Journal

1. Acta Biomaterialia 10 (2014) 4730–4741
Contents lists available at ScienceDirect
Acta Biomaterialia
journal homepage: www.elsevier.com/locate/actabiomat
Mesenchymal stroma cells trigger early attraction of M1 macrophages
and endothelial cells into fibrin hydrogels, stimulating long bone healing
without long-term engraftment
Elisabeth Seebach, Holger Freischmidt, Jeannine Holschbach 1, Jörg Fellenberg, Wiltrud Richter ⇑
Research Centre for Experimental Orthopaedics, Orthopaedic University Hospital Heidelberg, Schlierbacher Landstrasse 200a, 69118 Heidelberg, Germany
a r t i c l e i n f o
Article history:
Received 22 May 2014
Received in revised form 10 July 2014
Accepted 14 July 2014
Available online 22 July 2014
Keywords:
Bone healing
Mesenchymal stroma cells
Fibrin hydrogel
Host cell recruitment
Macrophage
a b s t r a c t
Implantation of mesenchymal stroma cells (MSCs) is an attractive approach to stimulate closure of large
bone defects but an optimal carrier has yet to be defined. MSCs may display trophic and/or immunomod-ulatory
features or stimulate bone healing by their osteogenic activity. The aim of this study was to unra-vel
whether fibrin hydrogel supports early actions of implanted MSCs, such as host cell recruitment,
immunomodulation and tissue regeneration, in long bone defects. Female rats received cell-free fibrin
or male MSCs embedded in a fibrin carrier into plate-stabilized femoral bone defects. Removed callus
was analyzed for host cell invasion (day 6), local cytokine expression (days 3 and 6) and persistence of
male MSCs (days 3, 6, 14 and 28). Fibrin–MSC composites triggered fast attraction of host cells into
the hydrogel while cell-free fibrin implants were not invaded. A migration front dominated by M1
macrophages and endothelial progenitor cells formed while M2 macrophages remained sparse. Only
MSC-seeded fibrin hydrogel stimulated early tissue maturation and primitive vessel formation at day 6
in line with significantly higher VEGF mRNA levels recorded at day 3. Local TNF-a, IL-1b and IL-10 expres-sion
indicated a balanced immune cell activity independent of MSC implantation. Implanted MSCs
persisted until day 14 but not day 28. Our results demonstrate that fibrin hydrogel is an attractive carrier
for MSC implantation into long bone defects, supporting host cell attraction and pro-angiogenic activity.
By this angiogenesis, implant integration and tissue maturation was stimulated in long bone healing
independent of long-term engraftment of implanted MSCs.
2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
1. Introduction
The closure of large bone defects secondary to trauma or tumor
resection remains a challenge in orthopedic surgery. One promis-ing
approach to support natural bone healing is the implantation
of bone marrow-derived mesenchymal stroma cells (MSCs) in a
suitable carrier [1]. So far, sponge-like scaffolds have mainly been
used for cell implantation although these have disadvantages, such
as limited cell seeding, unequal cell distribution and non-homoge-neous
matrix deposition. Hydrogels are attractive vehicles for cell
transplantation because of their easy adaptation to any shape of
defect, homogeneous cell distribution, even extracellular matrix
deposition and beneficial interaction with the host tissue [2–4].
High biocompatibility, biodegradation and the adhesiveness of
fibrin glue [5] have rendered fibrin hydrogel a common carrier
for autologous cell transplantation in cartilage repair [6,7]. Surpris-ingly,
fibrin has so far attracted little attention as a carrier for MSC-based
treatment of bone defects and little is known as to whether
fibrin hydrogels support early actions of MSCs in stimulating long
bone healing. MSCs can easily be isolated from bone marrow [8],
are characterized by fast proliferation in culture, and express
CD90, CD105 and vascular cell adhesion molecule 1 (VCAM1,
CD106) on their surface in the absence of CD34 and CD45 [9,10].
After expansion culture, MSCs can be induced to differentiate into
chondrogenic, adipogenic and osteogenic lineages in vitro [11].
Moreover, MSCs provide a supportive cellular microenvironment
by secreting a variety of molecules including growth factors and
cytokines which potentially mediate host cell recruitment, angio-genesis
and immune modulation [12,13]. MSCs further possess a
significant osteogenic potential in vivo and have successfully been
used to induce repair of bone defects in animals [14,15] and in
humans [16,17].
⇑ Corresponding author. Tel.: +49 (0) 6221 5629254; fax: +49 (0) 6221 5629288.
E-mail address: wiltrud.richter@med.uni-heidelberg.de (W. Richter).
1 Current address: Merck KGaA, Frankfurter Strasse 250, 64293 Darmstadt,
Germany.
http://dx.doi.org/10.1016/j.actbio.2014.07.017
1742-7061/ 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

2. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4731
According to the concept of stem cell-based bone regeneration,
implanted MSCs contribute physically to the repair tissue by gen-erating
new bone tissue, as has been reported in ectopic implanta-tion
models in immune-deficient mice in which fibrin hydrogel
formed part of the carrier [18,19]. The role and fate of MSCs
implanted into a bone defect is, however, unclear and long-term
persistence, especially in immune competent animals, has been
discussed [20–22]. Fast attraction of a large number of diverse host
cells to the defect site, acceleration of new vessel formation and
modulation of the early inflammatory reaction may be important
trophic roles of MSCs in stimulation of bone healing which should
be supported by the carrier used for implantation. In an orthotopic
setting, these mechanisms are potentially more important for
improved bone regeneration than enhancing the number of local
bone-forming cells by implantation of additional osteogenic pro-genitors.
