Amplification of human papillomavirus (HPV) DNA by L1 consensus primer systems (e.g., MY09/11 or GP51/61) can detect as few as 10 to 100 molecules of HPV targets from a genital sample. However, genotype determination by dot blot hybridization is laborious and requires at least 27 separate hybridizations for substantive HPV-type discrimination. A reverse blot method was developed which employs a biotin-labeled PCR product hybridized to an array of immobilized oligonucleotide probes. By the reverse blot strip analysis, genotype discrimination of multiple HPV types can be accomplished in a single hybridization and wash cycle. Twenty-seven HPV probe mixes, two control probe concentrations, and a single reference line were immobilized to 75- by 6-mm nylon strips. Each individual probe line contained a mixture of two bovine serum albuminconjugated oligonucleotide probes specific to a unique HPV genotype. The genotype spectrum discriminated on this strip includes the high-risk, or cancer-associated, HPV genotypes 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 55, 56, 58, 59, 68 (ME180), MM4 (W13B), MM7 (P291), and MM9 (P238A) and the low-risk, or non-cancerassociated, genotypes 6, 11, 40, 42, 53, 54, 57, 66, and MM8 (P155). In addition, two concentrations of b-globin probes allowed for assessment of individual specimen adequacy following amplification. We have evaluated the performance of the strip method relative to that of a previously reported dot blot format (H. M. Bauer et al., p. 132–152, in C. S. Herrington and J. O. D. McGee (ed.), Diagnostic Molecular Pathology: a Practical Approach, (1992), by testing 328 cervical swab samples collected in Digene specimen transport medium (Digene Diagnostics, Silver Spring, Md.). We show excellent agreement between the two detection formats, with 92% concordance for HPV positivity (kappa 5 0.78, P < 0.001). Nearly all of the discrepant HPV-positive samples resulted from weak signals and can be attributed to sampling error from specimens with low concentrations (<1 copy/ml) of HPV DNA. The primary advantage of the strip-based detection system is the ability to rapidly genotype HPVs present in genital samples with high sensitivity and specificity, minimizing the likelihood of misclassification.

1. JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 1998, p. 3020–3027 Vol. 36, No. 10
0095-1137/98/$04.00 0
Copyright © 1998, American Society for Microbiology. All Rights Reserved.
Genotyping of 27 Human Papillomavirus Types by Using L1
Consensus PCR Products by a Single-Hybridization,
Reverse Line Blot Detection Method
P. E. GRAVITT,1† C. L. PEYTON,2 R. J. APPLE,1* AND C. M. WHEELER2
Department of Human Genetics, Roche Molecular Systems, Inc., Alameda, California 945011 and
Department of Molecular Genetics and Microbiology, University of New Mexico
School of Medicine, Albuquerque, New Mexico 871312
Received 5 March 1998/Returned for modification 6 May 1998/Accepted 12 June 1998
Amplification of human papillomavirus (HPV) DNA by L1 consensus primer systems (e.g., MY09/11 or
GP5 /6 ) can detect as few as 10 to 100 molecules of HPV targets from a genital sample. However, genotype
determination by dot blot hybridization is laborious and requires at least 27 separate hybridizations for
substantive HPV-type discrimination. A reverse blot method was developed which employs a biotin-labeled
PCR product hybridized to an array of immobilized oligonucleotide probes. By the reverse blot strip analysis,
genotype discrimination of multiple HPV types can be accomplished in a single hybridization and wash cycle.
Twenty-seven HPV probe mixes, two control probe concentrations, and a single reference line were immobilized
to 75- by 6-mm nylon strips. Each individual probe line contained a mixture of two bovine serum albumin-
conjugated oligonucleotide probes specific to a unique HPV genotype. The genotype spectrum discriminated on
this strip includes the high-risk, or cancer-associated, HPV genotypes 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 55,
56, 58, 59, 68 (ME180), MM4 (W13B), MM7 (P291), and MM9 (P238A) and the low-risk, or non-cancer-
associated, genotypes 6, 11, 40, 42, 53, 54, 57, 66, and MM8 (P155). In addition, two concentrations of -globin
probes allowed for assessment of individual specimen adequacy following amplification. We have evaluated the
performance of the strip method relative to that of a previously reported dot blot format (H. M. Bauer et al.,
p. 132–152, in C. S. Herrington and J. O. D. McGee (ed.), Diagnostic Molecular Pathology: a Practical Approach,
(1992), by testing 328 cervical swab samples collected in Digene specimen transport medium (Digene Diag-
nostics, Silver Spring, Md.). We show excellent agreement between the two detection formats, with 92%
concordance for HPV positivity (kappa 0.78, P < 0.001). Nearly all of the discrepant HPV-positive samples
resulted from weak signals and can be attributed to sampling error from specimens with low concentrations
(<1 copy/ l) of HPV DNA. The primary advantage of the strip-based detection system is the ability to rapidly
genotype HPVs present in genital samples with high sensitivity and specificity, minimizing the likelihood of
misclassification.
