 P. vivax genotypes, but it is
∗ Corresponding author. Tel.: +55 17 3201 5736; fax: +55 17 3201 5736. less sensitive compared with the polymerase chain reaction- (PCR-)
E-mail address: gcapatti@hotmail.com (G.C. Cassiano). assays (Moreno et al., 2004).
0001-706X/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.actatropica.2011.02.011

2. G.C. Cassiano et al. / Acta Tropica 118 (2011) 118–122 119
PCR has been considered the most suitable method for the iden- to ensure that no variation existed in the primer annealing
tification of human malaria parasites (Snounou et al., 1993a,b). In regions.
fact, currently, the most widely used PCR assay is a nested-PCR
designed by Snounou et al. (1993b) using the small subunit ribo-
somal RNA, generally accepted as the gold standard for human 2.4. PCR amplification
malaria species identification. Recently, a real-time TaqMan PCR
assay (Bass et al., 2008) and a novel single-step PCR based on All PCR amplifications were carried out in a 25 ␮l reaction mix-
the amplification of the mitochondrial cytochrome b (Cyt b) gene ture containing 3 ␮l genomic DNA for P. falciparum and P. vivax and
(Hasan et al., 2009) were developed. These methods are sensitive 5 ␮l for P. malariae, 1 X PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM
and specific for the detection of infectivity in mosquitoes. Neverthe- KCl), 1.5 mM MgCl2 , 0.2 mM of each dNTP, 0.2 ␮M of each primer,
less, they are unable to distinguish Plasmodium species other than and 2.5 U of Taq polymerase (Invitrogen, Carlsbad, USA). A sepa-
falciparum. Herein, we describe a novel PCR assay using primers rate reaction was carried out with every sample for the detection
for specific regions in the sequences of the CS gene to identify of each Plasmodium species. Species-specific primers were used in
human Plasmodium species, and the use of restriction fragment each reaction mixture. The amplification was performed in a ther-
length polymorphism (RFLP) to discriminate P. vivax variants in mal cycler (DNA MasterCycler, Eppendorf, Germany) as follows: an
mosquitoes. initial cycle of 94 ◦ C for 15 min, followed by 30 cycles of 94 ◦ C for
1 min, 58 ◦ C for 1 min, and 72 ◦ C for 1 min, with a final extension
2. Materials and methods at 72 ◦ C for 10 min. DNA of P. falciparum, P. malariae, and P. vivax
were included as positive controls, while sterilized water and DNA
2.1. Preparation of mosquito samples extracted from colonized, malaria-free An. darlingi were used as a
negative control.
Laboratory-infected mosquitoes were kindly provided by Dr.
William Collins from the Malaria Branch, Division of Parasitic Dis-
2.5. PCR product analysis
eases and Malaria, United States Centers for Disease Control and
Prevention (CDC). Thirty Anopheles dirus mosquitoes had been arti-
The PCR product (5 ␮l) was electrophoresed at 100 V for
ficially infected with P. vivax and 30 with P. falciparum. In addition,
50 min with 50 or 100 bp DNA molecular weight markers (Invit-
30 An. gambiae mosquitoes had been artificially infected with P.
rogen, Carlsbad, USA) in 1.5% agarose gel stained by ethidium
malariae. Mosquitoes were stored on silica gel before being frozen
bromide. The target DNA was visualized on an ultraviolet
at −20 ◦ C.
transilluminator.
2.2. Extraction of malaria parasite DNA from mosquitoes and
plasmid clones 2.6. Sensitivity and specificity of the assay
DNA was extracted from single mosquitoes using DNAzol® Blood samples from patients with malaria parasitemia ranging
(Invitrogen, Gaithersburg, USA), with slight modifications. Briefly, from 300 to 12,500 parasites per microliter were used to evaluate
the head and thorax of single mosquitoes were placed in 1.5 ml PCR sensitivity. These samples were serially diluted in blood from
Eppendorf tubes and macerated using a new sterile pipette tip in an uninfected donor to a final level of parasitemia corresponding
100 ␮l of DNAzol. The product was suspended in 100 ␮l 8 mM NaOH to 10−6 , and were further processed for PCR amplification. DNA
and stored at −20 ◦ C until use. For PCR–RFLP standardization, we samples of P. falciparum, P. malariae, and P. vivax were diluted to
used three plasmid clones carrying a PCR insert of the CS gene 10 ng/␮l in sterile water (determined using a NanoDrop® ND-1000
amplified from the P. vivax variants VK210, VK247 and P. vivax- UV–Vis spectrophotometer) and then serial dilutions were made
like (BlueScript, Stratagene, La Jolla, USA), kindly provided by Ira down to 1 in 1 × 106 to determine the sensitivity of the PCR assay.
