[2024]Digital Global Overview Report 2024 Meltwater.pdf
Presentation from Bioconference Live 2010
1. Using Targeted Resequencing Microarrays for
Simultaneous Definitive Detection and Identification of
Multiple Respiratory Pathogens.
Agnieszka M. Lichanska, Clark Tibbetts, and
Matthew C. Lorence
TessArae, LLC, Potomac Falls, Virginia, USA
TessArae, LLC, Proprietary Information
2. Overview
Re-sequencing technology vs. traditional diagnostic
techniques
How does re-sequencing work?
How are the techniques different?
Identification of new pathogens - an example: novel
H1N1 flu
Additional examples of use of RPM-Flu 3.1 assay
Summary
TessArae, LLC, Proprietary Information
3. Shift in Microbial Diagnostics
TessArae Inc.
TessArray RPM-Flu v3.1
Respiratory Pathogen
Panel
P/N: 520-191
TessArray™
Phenotypic detection Genotypic detection
and identification and identification
Mainly single result per test Multiple results per one test
Multiple signatures per pathogen
Detection and confirmation
TessArae, LLC, Proprietary Information
4. RPM Strategy
GTATGGTAGTTGAGATAATTAGCTT
Probes to interrogate
GTATGGTAGTTGCGATAATTAGCTT center position of first
complementary target
GTATGGTAGTTGGGATAATTAGCTT strand
GTATGGTAGTTGTGATAATTAGCTT
Target GTATGGTAGTTGGGATAATTAGCTTGATGT
CATACCATCAACCCTATTAATCGAACTACA
CATACCATCAACACTATTAATCGAA
Probes to interrogate
CATACCATCAACCCTATTAATCGAA center position of second
complementary target
CATACCATCAACGCTATTAATCGAA strand
CATACCATCAACTCTATTAATCGAA
25-base window of 8 transducers
Hemagglutinin A/Goose/Guangdong/1/96/H5N1
TessArae, LLC, Proprietary Information
7. Influenza A HA1 Coronavirus (229E)
Influenza A HA2 Coronavirus (OC43)
Influenza A HA3 Coronavirus (NL63)
Influenza A HA4 Coronavirus (SARS Urbani)
TessArray® Influenza A HA5
Influenza A HA6
Cytomegalovirus (HHV-5)
Enteroviruses:
Influenza A HA7 • Coxsackievirus (5 types)
RPM-Flu 3.1 Influenza A HA8
Influenza A HA9
• Echovirus (8 types)
• Rhinovirus (27 types)
TessArae, LLC Influenza A HA10 Measles Virus
TessArray RPM-Flu v3.1
Respiratory Pathogen Panel Influenza A HA11 Metapneumovirus (types A, B)