Epidemiologic evidence identifying human papillomavirus suggest a potential role in primary screening of populations in
(HPV) as the sexually transmitted, primary cause of cervical which Pap smears have not been sufficiently effective. A rapid
cancer is strong (12). It is clear from several large case-control PCR-based test for HPV DNA is also important to accurately
and cohort studies that HPV infection is the main risk factor investigate the natural history of HPV infections. Further-
for the development of cervical intraepithelial neoplasia and more, because of the high sensitivity and type specificity af-
that risk is significantly increased by persistent infection with forded only by amplified DNA detection methods, specific
high-risk, or cancer-associated, HPV genotypes (2, 3, 14, 15, PCR-based HPV DNA typing may have a unique utility in the
23). PCR technology, particularly with consensus, or general, clinical management of cervical lesions.
primer systems such as MY09/11 (1) and GP5 /6 (13), has We report a method that uses a sensitive and broad-spec-
been instrumental to these studies by elaborating the natural trum amplification system (1), followed by a single hybridiza-
history of HPV infections. The recognition of HPV infection as tion with a reverse line blot detection method for complete
a factor that is necessary, but not sufficient, for the develop- HPV genotype discrimination (see Fig. 1). This method, like
ment of cervical cancer has resulted in the initiation of several other PCR-based assays, avoids false negatives below the limit
longitudinal studies and randomized clinical trials designed to of detection of nonamplified methods and can readily detect a
examine the predictive value of HPV DNA testing (5, 6, 12, 17, broad spectrum of HPV genotypes. Furthermore, HPV type-
18, 24). Preliminary findings from these studies support the specific disease associations can be precisely defined, since
potential utility of HPV testing for the effective triage of Pap genotypes are individually discriminated.
smears of atypical squamous cells of undetermined significance
and atypical glandular cells of undetermined significance and MATERIALS AND METHODS
Sample acquisition and preparation. Cervical specimens were collected in 1.0
ml of specimen transport medium (Digene Diagnostics, Silver Spring, Md.) as
part of an ongoing natural history study of HPV infection conducted at the
* Corresponding author. Mailing address: Roche Molecular Sys-
University of New Mexico Health Sciences Center. The samples were processed
tems, Inc., 1145 Atlantic Ave., Alameda, CA 94501. Phone: (510) by adding 30 l of digestion solution to achieve a final concentration of 200 g
814-2938. Fax: (510) 522-1285. E-mail: raymond.apple@roche.com. of proteinase K per ml and 0.1% Laureth-12. Digestion was conducted at 56°C
† Present address: Department of Epidemiology, School of Hygiene for 1 h. A 300- l aliquot of the digested material was added to 1.0 ml of absolute
and Public Health, Johns Hopkins University, Baltimore, MD 21205. ethanol containing ammonium acetate and precipitated overnight at 20°C. The
3020

2. VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3021
FIG. 1. HPV genotyping of PCR product by reverse line blot method. Schematic of the reverse line blot genotyping assay from L1 consensus primer-generated PCR
products. The drawing represents the detection of a hypothetical mixed infection of HPV 16, 31, and 11.
precipitated DNA was centrifuged for 30 min at 13,000 g. The supernatant was each primer was labeled with a 5 biotin molecule (denoted in the primer name
immediately removed and discarded with a plugged Pasteur pipette. The crude by the inclusion of a capital B as follows: MYB09, MYB11, HMBB01, B GH20,
DNA pellet was dried overnight at room temperature. The pellet was then B PC04). In brief, each amplification contained 10 mM Tris-HCl (pH 8.5), 50
resuspended in 150 l of TE (10 mM Tris, 1 mM EDTA) and incubated for 15 mM KCl, 6 mM MgCl2, 200 M (each) dCTP, dGTP, and dATP, 600 M dUTP,
min at 95°C to inactivate the proteinase K. The crude DNA extracts were then 7 to 10 U of AmpliTaq Gold, 50 pmol of MYB09, 50 pmol of MYB11, 5 pmol of
stored at 20°C until amplification. HMBB01, 5 pmol of B PC04, 5 pmol of B GH20, and 5 to 10 l of sample (the
PCR and dot blot-based HPV-testing methods. Prior to amplification, the MgCl2, dUTP, and AmpliTaq Gold were modifications from dot blot protocol).
crude digests were allowed to reach room temperature and centrifuged briefly. Modifications to the published L1 consensus amplification were made to obtain
Six microliters of each specimen was amplified with the MY09-MY11-HMB01 optimal sensitivity and to standardize the format to other RMS PCR assays. For
L1 consensus primer system (1) and AmpliTaq polymerase (Perkin-Elmer, Fos- eventual inclusion of uracil-N-glycosylase to prevent product carryover, dTTP
ter City, Calif.). To determine specimen adequacy, the GH20/PC04 human was replaced with dUTP. It was empirically determined that the dUTP concen-
-globin target was coamplified with the HPV consensus primers. The PCRs tration must be increased threefold relative to the other dNTPs for efficient
were amplified in a Perkin-Elmer GeneAmp PCR System 9600 for 40 cycles. The strand incorporation by a DNA polymerase. The MgCl2 was subsequently reop-
following ultrasensitive, or long, amplification profile was used: 95°C denatur- timized to 6 mM to compensate for the increase in dNTP concentration. Reac-
ation for 1 min, 55°C annealing for 1 min, and 72°C extension for 1 min for 40 tions were amplified in a Perkin-Elmer TC9600 thermal cycler with the following
cycles; followed by a 5-min terminal extension at 72°C. A subset of 56 specimens ultrasensitive thermal profile: 9-min AmpliTaq Gold activation at 95°C, 40 cycles
were amplified with an alternate amplification profile (rapid amplification) as of 1-min denaturation at 95°C, 1-min annealing at 55°C, 1-min extension at 72°C;
follows: 95°C denaturation for 20 s, 55°C annealing for 20 s, and 72°C terminal a 5-min final extension at 72°C; and a hold step at 15°C. A subset of 56 specimens
extension for 30 s for 40 cycles; followed by a 5-min extension at 72°C. were amplified with an alternate amplification profile (rapid amplification) as
HPV typing analyses were carried out by dot blot hybridization and biotinyl- follows: a 9-min AmpliTaq Gold activation at 95°C followed by 40 cycles of
ated HPV type-specific oligonucleotide probes as previously described (1, 10). To denaturation for 20 s at 95°C, annealing for 20 s at 55°C, and terminal extension
each nylon membrane, 6 l of each PCR product was denatured and applied to for 30 s at 72°C; followed by a 5-minute extension at 72°C and a hold step at 15°C.