Goldman from CDC. The protocol for this study was reviewed and approved by the
Research Board of the Faculdade de Medicina de São José do Rio
2.3. Primer design Preto, Brazil.
To determine PCR specificity, genomic DNA obtained from
We designed one PCR reaction to amplify the conserved patients’ blood infected with P. vivax, P. falciparum, and P. malariae
region of the CS gene from P. falciparum and P. malariae and was used. In addition, DNA from An. stephensi infected with Plas-
a second one to amplify the internal variable region of the modium ovale provided by Dr. William Collins, An. gambiae infected
P. vivax CS gene. The sequence of P. falciparum was ampli- with P. malariae, An. dirus infected with P. falciparum and P. vivax,
fied using primer pairs PFCSP1 (5 CCAGTGCTATGGAAGTTCGTC and DNA from uninfected An. darlingi were used.
3 ) and PFCSP2 (5 CCAATTTTCCTGTTTCCCATAA 3 ). We used
primers PMCSP1 (5 ATATAGACTTGCTCCAACATGAAGAA 3 ) and
PMCSP2 (5 AATGATCTTGATTCGTGCTATATCTG 3 ) for P. malar- 2.7. Restriction digests of PCR products
iae; and primers PVCSP1 (5 AGGCAGAGGACTTGGTGAGA 3 )
and PVCSP2 (5 CCACAGGTTACACTGCATGG 3 ) for P. vivax. The P. vivax variants were genotyped by RFLP analysis of
primers were selected using the web-based software Primer3 PCR products displaying at least one cleavage site for the
v.0.4.0 (http://frodo.wi.mit.edu/primer3/). To evaluate the appro- restriction enzyme selected by the software RestrictionMapper
priateness of the selected primers, a conformational analysis to (http://www.restrictionmapper.org/). The restriction reaction was
investigate the possibility of primer secondary structure formation, performed in a final volume of 20 ␮l, using 10 U of AluI (Invitrogen,
annealing temperature, and GC content was done using the soft- Carlsbad, USA), 2 ␮l of recommended restriction buffer, 10 ␮l of
ware Primer3 and IDT OligoAnalyzer 3.1 (http://www.idtdna.com). the PCR product, and 7 ␮l of sterilized water. Reactions took place
Nucleotide alignment of the CS gene sequences from Plas- at 37 ◦ C for 2 h. Digested products were electrophoretically sepa-
modium species and variants of diverse geographic origin, rated on 12.5% polyacrylamide gels, in the presence of 50 bp DNA
available from the National Center for Biotechnology Information molecular weight markers (Invitrogen, Carlsbad, USA), and the gels
website (http://www.ncbi.nlm.nih.gov/BLAST/), was performed were subsequently silver-stained.

3. 120 G.C. Cassiano et al. / Acta Tropica 118 (2011) 118–122
Fig. 1. Banding pattern of the CS-PCR–RFLP. (A) Lane 1, 100 bp DNA ladder (Invitrogen, U.S.A.); Lane 2, VK210 plasmid; Lane 3, VK247 plasmid; Lane 4, P. vivax-like plasmid;
Lane 5, P. malariae; Lane 6, P. falciparum; Lane 7, 50 bp DNA ladder (Invitrogen, U.S.A.). Lanes 2–6 show amplification products 789, 834, 834, 199, and 118 bp, respectively.
(B) Digestion of products amplified of P. vivax variants VK210, VK247, and P. vivax-like. Image showing the fragments of digestion with AluI. L: 50 bp ladder; I: VK210; II:
VK247; III: P. vivax-like. The products were run on 12.5% polyacrylamide gel.