P/N: 520-191
Influenza A HA12 Parainfluenza 1
Influenza A HA13 Parainfluenza 2
Influenza A HA14 Parainfluenza 3
Influenza A HA15 Parainfluenza 4a
Influenza A HA16 Parainfluenza 4b
RSV A
Influenza A NA1 RSV B
Influenza A NA2 Rubella Virus
TessArray™ Influenza A NA3
Influenza A NA4 Bordatella pertussis
Influenza A NA5 Corynebacterium diphtheriae
Influenza A NA6 Chlamydia psittaci
Simultaneous differential diagnosis Influenza A NA7 Chlamydia trachomatis
Influenza A NA8 Chlamydophila pneumoniae
of influenza-like illness Influenza A NA9 Haemophilus influenzae
Influenza A Mtx Klebsiella pneumoniae
30 different types of viral and Influenza A NS Legionella pneumophila
Influenza A PB2 Moraxella catarrhalis
bacterial respiratory pathogens Influenza B HA1 Mycobacterium kansasii
Influenza B HA2 Mycobacterium tuberculosis
938,032 oligonucleotide probes Influenza B NA1 Mycoplasma pneumoniae
Neisseria meningitidis
Influenza B Mtx Pseudomonas aeruginosa
117,254 nucleotides of targeted Staphylococcus aureus
Adenovirus B Streptococcus agalactiae
pathogen gene sequences per assay Adenovirus C Streptococcus pneumoniae
Adenovirus D Streptococcus pyogenes
Adenovirus E
Variola major
Bacillus anthracis
Francisella tularensis
Yersinia pestis
TessArae, LLC, Proprietary Information
8. How the RPM Assay Works?
Control Template Live Influenza Vaccine (FluMist® 2004-2005)
Trivalent mixture of different influenza virus A/HN and B subtypes
A/Canterbury/20/1999 (H1N1)
A/Wyoming/3/2003 (H3N2)
B/Jilin/20/2003
Hemagglutinin and Neuraminidase Genes from these Vaccine Strains
Engineered by Reassortment with Cold-Adapted Master Strains
A/Ann Arbor/6/1960 (H2N2)
B/Ann Arbor/1/1966
Matrix and Other Viral Genes from Master Strains
TessArae, LLC, Proprietary Information
9. Background
Chip
Segment
Translation Key:
Tile T C
GA
T G C A
TGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGA
Influenza A Virus segment 4 hemagglutinin (HA1)
TessArae, LLC, Proprietary Information
15. Detecting Seasonal Strains of Influenza
RPM-Detector Tiles for Seasonal A/H1N1 and Seasonal A/H3N2 Influenza Viruse s
Vir u s Target Gen e Detector Tile Sequence/Strai n Leng t h Prob e s
A/H1 N 1 Hemagglutinin(A/HA1 ) A/New Caledonia/20/1999(H1N1) 1500 bp 12,000
A/H1 N 1 Neuraminidase(A/N A 1 ) A/New Caledonia/20/1999(H1N1) 1200 bp 9,600
A/H1 N 1 Matrix(A/H1N1-M ) A/Canterbury/100/2000(H1N1) 850 bp 6,800
A/H3 N 2 Hemagglutinin(A/HA3 ) A/Canterbury /125/2005(H3 N 2 ) 1500 bp 12,000
A/H3 N 2 Neuraminidase(A/N A 2 ) A/Canterbury /125/2005(H3 N 2 ) 1200 bp 9,600
A/H3 N 2 Matrix(A/H3N2-M ) A/Canterbury /125/2005(H3 N 2 ) 850 bp 6,800
TessArae, LLC, Proprietary Information
16. A Sentinel Case
April 2009:
Patient presents at Washington, DC hospital
Recently returned from vacation in Mexico
Convalescing from recent flu-like illness
Anxious about reports of novel influenza outbreak
TessArray Outcomes:
01 May 2009 - Best Matches
L20309, X90504 H influenzae outer membrane protein P5
A/duck/Guanxi/2004(H5N1); A/chicken/Yogjakarta/2004(H5N1)
Very unusual result suggested patient had been infected by an avian influenza virus
Database updated following week, new sequence records from Mexico outbreak isolates
05 May 2009 - Best Matches
L20309, X90504 H influenzae outer membrane protein P5
A/California/07/2009(H1N1); A/Texas/04/2009(H1N1)
Perfect Match to New CDC Strain!
From a Test Designed in 2006 With No Prior Knowledge of New Strain
TessArae, LLC, Proprietary Information
17. T S R A - A ML_CNMC_01_050109 (“RPM-Flu Sentinel Case”)