replicate membranes with dot blot apparatuses (Bio-Rad, Hercules, Calif.). Pre- After removal from the thermal cycler, samples were stored at 4°C.
viously characterized PCR products were applied to 22 wells on each membrane The general principle of immobilized probe hybridization has been described
as HPV type-specific controls (3.5 l of PCR product per well). The membranes elsewhere (4, 21), and a schematic of the procedure is presented in Fig. 1.
were hybridized at 53°C overnight with biotinylated HPV type-specific oligonu- Generally, the probes were diluted into a coating buffer (50 mM 3-[cyclohex-
cleotide probes (6/11, 16, 18, 31, 33, 35, 39, 45, 51 to 59, 66, 68, MM7, MM9, and ylamino]-1-propanesulfonic acid [CAPS] and 0.1 g of orange dye II per liter) and
MM4). Probes for HPV types 26 and MM8 and 40 and 42 were pooled as pairs applied to a plastic-backed nylon membrane strip with a pump mechanism which
during hybridization. A -globin probe was used to assess specimen adequacy. delivers controlled amounts of probe to the membrane. The HPV genotyping
Following hybridization, membranes were washed at 56 to 57°C to remove strip contains 29 probe lines plus one reference ink line, detecting 27 individual
nonspecifically bound probe. The wash buffer was 56 to 57°C so that the wash HPV genotypes and two concentrations of the -globin control probe. Two
stringency would be increased, given the salt and detergent concentrations and bovine serum albumin (BSA)-conjugated probes per HPV type, corresponding to
the selected oligonucleotide probes. This ensures efficient removal of the non- each of two hypervariable regions within the MY09/MY11 amplicon, are depos-
specifically bound probe and optimal specific hybridization. The bound probes ited in a single line for each of the following HPV types: 16, 18, 26, 31, 33, 35, 39,
were detected with streptavidin-horseradish peroxidase (Vector, Burlingame, 42, 45, 51 to 59, 66, 68, MM4, MM7, MM8, and MM9. HPV types 6, 11, 40, and
Calif.) and enhanced chemiluminescent substrate (ECL; Amersham, Arlington the -globin controls have a single probe deposited per line. Subsequent to this
Heights, Ill.). Blots were exposed to Kodak X-OMAT AR 5 film initially for 10 study, HPV 51A has been removed from the HPV 51 pool, due to apparent
min, followed by a second 2-h or overnight exposure. HPV positivity by dot blot cross-reactivity with nonspecific amplicon. The configuration of the genotyping
was determined by establishment of a negative cutoff, and signals above the strip is diagrammed in Fig. 2, and the probe sequences are listed in Table 1. The
cutoff were scored based on four graded levels of intensity with visual standard high- and low-risk HPV types are visually separated by -globin control lines
references. In addition, these autoradiograms were read by two blinded inde- such that all types between the reference and -globin control lines are associ-
pendent observers. The discrepant results were resolved independently by a third ated with high cancer risk and all types beyond the control lines are associated
observer. with low or no cancer risk. Disease association was defined according to the
PCR and line blot-based detection methods. HPV DNA was amplified by the International Biological Study on Cervical Cancer (3). In the International Bi-
L1 consensus primer system previously described for dot blot detection, except ological Study on Cervical Cancer, HPV types were considered high risk if

3. 3022 GRAVITT ET AL. J. CLIN. MICROBIOL.
FIG. 2. Probe layout of the HPV genotyping strip. (a) HPV genotyping strips (n 28) hybridized with the HPV L1 consensus PCR product generated from the
HPV targets indicated to the right. Fifty microliters of PCR product generated from amplification of 106 HPV plasmid targets (with the exception of HPV 51 and 68,
which were amplified with 103 plasmid targets) in a background of human cellular DNA (12.5 ng/PCR) was hybridized to the HPV genotyping strips and detected by
the previously described reverse line blot method. (b) Line blot genotyping hybridization results for 10 clinical specimens in the previously described study. Fifty
microliters of denatured PCR product was hybridized to each strip. The genotyping results for the specimens are as follows: no. 333, HPV negative; no. 334, HPV
negative; no. 352, HPV 16, 26, and MM8; no. 353, HPV 16; no. 354, HPV 16, 51, and 66; no. 355, HPV negative; no. 357, HPV 39; no. 359, HPV MM7; no. 361, HPV
16 and 52; and no. 373, HPV 18, 56, and 58.
detected as a single HPV infection within an invasive cancer. One exception is an water and stored in citrate buffer until interpretation. Developed strips were
HPV 6 which was found alone in a single invasive tumor; we still considered HPV interpreted or photographed within 2 h of color development for accurate anal-
6 to be an HPV with low oncogenic potential, and it remains in the low-risk ysis of the results. Strips can be stored in citrate buffer in a sealed plastic bag in
category within our present study. the dark. Any prolonged exposure to light results in fading of the signal and
All liquid detection reagents used for the line blot assay were from Amplicor darkening of the membrane. Alternatively, the strips can be dried immediately
strip detection reagent kits (Dynal, Oslo, Norway). PCR products were dena- following the final citrate buffer wash and taped directly into a research note-
tured with 0.13 N NaOH (1:2 dilution of 0.4 N NaOH in PCR product). HPV book. Strip interpretation was performed with a labeled acetate overlay, with
genotyping strips were placed into individual wells of the typing trays (Perkin- lines indicating the position of each probe relative to the reference mark.