2.8. Statistical analysis 3.3. Sensitivity and specificity of CS-PCR
Statistical comparison between the results of CS-PCR and the We observed amplification bands at different dilutions of the
nested PCR described previously by Snounou et al. (1993b) was template DNA: 1:10,000 dilution for P. vivax, 1:5000 for P. falci-
made using Cohenˇs Kappa (k) measure of test association with
ı parum, and 1:1000 dilution for P. malariae. DNA from P. malariae,
a 95% confidence interval. Analyses were performed using the P. falciparum, and P. vivax, as well as samples of An. stephensi
BioEstat program version 5.0 (Ayres et al., 2003). The nested PCR infected with P. ovale and unfed mosquitoes, were used as con-
was considered the reference method of choice of test accuracy trol to confirm the specificity of each primer pair. No amplification
for determination of CS-PCR sensitivity and specificity. Sensitivity was obtained when DNA from a species of Plasmodium was sub-
was calculated as the proportion of mosquitoes positive by CS-PCR mitted to PCR with a primer pairs designed to amplify a different
among those positive by nested PCR. Specificity was calculated as species, i.e., there was no cross-reactivity. PCR did not elicit results
the proportion of mosquitoes that were negative by CS-PCR among when DNA from Anopheles samples was included in CS-PCR reac-
those that yielded negative results by nested PCR. Positive predic- tions (Fig. 2).
tive value was calculated as the proportion of true positive results
among all positive CS-PCR results.
3. Results
3.1. Amplification of P. malariae, P. falciparum, and P. vivax
variant CS gene fragments
We used the length of the amplification products obtained by CS
sequence genes specific for each P. vivax variants and the different
Plasmodium species. Those amplification products were 789 base
pair- (bp)-long for P. vivax variant VK210 and 834 bp-long for the
other P. vivax variants, i.e., VK247 and P. vivax-like. PCR-generated
product for P. malariae was 199 bp long, and was 118 bp long for P.
falciparum (Fig. 1A).
3.2. PCR–RFLP analysis
The product of amplification using primers PVCSP1 and PVCSP2
for the identification of P. vivax was subjected to RFLP to identify
the different variants. The patterns observed with the AluI enzyme
are shown in Fig. 1B. PCR–RFLP for P. vivax variant VK210 showed
fragments of 135, 106, 100, 54, 43, and 27 bp. Three fragments (691,
100, and 43 bp) were specific for P. vivax variant VK247, while for Fig. 2. Amplification of PCR products using different primer pairs by electrophoresis
P. vivax-like, fragments of 731, 62, and 41 bp were detected. Frag- in 1.5% agarose gel. Section A, primers PVCSP1 and PVCS2, specific for P. vivax. Section
ments below 50 bp were not easily visible on the polyacrylamide B, primers PMCSP1 and PMCSP2, specific for P malariae. Section C, primers PFCSP1
and PFCS2, specific for P. falciparum. Letters on top of each lane indicate the species
gel; however, the differences among the variants were easily deter- of used in each individual assay: V: P. vivax; F: P. falciparum; M: P. malariae; O: P.
mined based on the larger fragments (Fig. 1B). ovale; and L: 100 bp ladder as a molecular size marker.

4. G.C. Cassiano et al. / Acta Tropica 118 (2011) 118–122 121
Table 1
Results of the CS-PCR and nested PCR using Plasmodium artificially infected and uninfected mosquitoes.
