SlideShare une entreprise Scribd logo

Perform a BLAST search on the following nucleotide sequence and answ.pdf

•
•
A
amayagency123

Perform a BLAST search on the following nucleotide sequence and answer the following 3 questions: https://blast.ncbi.nlm.nih.gov/Blast.cgi 1. What is the name of the gene from which this nucleotide sequence is derived? 2. What human disease has been associated with this gene? 3. What is the function of this gene product?ACCCAGGAACTGAGGGCGCTGATGGACGAG.

Formation
1  sur  1
Télécharger pour lire hors ligne
Perform a BLAST search on the following nucleotide sequence and answer the following 3 questions: https://blast.ncbi.nlm.nih.gov/Blast.cgi 1. What is the name of the gene from which this nucleotide sequence is derived? 2. What human disease has been associated with this gene? 3. What is the function of this gene product?ACCCAGGAACTGAGGGCGCTGATGGACGAG

Recommandé

Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdf
Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdfPepper, Inc., an S corporation, holds a $1 million balance in accumu.pdf
Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdfamayagency123
 
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdf
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdfPensando en las caracter�sticas del control efectivo, elija el t�rmi.pdf
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdfamayagency123
 
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdf
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdfPatentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdf
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdfamayagency123
 
Peete Company identifies the following items for possible inclusion .pdf
Peete Company identifies the following items for possible inclusion .pdfPeete Company identifies the following items for possible inclusion .pdf
Peete Company identifies the following items for possible inclusion .pdfamayagency123
 
Pension data for Barry Financial Services Incorporated include the f.pdf
Pension data for Barry Financial Services Incorporated include the f.pdfPension data for Barry Financial Services Incorporated include the f.pdf
Pension data for Barry Financial Services Incorporated include the f.pdfamayagency123
 
People who are considered to be effective leaders usually have the f.pdf
People who are considered to be effective leaders usually have the f.pdfPeople who are considered to be effective leaders usually have the f.pdf
People who are considered to be effective leaders usually have the f.pdfamayagency123
 
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdf
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdfParte 2 Elija dos de las caracter�sticas definitorias de la vi.pdf
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdfamayagency123
 
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdf
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdfParte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdf
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdfamayagency123
 

Recommandé

Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdf
Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdfPepper, Inc., an S corporation, holds a $1 million balance in accumu.pdf
Pepper, Inc., an S corporation, holds a $1 million balance in accumu.pdfamayagency123
 
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdf
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdfPensando en las caracter�sticas del control efectivo, elija el t�rmi.pdf
Pensando en las caracter�sticas del control efectivo, elija el t�rmi.pdfamayagency123
 
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdf
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdfPatentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdf
Patentes A. tambi�n se denominan marcas comerciales. B. dar a las e.pdfamayagency123
 
Peete Company identifies the following items for possible inclusion .pdf
Peete Company identifies the following items for possible inclusion .pdfPeete Company identifies the following items for possible inclusion .pdf
Peete Company identifies the following items for possible inclusion .pdfamayagency123
 
Pension data for Barry Financial Services Incorporated include the f.pdf
Pension data for Barry Financial Services Incorporated include the f.pdfPension data for Barry Financial Services Incorporated include the f.pdf
Pension data for Barry Financial Services Incorporated include the f.pdfamayagency123
 
People who are considered to be effective leaders usually have the f.pdf
People who are considered to be effective leaders usually have the f.pdfPeople who are considered to be effective leaders usually have the f.pdf
People who are considered to be effective leaders usually have the f.pdfamayagency123
 
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdf
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdfParte 2 Elija dos de las caracter�sticas definitorias de la vi.pdf
Parte 2 Elija dos de las caracter�sticas definitorias de la vi.pdfamayagency123
 
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdf
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdfParte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdf
Parte 1 Junt�ndolorespondelas preguntas sobre el pa�s ficticio de .pdfamayagency123
 
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfParte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfamayagency123
 
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfparte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfamayagency123
 
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfParte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfamayagency123
 
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfParte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfamayagency123
 
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfParte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfamayagency123
 
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfPARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfamayagency123
 
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfParte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfamayagency123
 
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfParte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfamayagency123
 
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfPARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfamayagency123
 
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfPatr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfamayagency123
 
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfPathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfamayagency123
 
Please answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfPlease answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfamayagency123
 
Please answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfPlease answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfamayagency123
 