Elmer) and covered with 3 ml of hybridization buffer (4 SSPE [1 SSPE is 0.18
M NaCl, 10 mM NaH2PO4, and 1 mM EDTA, pH 7.7], 0.1% sodium dodecyl
sulfate) prewarmed to 53°C. Seventy microliters of denatured, biotinylated prod- RESULTS
uct was added to each well and incubated in a shallow, shaking (60 rpm) water
bath at 53°C for 30 min. Following hybridization, trays were removed from the Analytic sensitivity of the HPV-type spectrum detected for
water bath, and hybridization solution was removed with a vacuum aspirator.
Strips were briefly rinsed in the trays with ambient wash buffer (1 SSPE, 0.1%
both dot blot and line blot assays was determined by serial
sodium dodecyl sulfate). After removal of the rinse by aspiration, 3 ml of dilution of HPV plasmid or M13 phage clones amplified in a
prewarmed (53°C) wash buffer was added to each well and the trays were background of 12.5 ng of human cellular DNA from the K562
incubated in a shaking water bath at 53°C for 15 min. After the stringent wash, cell line (ATCC CCL243). HPV types 58, 59, 61, 62, 64, and 67
buffer was removed, 3 ml of streptavidin-horseradish peroxidase conjugate was
added to each well, and the tray was placed on a rotating platform at room
were provided by T. Matsukura; HPVs 33, 39, 42, 54, 55, 66, 68,
temperature for 30 min, with shaking at 70 rpm. Unbound conjugate was re- and 70 were from G. Orth; HPVs 6, 11, 16, 18, 53, and 57 were
moved by a quick rinse with ambient wash buffer followed by two 10-min washes from E. M. de Villiers; HPV 52 was from W. Lancaster; HPV
in ambient wash buffer. After the final wash, buffer was removed by vacuum 26 was from R. Ostrow; HPV 45 was from K. Shah; and HPV
aspiration, and strips were rinsed in 0.1 M sodium citrate. Color development
was activated by incubation in a 4:1 mixture of substrates A (hydrogen peroxide
51 was from S. Silverstein. Clinical HPV types, including MM4
in sodium citrate buffer) and B (3,3 ,5,5 -tetramethylbenzidine in dimethylform- (W13B), MM7 (P291), MM8 (P155), and MM9 (P238A) had
amide) for 5 min on a rotating platform (70 rpm). Strips were rinsed in deionized been previously cloned as PCR fragments of approximately

4. VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3023
TABLE 1. BSA-conjugated HPV line blot probe sequences
HPV type BSA probe Biotinylated probe Sequencea
6 HPV611A MYB12 CATCCGTAACTACATCTTCCA (1)
11 HPV611B MYB13 TCTGTGTCTAAATCTGCTACA (1)
16 HPV16A MYB95 GATATGGCAGCACATAATGAC (1)
HPV16B MYB133 GTAACATCCCAGGCAATTG (1)
18 HPV18C CTTAAATTTGGTAGCATCATATTGb
HPV18D TCAGCCGGTGCAGCATCC
26 HPV26A MYB186 GCTGACAGGTAGTAGCAGAGTT (10)
HPV26B MYB187 GCCATAACATCTGTTGTAAGTG (10)
31 HPV31C GATCTTCCTTGGGCTTTTGG
HPV31D TGTCTGTTTGTGCTGCAATT
33 HPV33C CTGTCACTAGTTACTTGTGTGCAT
HPV33E TTTGGAGGTACTGTTTTTTGA
35 HPV35A MYB115 CTGCTGTGTCTTCTAGTGACAG (1)
HPV35B MYB117 ATCATCTTTAGGTTTTGGTGC (1)
39 HPV39A MYB89 TAGAGTCTTCCATACCTTCTAC (1)
HPV39B MYB90 CTGTAGCTCCTCCACCATCT (1)
40 HPV40A MYB176 CCCAAGGTACGGGAGGATCC (10)
42 HPV42C GCGTTGTTACCTTAGCCTGA
HPV42D ATCACCAGATGTTGCAGTG
45 HPV45A MYB69 ATACTACACCTCCAGAAAAGC (1)
HPV45B MYB129 GCACAGGATTTTGTGTAGAG (10)
51 HPV51Ab MYB87 TATTAGCACTGCCACTGCTG (1)
HPV51D CATCCTCCAAACTAGCAGAC
52 HPV52A MYB81 CACTTCTACTGCTATAACTTGT (1)
HPV52B MYB82 ACACACCACCTAAAGGAAAGG (1)
53 HPV53A MYB102 TTCTACCTTACTGGAAGACTGG (10)
HPV53B MYB182 GCAACCACACAGTCTATGTC (10)
54 HPV54C TTATTAAAGCTATCCTGCGTGG
HPV54D TCCTCCAAACTACTTGTAGCTG
55 HPV55A MYB151 GTGCTGCTACAACTCAGTCT (10)
HPV55D CGCATGTATTGTTTATATTCTGTA
56 HPV56A MYB197 GCACAGCTATAACATGTCAACG (10)
HPV56C CGTGCATCATATTTACTTAACTG
57 HPV57A MYB154 AATGTCTCTTTGTGTGCCAC (10)
HPV57B MYB156 GGATCAGTAGGGGTCTTAGG (10)
58 HPV58A MYB94 AGCACCCCCTAAAGAAAAGGA (10)
HPV58B MYB179 GACATTATGCACTGAAGTAACTAAG (10)
59 HPV59A MYB123 GCCAGTTAAACAGGACCC (10)
HPV59B MYB162 CCTAATGWATACACACCTACCAG (10)
66 HPV66A MYB83 ATTAATGCAGCTAAAAGCACATT (10)
HPV66B MYB178 CATGTCAGAGGGAACAGCC (10)
68 HPV68A MYB191 CATACCGCTATCTGCAATCAG (10)
HPV68B MYB194 CTACTACTGAATCAGCTGTACC (10)
MM4 HPVMM4A MYB164 CTCAATCTGTTGCACAAACA (10)
HPVMM4B MYB165 TAACCTTGCCCCCCTCAG (10)
Continued on following page

5. 3024 GRAVITT ET AL. J. CLIN. MICROBIOL.