Moquitoes CS-PCR Nested PCR CS-PCR sensitivity CS-PCR specificity Cohenˇs kappa value
ı
Positive Negative Positive Negative
P. vivax-infected mosquitoes 17 13 19 11 84.2% 90.9% 0.723
P. falciparum-infected mosquitoes 14 16 16 14 87.5% 100% 0.867
P. malariae-infected mosquitoes 16 14 21 09 76.2% 100% 0.657
Uninfected mosquitoes 0 30 0 30 1
3.4. Evaluation of the CS-PCR human malaria parasites (P. vivax, P. falciparum,m and P. malariae)
and sporozoites in mosquitoes infected in the laboratory was mod-
CS-PCR and nested PCR protocols were tested using artificially erate for P. vivax and P. malariae (Ä = 0.723 and 0.657, respectively)
infected mosquitoes. A total of 120 mosquitoes were screened, con- and high for P. falciparum (Ä = 0.867). This may be due to the fact that
sisting of 30 infected with P. vivax, 30 infected with P. falciparum, 30 nested PCR uses two rounds of PCR, which allows for the detection
infected with P. malariae, and 30 unfed mosquitoes. The results are of lower parasitemia levels. Moreover, the nested PCR targets the
shown in Table 1. All infected mosquitoes, as determined by CS-PCR, small subunit ribosomal RNA gene, which is present as four copies
were also determined as Plasmodium-positive by the nested PCR, per haploid genome and, for this reason, improves the sensitivity
except for one mosquito positive for P. vivax by the first method- of this PCR (Hasan et al., 2009). The extra advantage of using the
ology. No infection was found in any of the 30 unfed mosquitoes CS gene as a target is the possibility of distinguishing among the P.
using both methods. The comparison revealed a close agreement vivax variants.
between the CS-PCR and the gold standard nested PCR (Ä = 0.723, The CS gene has been extensively studied because its protein
0.867, and 0.657, respectively, for P. vivax, P. falciparum, and P. is the main target for vaccine development (Herrera et al., 2007).
malariae). Since the presence of mutations in the primer binding sites can
The CS-PCR assay showed good sensitivity for P. vivax and P. preclude primer-binding during PCR, we investigated multiple CS
falciparum sporozoites (84.2% and 87.5%, respectively) and less sen- gene sequences isolated from different regions in the world, avail-
sitivity for P. malariae sporozoites (76.2%). The specificities were able in the GenBank database. In the case of P. vivax, after sequence
high for P. vivax, P. falciparum, and P. malariae (90.9%, 100%, and alignment of the nonrepeat regions, we found that there was no
100%, respectively). The positive predictive value was 94.5% for P. variation in the binding sequence of the newly designed primers
vivax and 100% for P. falciparum and P. malariae. of any sequence. For P. malariae, there is no variation in the 5
region of the gene of 16 sequences analyzed; therefore, this region
4. Discussion was chosen for primer design. For P. falciparum, we selected the
5 region because we found only a single base substitution in this
Correct determination of the malaria infection rate of Anophe- region (accession no. U20969). This is favorable since it suggests
les mosquitoes and accurate identification of Plasmodium species in that this method may be useful in different malaria-endemic areas
these mosquitoes assist in the understanding of the malaria trans- of the world.
mission dynamics in a given malaria endemic region. This allows for P. vivax malaria is endemic in many countries and its CS
the judicious use of resources and implementation of vector control genotypes are found worldwide, so its accurate diagnosis is very
strategies, such as those based on insecticide use. Thus, the identi- important. Indeed, P. vivax malaria variants may have different
fication of Plasmodium species in Anopheles mosquitoes should be characteristics with respect to the intensity of symptoms and the
an integral component of a malaria control program. It is, however, response to drugs, which could result in additional challenges for
important to have tools and techniques to accurately determine proper malaria control strategies (Kain et al., 1993; Machado and
these parameters. Póvoa, 2000). Additionally, some species of Anopheles have dif-
Traditionally, the detection of malaria parasites in mosquitoes ferential susceptibility to P. vivax variants (Gonzalez-Ceron et al.,
is done using microscopy, but this is laborious, requires fresh 1999, 2001; Silva et al., 2006). Thus, it is important to identify P.
material, and cannot distinguish between the different Plasmod- vivax variants in Anopheles mosquitoes to better target appropriate
ium species. A rapid diagnostic test that detects CS antigen with vector control strategies for the different mosquito species. In our
monoclonal antibodies allows for the identification of P. falciparum study, the choice of restriction enzymes used in the RFLP assay was
and P. vivax variants VK210 and VK247 (Ryan et al., 2001). Although influenced by the desire to create an efficient test with optimal res-
simple, fast, and specific (Bangs et al., 2002), this rapid diagnostic olution of restriction profiles. Based on the sequence analysis of P.
test may fail to detect low-level infections (Arez et al., 2000). The vivax variants available in the GenBank database, the AluI endonu-
CS-ELISA, which is widely used, has similar limitations (Robert et al., clease was found to be the most suitable enzyme, and it showed
1988; Fontenille et al., 2001; Hasan et al., 2009). optimal discriminatory power to distinguish all variants.