Best Matches from VSRD Archive Best Matches from VSRD Archive
Updated November 2008 Updated May 2009
A/chicken/Indonesia/7/2003(H5N1)
A/chicken/Puebla/231-5284/98(H5N2) A/chicken/Puebla/231-5284/98 (H5N2)
A/chicken/Yogjakarta/BBVet-IX/2004(H5N1)
A/duck/Guangxi/1436/2006(H5N1)
A/duck/Guangxi/351/2004(H5N1)
A/duck/Guangxi/3548/2005(H5N1)
A/duck/Guangxi/380/2004(H5N1)
A/duck/Guangxi/4016/2005(H5N1)
A/hooded vulture/Burkina Faso/2/2006(H5N1)
A/mallard/Alberta/111/99(H4N6) A/mallard/Alberta/111/99(H4N6)
A/mallard/Maryland/1235/2006(H3N6) A/mallard/Maryland/1235/2006(H3N6)
A/quail/Tasikmalaya/BPPV4/2004(H5N1)
A/swine/Hong Kong/1197/02(H3N2) A/swine/Hong Kong/1197/02(H3N2)
A/swine/Iowa/930/01(H1N2)
A/swine/Virginia/670/1987(H1N1)
A/swine/Virginia/671/1987(H1N1)
A/swine/British Columbia/28103/2005(H3N2)
A/California/04/2009(H1N1)
A/California/05/2009(H1N1)
A/California/06/2009(H1N1)
A/California/07/2009(H1N1)
RPM detection and identification works for A/California/08/2009(H1N1)
A/California/09/2009(H1N1)
A/California/10/2009(H1N1)
strains and variants A/California/14/2009(H1N1)
A/Canada-ON/RV1527/2009(H1N1)
that share at least 80% sequence similarity to A/New York/06/2009(H1N1)
A/New York/10/2009(H1N1)
array detector tiles
A/New York/11/2009(H1N1)
A/New York/15/2009(H1N1)
A/New York/18/2009(H1N1)
A/New York/19/2009(H1N1)
A/New York/20/2009(H1N1)
A/New York/22/2009(H1N1)
A/Ohio/07/2009(H1N1)
A/Texas/04/2009(H1N1)
A/Texas/05/2009(H1N1)
190/215 = 88%
The RPM-Flu 3.1 designed for A/H5N1 in 2006 is capable to sensitively detect and differentiate
the Novel A/H1N1 SOIV from Seasonal A/H1N1 and Seasonal A/H3N2 subtypes without modification
TessArae, LLC, Proprietary Information
18. Avian A/H5N1 matrix
gene resequencing
detector tile sequence
(top sequence)
2009 Novel H1N1
(A/Pensacola/INS107/200
9(H1N1)) strain (middle
sequence)
Sequence from a high titer
stock of a 2009 Novel H1N1
outbreak strain strain,
A/NHRC-
California/BRD_40116(H1N1)
(bottom sequence)
Legend:
“x” = Mismatch
“|” = Match
TessArae, LLC, Proprietary Information
21. Detecting Emergent Strains
What’s on the Device: 2004-5 FluMist
A/New Caledonia/20/1999(H1N1) Hemagglutinin A/New Caledonia/20/1999(H1N1)
A/New Caledonia/20/1999(H1N1) Neuraminidase A/New Caledonia/20/1999(H1N1)
A/Canterbury/100/2000(H1N1) Matrix A/Ann Arbor/6/1960(H2N2)
A/Canterbury/125/2005 (H3N2) Hemagglutinin A/Wyoming/03/2003 (H3N2)
A/Canterbury/125/2005 (H3N2) Neuraminidase A/Wyoming/03/2003 (H3N2)
A/Canterbury/125/2005 (H3N2) Matrix A/Ann Arbor/6/1960(H2N2)
What it Told Us: 2009-10 FluMist
A/South Dakota/6/2007(H1N1)
A/South Dakota/6/2007(H1N1)
A/Ann Arbor/6/1960(H2N2)
A/Uruguay/716/2007 (H3N2)
TessArae, LLC A/Uruguay/716/2007 (H3N2)
TessArray RPM-Flu v3.1
Respiratory Pathogen Panel A/Ann Arbor/6/1960(H2N2)
P/N: 520-191
2006-7 FluZone
A/New Caledonia/20/1999(H1N1)
A/New Caledonia/20/1999(H1N1)
A/Puerto Rico/8/1934(H1N1)
A/Wisconsin/67/2005 (H3N2)
TessArray™ A/Wisconsin/67/2005 (H3N2)
A/Puerto Rico/8/1934(H1N1)
2009-10 FluVirin
When Confronted With Different A/South Dakota/6/2007(H1N1)
Strains the Array Still Tells Us A/South Dakota/6/2007(H1N1)
A/Puerto Rico/8/1934(H1N1)
What Is Present Based on the A/Uruguay/716/2007 (H3N2)
A/Uruguay/716/2007 (H3N2)
Sequences of the Organisms
A/Puerto Rico/8/1934(H1N1)
TessArae, LLC, Proprietary Information
22. Avian Influenza Subtypes: Differential Diagnostics
Specimens from USDA ARS SEPRL reference archive (20 Mar 08)
Sample RPM Assay Match SEPRL Reference Strain
1 H1N1 H1N1 A/Turkey/Kansas/4880/80