TABLE 1—Continued
HPV type BSA probe Biotinylated probe Sequencea
MM7 HPVMM7A MYB166 GGCTAATGAATACACAGCCTC (10)
HPVMM7C TCCTTCCACCAGCCTTGAT
MM8 HPVMM8A MYB85 CCAACACCGAATCAGAATATAAA (10)
HPVMM8B MYB163 GTTGTGCCCCCTCCCTCCA (10)
MM9 HPVMM9A MYB104 GTAGGTACACAGGCTAGTAGCTC (10)
HPVMM9B MYB106 AGTTGCCAACGTCCTCAAC (10)
-Globin B PCO3 PC03 ACACAACTGTGTTCACTAGC (1)
a
Bold-faced sequences have not been previously published.
b
HPV 51A was subsequently removed from the assay; see Materials and Methods.
450 bp (16). Additional sensitivities were determined in pre- were amplified and detected with a long and short cycle profile
characterized cervical specimens. Sensitivities were virtually is presented in Table 3. Only 49 of the 56 samples were in-
identical by both dot and line blot assays, ranging from 10 to cluded in the final analysis due to false ECL signals on the dot
100 genomes per PCR for HPV types 6, 11, 16, 18, 31, 33, 39, blot. As expected, the agreement between the two amplifica-
45, 51, 52, 58, 59, 66, and 68 and from 500 to 1,000 genomes tion profiles reflected the increase in detection of low levels of
per PCR for HPV types 26, 35, 40, 42, and 53 to 57. Variation HPV with the longer, ultrasensitive profile. Only the line blot
in sensitivity among the genotypes reflects the number and results for rapid versus ultrasensitive amplification profiles are
position of mismatched bases in the primer-binding region at shown; however, the dot blot results were virtually identical
nondegenerate sites. (87.8% agreement, kappa 0.75 for both line and dot blot).
The specificity of HPV genotype discrimination was tested Further analysis of HPV data for both line and dot HPV assay
by hybridization of 500 ng (determined by gel quantitation) of was conducted based on recorded intensities. Signal intensity
amplified product to the HPV genotyping strips. Specificity of scores were as follows: 1, strong; 2, medium; 3, weak; 4, very
typing was excellent, with negligible background or cross-reac- weak; and 0, negative. Stratified analyses by signal intensity
tivity. revealed that a short versus a long profile resulted in discor-
To test the utility of the line blot HPV detection method in dance within HPV-positive specimens designated 3, 4, and 0
clinical samples, we analyzed 359 specimens collected in Di- (i.e., weak or negative) for both the line and dot blot assays.
gene specimen transport medium. Type-specific oligonucleo- Assays of samples with discrepant results were repeated by
tide probe results obtained by the standard MY09-MY11- line blot. Results by line blot were consistent after repeat
HMB01 dot blot hybridization method were compared to analysis, with the exception of weak-positive signals, which
those obtained using the MYB09-MYB11-BHMB01 reverse were inconsistently amplified. To ascertain the possibility of
line blot method. Two separate aliquots of each digested STM irreproducibility due to sampling error from low concentra-
sample were taken and processed independently at the two tions of viral DNA, we added HPV 16 plasmid DNA to a PCR
participating laboratory sites, where all aliquots were amplified premix for a final concentration of 1.27 10 4 fg/ l, the
by using the ultrasensitive amplification profile (see Materials equivalent of a single target per 100- l reaction mixture. This
and Methods). Thirty-two HPV-positive and 24 HPV-negative mixture was aliquotted to 80 PCR tubes and amplified under
samples determined by the ultrasensitive cycle system were sensitive amplification profiles. Analysis of the products by
randomly chosen for analysis by the short cycle profile, in strip analysis indicated that only 42 of 80, or 52.5%, were
which the time at each temperature step in the thermal profile positive for HPV DNA. Human DNA was included at a con-
was shortened. Samples were amplified separately for dot and centration of 2.5 ng per PCR and was amplified in all 80
line blot detection because of the requirement of unlabeled reactions.
versus labeled primers in the dot and line blot detection meth-
ods, respectively. Investigators performing the two assays were DISCUSSION
blinded to results until all interpretations were final.