Usually, PCR-based assays can discriminate between different As expected for all PCR-based methods, our assay has some
Plasmodium species using two rounds of amplification (Snounou limitations. The requirement for separate PCRs for each species
et al., 1993a; Singh et al., 1999; Rubio et al., 2002) and are more increases the time required and the assay cost; therefore, it may
sensitive than other methods (Wilson et al., 1998; Póvoa et al., not be suitable for large-scale epidemiologic surveys. However, this
2000; Moreno et al., 2004). We have optimized a protocol in PCR–RFLP is very useful when P. vivax variant detection is required,
which sequences of the CS gene were used as primers for a PCR- since there is no need for sequencing. Unfortunately, the CS-PCR
based assay to detect and identify the three variants of P. vivax, does not identify P. ovale infection, and it may not be useful in
VK210, VK247, and P. vivax-like. Moreover, we used species-specific countries where this species circulates.
primers to identify P. falciparum and P. malariae. In conclusion, this comparative study showed a close agreement
The CS-PCR showed high specificity and positive predictive between the novel CS-PCR and the gold standard nested PCR. More-
values for the three Plasmodium species tested. The concordance over, the CS-PCR–RFLP described here was highly specific to each
between the results obtained when employing the CS-PCR pro- Plasmodium species and P. vivax variants. Because of its low detec-
posed herein and the nested PCR (Snounou et al., 1993b) to identify tion threshold, especially for P. vivax, this assay can be used for

5. 122 G.C. Cassiano et al. / Acta Tropica 118 (2011) 118–122
detection even at low parasite levels. The CS-PCR–RFLP is the first Lulu, M., Hermans, P.W., Gemetchu, T., Petros, B., Miörner, H., 1997. Detection of Plas-
molecular diagnostic, to our knowledge, that can identify P. vivax modium falciparum sporozoites in naturally infected anopheline species using a
fluorescein-labelled DNA probe. Acta Trop. 63, 33–42.
variants in Anopheles mosquitoes. Machado, R.L., Figueiredo-Filho, A.F., Calvosa, V.S., Figueredo, M.C., Nascimento, J.M.,
Póvoa, M.M., 2003. Correlation between Plasmodium vivax variants in Belém,
Acknowledgments Pará State, Brazil and symptoms and clearance of parasitaemia. Braz. J. Infect.
Dis. 7, 175–177.
Machado, R.L.D., Póvoa, M.M., 2000. Distribution of Plasmodium vivax variants
The authors thank Ira Goldman for supplying plasmid clones and (VK210, VK247 and P.vivax-like) in three endemic areas of Amazonian Brazil
Dr. William Collins for supplying artificially infected mosquitoes. and their correlation with chloroquine-treatment. Trans. R. Soc. Trop. Med. Hyg.
94, 377–381.
We are grateful to Luciana Moran and Valéria Fraga for their Ministério da Saúde, 2009. Secretaria de Vigilância em Saúde. Sistema de
technical assistance. We are also thankful to Dr. Jan Conn, Dr. Informacões de Vigilância Epidemiológica (SIVEP) – Malária. Dados epidemi-
¸
Alexandre Macedo de Oliveira and Dr. Beatie Divine for the criti- ológicos de malária, por Estado. Amazônia Legal. http://portalweb04.saude.
gov.br/sivep malaria (assessed 10 03 10).
cal review of this manuscript. This work was financially supported
Moreno, M., Cano, J., Nzambo, S., Bobuakasi, L., Buatiche, J.N., Ondo, M., Micha, F.,
by Fundacão de Amparo à Pesquisa do Estado de São Paulo
¸ Benito, A., 2004. Malaria Panel Assay versus PCR: detection of naturally infected
(FAPESP). Anopheles melas in a coastal village of Equatorial Guinea. Malar. J. 3, 6.
Ozaki, L.S., Svec, P., Nussenzweig, F.T.S., Nussenzweig, V., Godson, G.N., 1983. Struc-
ture of the Plasmodium knowlesi gene coding for the Circumsporozoite protein.