Please answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfPlease answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfamayagency123
 
Please answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfPlease answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfamayagency123
 
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfPlease answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfamayagency123
 
Please answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfPlease answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfamayagency123
 
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfPiense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfamayagency123
 
Please answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfPlease answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfamayagency123
 
Please answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfPlease answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfamayagency123
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application ) Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application ) Sakshi Ghasle
 

Contenu connexe

Plus de amayagency123

Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfParte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfamayagency123
 
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfparte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfamayagency123
 
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfParte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfamayagency123
 
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfParte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfamayagency123
 
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfParte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfamayagency123
 
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfPARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfamayagency123
 
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfParte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfamayagency123
 
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfParte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfamayagency123
 
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfPARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfamayagency123
 
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfPatr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfamayagency123
 
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfPathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfamayagency123
 
Please answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfPlease answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfamayagency123
 
Please answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfPlease answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfamayagency123
 
Please answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfPlease answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfamayagency123
 
Please answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfPlease answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfamayagency123
 
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfPlease answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfamayagency123
 
Please answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfPlease answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfamayagency123
 
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfPiense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfamayagency123
 
Please answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfPlease answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfamayagency123
 
Please answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfPlease answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfamayagency123
 

Plus de amayagency123 (20)

Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfParte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
 
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfparte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
 
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfParte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
 
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfParte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
 
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfParte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
 
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfPARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
 
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfParte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
 
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfParte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
 
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfPARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
 
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfPatr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
 
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfPathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
 
Please answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfPlease answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdf
 
Please answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfPlease answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdf
 
Please answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfPlease answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdf
 
Please answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfPlease answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdf
 
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfPlease answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
 
Please answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfPlease answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdf
 
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfPiense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
 
Please answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfPlease answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdf
 
Please answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfPlease answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdf
 

Dernier

1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application ) Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application ) Sakshi Ghasle
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13Steve Thomason
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphThiyagu K
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformChameera Dedduwage
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3JemimahLaneBuaron
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
mini mental status format.docx
mini mental status format.docxmini mental status format.docx
mini mental status format.docxPoojaSen20
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfsanyamsingh5019
 
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdfssuser54595a
 
Organic Name Reactions for the students and aspirants of Chemistry12th.pptx
Organic Name Reactions for the students and aspirants of Chemistry12th.pptxOrganic Name Reactions for the students and aspirants of Chemistry12th.pptx
Organic Name Reactions for the students and aspirants of Chemistry12th.pptxVS Mahajan Coaching Centre
 
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...RKavithamani
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Krashi Coaching
 
How to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxHow to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxmanuelaromero2013
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 
URLs and Routing in the Odoo 17 Website App
URLs and Routing in the Odoo 17 Website AppURLs and Routing in the Odoo 17 Website App
URLs and Routing in the Odoo 17 Website AppCeline George
 

Dernier (20)

1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application ) Hybridoma Technology ( Production , Purification , and Application )
Hybridoma Technology ( Production , Purification , and Application )
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy Reform
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
mini mental status format.docx
mini mental status format.docxmini mental status format.docx
mini mental status format.docx
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdf
 
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
18-04-UA_REPORT_MEDIALITERAСY_INDEX-DM_23-1-final-eng.pdf
 
Organic Name Reactions for the students and aspirants of Chemistry12th.pptx
Organic Name Reactions for the students and aspirants of Chemistry12th.pptxOrganic Name Reactions for the students and aspirants of Chemistry12th.pptx
Organic Name Reactions for the students and aspirants of Chemistry12th.pptx
 
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...
Privatization and Disinvestment - Meaning, Objectives, Advantages and Disadva...
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
 
How to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxHow to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptx
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
URLs and Routing in the Odoo 17 Website App
URLs and Routing in the Odoo 17 Website AppURLs and Routing in the Odoo 17 Website App
URLs and Routing in the Odoo 17 Website App
 

Perform a BLAST search on the following nucleotide sequence and answ.pdf

  • 1. Perform a BLAST search on the following nucleotide sequence and answer the following 3 questions: https://blast.ncbi.nlm.nih.gov/Blast.cgi 1. What is the name of the gene from which this nucleotide sequence is derived? 2. What human disease has been associated with this gene? 3. What is the function of this gene product?ACCCAGGAACTGAGGGCGCTGATGGACGAG