Of the 359 samples evaluated, 30 were excluded because of We compared our reformatted line blot system to the estab-
false signal generation from the ECL substrate (1), presumably lished dot blot assay to evaluate its performance. In general,
caused by pseudoperoxidases in the sample, thus precluding the results from this comparison are highly concordant, both
interpretation of the dot blot results. The results from the for overall HPV DNA detection and for genotype-specific dis-
remaining 329 samples are presented. crimination. Most of the signals from the few discrepant sam-
The HPV prevalence in this population was 24.0 and 25.5% ples were weak, suggesting low concentration of viral DNA,
by the dot blot and line blot detection methods, respectively. with disagreement likely attributable to sampling error and
Table 2 represents the overall HPV concordance between the variable amplification of low levels of HPV DNA. This expla-
two detection formats. Agreement for HPV-positive results nation is substantiated by the following observations. First, the
was good, with a kappa statistic of 0.78. Type-specific agree- design of the study required each laboratory to prepare, am-
ment between the two methods was good, with total concor- plify, and detect each sample separately. This procedure cre-
dance ranging from 97 to 100%. Within the HPV-positive ates at least three separate circumstances wherein subaliquots
samples, multiple HPV types were detected in 10.7 and 8.5% of each sample were transferred to a subsequent step in the
of specimens by the dot blot and line blot detection methods, protocol. The likelihood of each transfer containing equivalent
respectively. A comparison of the results from 56 samples that concentrations of HPV DNA is low. Second, the discrepant

6. VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3025
TABLE 2. Correlation between results for dot and line blot assays (n 329)
Dot blot Line blot Dot or line Dot and strip % overall % agreement
HPV type Kappa
positive n (%) positive n (%) positive n (%) positive n (%) agreement among positives
Any 79 (24.0) 84 (25.5) 95 (28.9) 68 (20.7) 91.8 71.6 0.780
6 or 11 5 (1.5) 6 (1.8) 6 (1.8) 5 (1.5) 99.7 83.3 0.908
16 16 (4.9) 22 (6.7) 22 (6.7) 16 (4.9) 98.2 72.7 0.883
18 5 (1.5) 6 (1.8) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
26 or MM8 4 (1.2) 5 (1.5) 5 (1.5) 4 (1.2) 99.7 80.0 0.887
31 10 (3.0) 9 (2.7) 12 (3.6) 7 (2.1) 98.5 58.3 0.729
33 2 (0.6) 2 (0.6) 2 (0.6) 2 (0.6) 100 100 1.000
35 1 (0.3) 1 (0.3) 1 (0.3) 1 (0.3) 100 100 1.000
39 5 (1.5) 9 (2.7) 10 (3.0) 4 (1.2) 98.2 40.0 0.563
40 or 42 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
45 3 (0.9) 3 (0.9) 4 (1.2) 2 (0.6) 99.4 50.0 0.664
51 6 (1.8) 13 (4.0) 13 (4.0) 6 (1.8) 97.9 46.2 0.622
52 14 (4.3) 5 (1.5) 15 (4.6) 4 (1.2) 96.7 26.7 0.408
53 10 (3.0) 12 (3.6) 13 (4.0) 9 (2.7) 98.8 69.2 0.812
54 3 (0.9) 7 (2.1) 7 (2.1) 3 (0.9) 98.9 42.9 0.595
55 2 (0.6) 0 (0.0) 2 (0.6) 0 (0.0) 99.4 0.0
56 8 (2.4) 6 (1.8) 9 (2.7) 5 (1.5) 98.8 55.6 0.708
57 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
58 4 (1.2) 4 (1.2) 5 (1.5) 3 (0.9) 99.4 60.0 0.747
59 7 (2.1) 4 (1.2) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
66 5 (1.5) 6 (1.8) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
68 3 (0.9) 3 (0.9) 3 (0.9) 3 (0.9) 100 100 1.000
MM4 1 (0.3) 1 (0.3) 1 (0.3) 1 (0.3) 100 100 1.000
MM7 4 (1.2) 6 (1.8) 6 (1.8) 4 (1.2) 99.4 66.7 0.797
MM9 1 (0.3) 2 (0.6) 3 (0.9) 0 (0.0) 99.1 0.0 0.004
results were evenly distributed between the two methods, in- discrepancies to random sampling error, except those for HPV
dicating that neither method had a propensity toward false- types 51, 52, 54, and MM9. In these cases, the more-discordant
negative or false-positive results. Third, we demonstrated in a detection rates were attributed to differences in type-specific
controlled experiment that a homogeneous mixture of low- amplification efficiencies among degenerate primer lots (data
copy DNA yielded a positive result in only 52.5% (42 of 80) of not shown).
the reactions tested. Based on these results, we attribute most We also evaluated the effect of amplification conditions on
TABLE 3. Correlation between ultrasensitive and rapid PCR resultsa
Ultrasensitive Rapid positive Ultrasensitive or Ultrasensitive and % overall % agreement
HPV type Kappa
positive n (%) n (%) rapid positive n (%) rapid positive n (%) agreement among positives
Any 24 (49.0) 22 (44.9) 26 (53.1) 20 (40.8) 87.8 76.9 0.755
6 or 11 1 (2.0) 1 (2.0) 1 (2.0) 1 (2.0) 100 100 1.000
16 12 (24.5) 10 (20.4) 12 (24.5) 10 (20.4) 95.9 83.3 0.883
18 2 (4.1) 2 (4.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.479
26 or MM8 1 (2.0) 3 (6.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.484
31 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
33 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
35 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
39 1 (2.0) 1 (2.0) 1 (2.0) 1 (2.0) 100 100 1.000
40 or 42 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
45 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
51 5 (10.2) 2 (4.1) 5 (10.2) 2 (4.1) 93.9 40.0 0.545
52 3 (6.1) 0 (0.0) 3 (6.1) 0 (0.0) 93.9 0.0
53 3 (6.1) 1 (2.0) 3 (6.1) 1 (2.0) 95.9 33.3 0.484
54 2 (4.1) 2 (4.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.479
55 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
56 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
57 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
58 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
59 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
66 3 (6.1) 2 (4.1) 3 (6.1) 2 (4.1) 98.0 66.7 0.790
68 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
MM4 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
MM7 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
MM9 1 (2.0) 0 (0.0) 1 (2.0) 0 (0.0) 98.0 0.0
a
n 49 for line blot results.