References Cell 34, 815–822.
Póvoa, M.M., Machado, R.L., Segura, M.N., Vianna, G.M., Vasconcelos, A.S., Conn, J.E.,
Arez, A.P., Lopes, D., Pinto, J., Franco, A.S., Snounou, G., do Rosário, V.E., 2000. Plas- 2000. Infectivity of malaria vector mosquitoes: correlation of positivity between
modium sp.: optimal protocols for PCR detection of low parasite numbers from ELISA and PCR–ELISA tests. Trans. R. Soc. Trop. Med. Hyg. 94, 106–107.
mosquito (Anopheles sp.) samples. Exp. Parasitol. 94, 269–272. Robert, V., Verhave, J.P., Ponnudurai, T., Louwé, L., Scholtens, P., Carnevale, P., 1988.
Arnot, D.E., Barnwell, J.W., Tam, J.P., 1985. Circumsporozoite protein of Plasmod- Study of the distribution of circumsporozoite antigen in Anopheles gambiae
ium vivax: gene cloning and characterization of the immunodominant epitope. infected with Plasmodium falciparum, using the enzyme-linked immunosorbent
Science 230, 815–817. assay. Trans. R. Soc. Trop. Med. Hyg. 82, 389–391.
Ayres, M., Ayres, M.J., Ayres, D.L., dos Santos, A.S., 2003. Bioestat: 3.0 aplicacões ¸ Rubio, J.M., Post, R.J., van Leeuwen, W.M., Henry, M.C., Lindergard, G., Hommel,
estatísticas nas áreas das ciências biológicas e médicas, fifth ed. Sociedade Civil M., 2002. Alternative polymerase chain reaction method to identify Plasmod-
Mamirauá, Belém. ium species in human blood samples: the semi-nested multiplex malaria PCR
Bangs, M.J., Rusmiarto, S., Gionar, Y.R., Chan, A.S., Dave, K., Ryan, J.R., 2002. Evaluation (SnM-PCR). Trans. R. Soc. Trop. Med. Hyg. 96 (S1), 199–204.
of a dipstick malaria sporozoite panel assay for detection of naturally infected Ryan, J.R., Dave, K., Emmerich, E., Garcia, L., Yi, L., Coleman, R.E., Sattabongkot, J., Dun-
mosquitoes. J. Med. Entomol. 39, 324–330. ton, R.F., Chan, A.S., Wirtz, R.A., 2001. Dipsticks for rapid detection of Plasmodium
Bass, C., Nikou, D., Blagborough, A.M., Vontas, J., Sinden, R.E., Williamson, M.S., Field, in vectoring Anopheles mosquitoes. Med. Vet. Entomol. 15, 225–230.
L.M., 2008. PCR-based detection of Plasmodium in Anopheles mosquitoes: a com- Sattabongkot, J., Kiattibut, C., Kumpitak, C., Ponlawat, A., Ryan, J.R., Chan, A.S., Davé,
parison of a new high-throughput assay with existing methods. Malar. J. 7, K., Wirtz, R.A., Coleman, R.E., 2004. Evaluation of the VecTest Malaria Antigen
177. Panel assay for the detection of Plasmodium falciparum and P. vivax circum-
Dame, J.B., Williams, J.L., McCucthan, T.F.M., Weber, J.L., Wirtz, R.A., Hockmeyer, W.T., sporozoite protein in anopheline mosquitoes in Thailand. J. Med. Entomol. 41,
Maloy, W.L., Haynes, J.D., Schneider, I., Roberts, D., 1984. Structure of the gene 209–214.
encoding the immunodominant surface antigen of the human malaria parasite Silva, A.N., Santos, C.C., Lacerda, R.N., Machado, R.L., Póvoa, M.M., 2006. Susceptibility
Plasmodium falciparum. Science 225, 593–599. of Anopheles aquasalis and An. darlingi to Plasmodium vivax VK210 and VK247.