2 H2N8 H2N8 A/Herring Gull/DE/677/88
3 H3N2 H3N2 A/turkey/MN/366767/2005
4 H4N6 H4N6 A/Blue Winged Teal/LA/240B/88
6 H7N2 H7N2 A/quail/PA/20304/98
7 H8N4 H8N4 A/turkey/CO/169118-13/02
9 H10N7 H10N7 A/quail/NJ/25254-22/95
10 H11N3 H11N3 A/chicken/NJ/4645/96
11 H12N5 H12N5 A/duck/LA/188D/87
12 H13N6 H13N6 A/gull/MD/1824/78
13 AMPV, No AI AMPV, No AI Avian Metapneumovirus (Colorado Strain)
14 H5N3 H5N3 A/duck/Singapore/F119/97
15 H7N3 H7N3 A/chicken/Chile(F0)/176822/02
16 No AI No AI Avian Paramyxovirus I (NDV, RPM-TEI assay)
17 H5N2 H5N2 A/chicken/Mex/26654-1374/94
18 H7N1 H7N1 A/turkey/Italy/4580/99
19 H7N3 H7N3 A/chicken/Pakistan/1369-CR2/95
20 H7N7 H7N7 A/chicken/Victoria/85
21 H14N5 H14N5 A/mallard/Gurjev/263/82
22 H15N9 H15N9 A/Shearwater/W. Australia/2576/79
TessArae, LLC, Proprietary Information
23. Avian Influenza Subtypes: Differential Diagnostics
Reconciliation of Inter-Platform Results Discrepancies by
de novo DNA Sequencing of Viral Genes from Original Specimens
CDC-Certified Ibis-T5000 HA RSLT (P1) TessArray® Gold Standard
Sample ID H5 (Asian) PCR ESI-MS RPM-Flu v3.1 DNA Sequencing
2006900845 H5 H5N1 H5 H5N1 not tested
2006906089 H5 H5N1 H5 H5N1 not tested
2006900590 H5 H5N1 H5 H5N1 not tested
2006902838 H5 H5N1 H5 H5N1 not tested
2006902764 not tested H5N1 H5 H5N1 H5N1
2006905588 Flu UNKNOWN H7 H7N7 H7N7
2004909864 not tested H9N2 UNKNOWN H7N7 H7
2005912823 Flu H7N7 UNKNOWN H10N7 H10N7
2005912908 not tested H7N7 H10 H10N7 H10N7
2004900600 Flu H7N7 H10 H10N7 H10N7
2004900845 H5 H5N1 H10 H10N7 or H10N5 H10N7
2004900688 not tested H7N7 H11 H11N? H11
2005912306 Flu NEW UNKNOWN H13N6 or H13N8 H13
Lin et al PLOS 2009
= Conflict with de novo sequencing results = Results concordant with de novo sequencing
TessArae, LLC, Proprietary Information
24. Longitudinal Data Analysis
CT_Healthy_Control_080508
CT_Sick_Day4_080603 Metapneumovirus
CT_Sick_050509 Rhinovirus
But not the novel A/H1N1!
CT_Sick_042010 Parainfluenza Virus
TessArae, LLC, Proprietary Information
25. MLST-like Epidemiological Analysis:
Genomic diversity of Haemophilus influenzae from
50 Different Patients at MCRD San Diego
TessArae, LLC, Proprietary Information
26. MLST-Like Epidemiological Analysis:
Clonal genomic uniformity of Adenovirus Type 4
in Same 50 Patients at MCRD San Diego
TessArae, LLC, Proprietary Information
27. Summary
Real-time Epidemic/Pandemic Surveillance in Human and Animal
Populations
Simultaneous Detection and Definitive Identification of Multiple Pathogens
Characterization of Difficult Cases
Superior to Benchmark Platform Sensitivity and Specificity
Limits of Detection ~ 102 Genome Equivalents/specimen
Zero False Positive Detection Events
Immediate Identification of Known and Unknown Strains and Variants
Surveillance of Shift and Drift in Populations
Same Day Results
RPM Sequence-based Detector Array
Six Sigma Data Quality
Basecall Error Rate ≥ 10-6
TessArae, LLC, Proprietary Information
28. Acknowledgements
TessArae, LLC - Potomac Falls, VA
Clark Tibbetts Brian Weslowski Leah Morris
Matthew Lorence Lisa Borsuk Klaus Schafer
Naval Health Research Center/Naval Respiratory Disease
Laboratory, San Diego, CA
David Metzgar Chris Myers Christian Hansen
CDR Kevin Russell Jason Brown Larivhie Dela Cruz
CDR Dennis Faix Miguel Osuna David Ortiz
Naval Research Laboratory/Center for Bio/Molecular Science and
Engineering - Washington, DC
Joel Schnur Anthony Malanoski Nina Long
David Stenger Baochuan Lin Carolyn Kidd
Zheng Wang Dzung Thach Kate Blaney
TessArae, LLC, Proprietary Information