7. 3026 GRAVITT ET AL. J. CLIN. MICROBIOL.
the low-end sensitivity of the assay by decreasing the time crease both the sensitivity and specificity of cervical cancer
spent at each thermal cycling step in the amplification profile. screening. Furthermore, the amplification and detection pro-
The results confirm that the discrepancies predominate among tocols used with the line blot detection method are compatible
the low-copy, or weak, positives, while all other results are with automation, facilitating the use of this method in large-
consistent, independent of the profile used. These results re- scale studies or screening. The ability to visually categorize
flect the inherent variability in sensitivity that results from high- versus low-risk HPV infection rapidly by the line blot
seemingly minor changes in protocol. Thus, it is recommended supports the use of a detailed and informative research assay
that changes to standardized protocols be accompanied by for routine clinical screening and patient management pur-
revalidated assays and appropriately redefined performance poses.
criteria.
It has been clearly demonstrated that accurate measurement ACKNOWLEDGMENTS
of even minute levels of HPV DNA is critical for a compre- This work was funded in part by a grant to C.M.W. from the Na-
hensible evaluation of the natural history of HPV infection (7). tional Institutes of Health (AI32917).
Use of a nonamplified method can dramatically skew the We thank William C. Hunt for performing the statistical analysis,
strength and even the existence of important epidemiologic Susan Eaton for excellent technical support, and the Roche Molecular
Systems DNA synthesis group for oligonucleotide support.
associations. Thus, amplification methods, including consen-
sus, or general, primer PCR have been adopted for the major- REFERENCES
ity of epidemiological studies (11, 20, 22). While the use of 1. Bauer, H. M., C. E. Greer, and M. M. Manos. 1992. Determination of genital
PCR methods can increase the molecular sensitivity of HPV human papillomavirus infection using consensus PCR, p. 132–152. In C. S.
Herrington and J. O. D. McGee (ed.), Diagnostic molecular pathology: a
DNA detection, the issue of misclassification remains (8, 9, practical approach. Oxford University Press, Oxford, United Kingdom.
19). It is important not only to increase the sensitivity relative 2. Bosch, F. X., N. Munoz, S. de Sanjose, C. Navarro, P. Moreo, N. Ascunce,
to detectable levels of virus but also to increase sensitivity by L. C. Gonzalez, L. Tafur, M. Gili, I. Larranaga, et al. 1993. Human papil-
increasing the spectrum of HPV genotypes detected, a goal lomavirus and cervical intraepithelial neoplasia grade III/carcinoma in situ:
a case-control study in Spain and Colombia. Cancer Epidemiol. Biomarkers
met by consensus primer PCR assays. However, previously Prev. 2:415–422.
described consensus PCR methods that utilized dot blot for- 3. Bosch, F. X., M. M. Manos, N. Munoz, M. Sherman, A. M. Jansen, J. Peto,
mats are too laborious to allow for the rapid evaluation of M. H. Schiffman, V. Moreno, R. Kurman, K. V. Shah, and the IBSCC Study
genotype-specific infections in large population studies. As a Group. 1995. Prevalence of human papillomavirus in cervical cancer: a
worldwide perspective. J. Natl. Cancer Inst. 87:796–802.
result, some investigators have combined genotyping probes 4. Bugawan, T. L., R. Apple, and H. Erlich. 1994. A method for typing poly-
into mixtures of presumably related HPV types in an attempt morphism at the HLA-A locus using PCR amplification and immobilized
to reduce the number of hybridizations required. For example, oligonucleotide probes. Tissue Antigens 44:137–147.
HPV 18 and 45 are often combined, the HR HPV 50s are 5. Cox, J. T., A. T. Lorincz, M. H. Schiffman, M. E. Sherman, A. Cullen, and
R. J. Kurman. 1995. Human papillomavirus testing by hybrid capture ap-
combined, the HR HPV 30s are combined, etc. Assumptions pears to be useful in triaging women with a cytologic diagnosis of atypical
have to be made regarding the validity of these groupings. squamous cells of undetermined significance. Am. J. Obstet. Gynecol. 172:
Groupings have historically been made according to anecdotal 946.
observations of disease relatedness and more recently accord- 6. Cuzick, J., A. Szarewski, G. Terry, L. Ho, A. Hanby, P. Maddox, M. Ander-
son, G. Kocjan, S. T. Steele, and J. Guillebaud. 1995. Human papillomavirus
ing to phylogenetic relatedness. While these assumptions are testing in primary cervical screening. Lancet 345:1533.
reasonable for grouping related viruses, the information ob- 7. Franco, E. L. 1991. The sexually transmitted disease model for cervical
tained from such groupings is inherently biased. Given that cancer: incoherent epidemiologic findings and the role of misclassification of
slight misclassification of HPV-type status may have dramatic human papillomavirus infection. Epidemiology 2:98–106.
8. Franco, E. L. 1992. Measurement errors in epidemiological studies of human
effects on the interpretation of far-more-subtle associations, papillomavirus and cervical cancer, p. 181–197. In N. Munoz, F. X. Bosch,
some of which are also prone to measurement error, it is K. J. Shah, and A. Meheus (ed.), The epidemiology of human papillomavirus
clearly important to develop accurate discriminatory HPV- and cervical cancer. Oxford University Press, Oxford, United Kingdom.
typing systems. 9. Franco, E. L. 1997. Statistical issues in studies of human papillomavirus
infection and cervical cancer, p. 39–50. In E. Franco and J. Monsonego (ed.),
The PCR-based line blot HPV detection method described New developments in cervical cancer screening and prevention. Blackwell
here allows sensitive amplification of a broad spectrum of HPV Science Ltd., Oxford, United Kingdom.
genotypes and accurate discrimination between 27 of those 10. Hildesheim, A., M. H. Schiffman, P. E. Gravitt, A. G. Glass, C. E. Greer, T.
types. Subsequent to this report, our collaborative efforts have Zhang, D. R. Scott, B. B. Rush, P. Lawler, M. Sherman, R. J. Kuman, and
M. M. Manos. 1994. Persistence of type-specific human papillomavirus in-
extended the HPV type-specific discrimination of this novel fection among cytologically normal women. J. Infect. Dis. 169:235–240.
line blot to an additional 12 HPV types (data not shown). Thus, 11. Ho, G. Y. F., R. D. Burk, S. Klein, A. S. Kadish, C. J. Chang, P. Palan, J.
disease associations can be more accurately defined, since dis- Bassu, R. Tachezy, R. Lewis, and S. Romney. 1995. Persistent genital human
crete and comprehensive genotyping information is available, papillomavirus infection as a risk factor for persistent cervical dysplasia.