Fontenille, D., Meunier, J.Y., Nkondjio, C.A., Tchuinkam, T., 2001. Use of cir- Mem. Inst. Oswaldo Cruz 101, 547–550.
cumsporozoite protein enzyme-linked immunosorbent assay compared with Singh, B., Bobogare, A., Cox-Singh, J., Snounou, G., Abdullah, M.S., Rahman, H.A.,
microscopic examination of salivary glands for calculation of malaria infectivity 1999. A genus- and species-specific nested polymerase chain reaction malaria
rates in mosquitoes (Diptera: Culicidae) from Cameroon. J. Med. Entomol. 38, detection assay for epidemiologic studies. Am. J. Trop. Med. Hyg. 60, 687–692.
451–454. Snounou, G., Viriyakosol, S., Jarra, W., Thaithong, S., Brown, K.N., 1993a. Identification
Gonzalez-Ceron, L., Rodriguez, M.H., Nettel, J.C., Villarreal, C., Kain, K.C., Hernan- of the four human malaria parasite species in field samples by the polymerase
dez, J.E., 1999. Differential susceptibilities of Anopheles albimanus and Anopheles chain reaction and detection of a high prevalence of mixed infections. Mol.
pseudopunctipennis to infections with coindigenous Plasmodium vivax variants Biochem. Parasitol. 58, 283–292.
VK210 and VK247 in southern Mexico. Infect. Immun. 67, 410–412. Snounou, G., Viriyakosol, S., Zhu, X.P., Jarra, W., Pinheiro, L., do Rosario, V.E.,
González-Cerón, L., Rodriguez, M.H., Santillan, F., Chavez, B., Nettle, J.A., Hernández- Thaithong, S., Brown, K.N., 1993b. High sensitivity of detection of human malaria
Avila, J.E., Kain, K.C., 2001. Plasmodium vivax: ookinete destruction and oocyst parasites by the use of nested polymerase chain reaction. Mol. Biochem. Para-
development arrest are responsible for Anopheles albimanus resistance to cir- sitol. 61, 315–320.
cumsporozoite phenotype VK247 parasites. Exp. Parasitol. 98, 152–161. Storti-Melo, L.M., Souza-Neiras, W.C., Cassiano, G.C., Joazeiro, A.C., Fontes, C.J.,
Hasan, A.U., Suguri, S., Sattabongkot, J., Fujimoto, C., Amakawa, M., Harada, M., Bonini-Domingos, C.R., Couto, A.A., Póvoa, M.M., Mattos, L.C., Cavasini, C.E.,
Ohmae, H., 2009. Implementation of a novel PCR based method for detecting Rossit, A.R., Machado, R.L., 2009. Plasmodium vivax circumsporozoite variants
malaria parasites from naturally infected mosquitoes in Papua New Guinea. and Duffy blood group genotypes in the Brazilian Amazon region. Trans. R. Soc.
Malar. J. 8, 182. Trop. Med. Hyg. 103, 672–678.
Herrera, S., Corradim, G., Arévalo-Herrera, M., 2007. An update on the search for a Wilson, M.D., Ofosu-Okyere, A., Okoli, A.U., McCall, P.J., Snounou, G., 1998. Direct
Plasmodium vivax vaccine. Trends Parasitol. 23, 122–127. comparison of microscopy and polymerase chain reaction for the detection of
Kain, K.C., Brown, A.E., Lanar, D.E., Ballou, W.R., Webster, H.K., 1993. Response of Plasmodium sporozoites in salivary glands of mosquitoes. Trans. R. Soc. Trop.
Plasmodium vivax variants to chloroquine as determined by microscopy and Med. Hyg. 92, 482–483.
quantitative polymerase chain reaction. Am. J. Trop. Med. Hyg. 49, 478–484. Wirtz, R.A., Zavala, F., Charoenvit, Y., Campbell, G.H., Burkot, T.R., Schneider, I., Esser,
Lal, A.A., De la Cruz, V.F., Campbell, G.H., Procell, P.M., Collins, W.E., McCutchan, K.M., Beaudoin, R.L., Andre, R.G., 1987. Comparative testing of monoclonal anti-
T.F., 1988. Structure of the circumsporozoite gene of Plasmodium malariae. Mol. bodies against Plasmodium falciparum sporozoites for ELISA development. Bull.
Biochem. Parasitol. 30, 291–294. World Health Organ. 65, 39–45.