J. Natl. Cancer Inst. 87:1365–1371.
without confounding due to potential misclassification. Also, 12. International Agency for Research on Cancer. 1995. Monographs on the
since the central role of HPVs in the etiology of cervical cancer evaluation of the carcinogenic risk of chemicals to humans, vol. 64. Human
has been defined, natural history studies of HPV infection will papillomaviruses. International Agency for Research on Cancer, Lyon,
now address more difficult issues, such as persistence, trans- France.
13. Jacobs, M. V., P. J. F. Snijders, A. J. C. van den Bruie, T. J. M. Helmerhorst,
missibility, and immunologic responses. All these parameters C. J. L. M. Meijer, and J. M. M. Walboomers. 1997. A general primer
are adequately studied only in an HPV type-specific or perhaps GP5 /6 -mediated PCR-enzyme immunoassay method for rapid detection
even in an HPV variant-specific manner. of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical
In addition to natural history studies of HPV infection, the scrapings. J. Clin. Microbiol. 35:791–795.
14. Koutsky, L. A., K. K. Holmes, C. W. Critchlow, C. E. Stevens, J. Paavonen,
success of HPV DNA testing in patient management and can- A. M. Beckmann, T. A. DeRouen, D. A. Galloway, D. Vernon, and N. B.
cer screening strategies is dependent upon the methodology Kiviat. 1992. A cohort study of the risk of cervical intraepithelial neoplasia
used. The key to improving the current standard of Pap screen- grade 2 or 3 in relation to papillomavirus infection. N. Engl. J. Med. 327:
ing may be to significantly increase the specificity of cytology- 272–278.
15. Liaw, K.-L., A. W. Hsing, C. J. Chen, M. H. Schiffman, T. Y. Zhang, C. Y.
based screening, without a concomitant decrease in sensitivity. Hsieh, C. E. Greer, S. L. You, T. W. Huang, T. C. Wu, et al. 1995. Human
It is believed that an HPV DNA testing method with both papillomavirus and cervical neoplasia: a case-control study in Taiwan. Int. J.
high-positive and negative predictive value will serve to in- Cancer 62:565–571.

8. VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3027
16. Manos, M. M., J. Waldman, T. Y. Zhang, C. E. Greer, G. Eichinger, M. H. 1995. The presence of persistent high-risk HPV genotypes in dysplastic
Schiffman, and C. M. Wheeler. 1994. Epidemiology and partial nucleotide cervical lesions is associated with progressive disease: natural history up to 36
sequence of four novel genital human papillomaviruses. J. Infect. Dis. 170: months. Int. J. Cancer 61:306–311.
1096–1099. 21. Saiki, R. K., P. S. Walsh, C. H. Levenson, and H. A. Erlich. 1989. Genetic
17. Meijer, C. J. L. M., L. Rozendaal, J. C. van der Linden, et al. 1997. Human analysis of amplified DNA with immobilized sequence-specific oligonucleo-
papillomavirus testing for primary cervical screening, p. 338–347. In E. tide probes. Proc. Natl. Acad. Sci. USA 86:6230–6234.
Franco and J. Monsonego (ed.), New developments in cervical cancer 22. Schiffman, M. H. 1995. New epidemiology of human papillomavirus infec-
screening and prevention. Blackwell Science Ltd., Oxford, United Kingdom.
tion and cervical neoplasia. J. Natl. Cancer Inst. 87:1345–1347.
18. Mould, T. A., and A. Singer. 1997. Human papillomavirus testing for diag-
23. Schiffman, M., H. Bauer, R. Hoover, A. G. Glass, D. M. Cadell, B. B. Rush,
nostic triage of minor-grade cytological abnormalities: the European per-
spective, p. 354–359. In E. Franco and J. Monsonego (ed.), New develop- D. R. Scott, M. E. Sherman, R. J. Kurman, S. Wacholder, C. K. Stanton, and
ments in cervical cancer screening and prevention. Blackwell Science Ltd., M. M. Manos. 1993. Epidemiologic evidence showing that HPV infection
Oxford, United Kingdom. causes most cervical intraepithelial neoplasia. J. Natl. Cancer Inst. 85:958–
19. Qu, W., G. Jiang, Y. Cruz, C. J. Chang, G. Y. F. Ho, R. S. Klein, and R. D. 964.
Burk. 1997. PCR detection of human papillomavirus: comparison between 24. Sherman, M. E., M. H. Schiffman, A. T. Lorincz, M. M. Manos, D. R. Scott,
MY09/MY11 and GP5 /GP6 primer systems. J. Clin. Microbiol. 35:1304– R. J. Kurman, N. B. Kiviat, M. Stoler, A. G. Glass, and B. B. Rush. 1994.
1310. Toward objective quality assurance in cervical cytopathology: correlation of
20. Remmink, A. J., J. M. M. Walboomers, T. J. M. Helmerhorst, F. J. Voor- cytopathologic diagnoses with detection of high-risk human papillomavirus
horst, L. Rozendaal, E. K. J. Risse, C. J. L. M. Meijer, and P. Kenemans. types. Am. J. Clin. Pathol. 2:182–187.