Whether fibrin hydrogel is an attractive carrier for MSC
implantation in this respect remains to be determined.
A highly potent MSC population has to be produced in a stan-dardized
fashion from each donor to allow optimal healing results
in the patient. In view of the changing paradigm of MSC function
[23], the therapeutically most potent MSC subpopulations may,
however, be characterized by pronounced trophic and/or immuno-modulatory
features displayed in the early callus instead of a high
osteogenic differentiation capacity. Thus, it is essential to better
understand relevant actions of MSC composites in a bone defect
in order to optimize MSC-based bone tissue engineering
approaches and to design an optimal application strategy for clin-ical
regeneration of large bone defects.
The aim of this study was to assess whether fibrin hydrogel is
an attractive carrier for MSC implantation supporting early bone
regeneration with regard to host cell attraction, angiogenesis,
immunomodulation and physical contribution of implanted MSCs
to newly formed bone tissue. In order to follow up implanted MSCs
without extra manipulation by a labelling reaction, our approach
was to implant sex-mismatched MSCs in a fibrin hydrogel into a
long bone defect in rats. Callus was removed from female recipi-ents
at distinct time points after surgery and analyzed for host cell
recruitment, the presence of inflammatory cytokines and the per-sistence
of male MSCs to pinpoint the dominant actions of
fibrin–MSC composites in early bone regeneration.
2. Materials and methods
2.1. Animals and study design
Sprague–Dawley rats (n = 46; 17–23 weeks of age, Charles
River, Sulzfeld, Germany) were included in the animal study. The
hind limbs in the growing rat are skeletally mature at around
15 weeks of age [24]. The experimental protocol was approved
by the local animal experimental ethics committee and all proce-dures
were performed according to the European Laboratory Ani-mal
Science Guidelines. Male rats were used for MSC donation
and female rats served as MSC recipients. A total of 43 animals
received a non-critical 2 mm bone defect in the right femur. Two
experimental groups were defined. Rats of group 1 received an
empty fibrin clot and served as controls (n = 20), while rats of
group 2 were treated with 1 106 MSCs in a fibrin clot (n = 23).
Animals were killed 3, 6, 14 or 28 days after surgery. Histological
evaluation of callus was performed at day 6 (five animals per
group). Gene expression analysis and detection of the sex-deter-mining
region of Y-Gen (SRY)-specific DNA were assessed in the
same sample at days 3 and 6 from the callus of five animals per
condition. Visualization of new bone formation by micro-com-puted
tomography (lCT) and SRY-DNA detection was done on
the same animals with n = 3 animals for the cell-free and n = 4
animals for the MSC-treated group at day 14, and with n = 2
animals for the cell-free and n = 4 animals for the MSC-treated
group at day 28.
2.2. MSC isolation and expansion
MSCs were isolated from bone marrow of three male rats using a
modified centrifugation method [25]. Animals were killed by
asphyxiation with CO2 and MSCs were extracted from tibiae and
femora by centrifugation at 750g for 2 min. All cells were pooled,
washed with phosphate-buffered saline (PBS) and seeded into
0.1% gelatin-coated flasks in a high-glucose Dulbecco’s modified
Eagle’s medium (DMEM) containing 12.5% fetal calf serum (FCS),
2mM L-glutamine, 1% non-essential amino acids, 0.1% 2-mercap-toethanol
(Invitrogen, Karlsruhe, Germany), 100 U ml–1 penicillin,
100 lgml–1 streptomycin (Biochrom, Berlin, Germany) and
4 ngml–1 recombinant human fibroblast growth factor-2 (Active
Bioscience, Hamburg, Germany) at a density of 1.25 105
cells cm–2. After 5 days under standard culturing conditions (37 C
and 6% CO2) non-adherent cells were removed by washing. Medium
was changed every 2 days and cells were split at 80% confluency and
replated at a density of 4–6 103 cells cm–2. All cells were frozen
in passage 1 in liquid nitrogen and recultivated at a density of
6 103 cells cm–2 3 days before implantation.
2.3. Flow cytometry
At the time of implantation cells were harvested with trypsin
and 1 105 cells were labelled with anti-CD45 (1:250), anti-
CD68 (1:100), anti-CD90-FITC (1:25; Abcam, Cambridge, UK) and
anti-CD106-PE (1:50; BD, Heidelberg, Germany) antibodies,
respectively. For CD45 and CD68 staining cells were incubated
with a secondary anti-mouse FITC-conjugated antibody (1:100;
Jackson ImmunoResearch Laboratories, Suffolk, UK). Surface mar-ker
positive cells were quantified in a FACSCalibur (BD, Heidelberg,
Germany).
2.4. Osteogenic, adipogenic and chondrogenic in vitro differentiation
For osteogenesis, quadruplicates of 3.5 104 MSCs were seeded
per well of a 24-well plate in osteogenic medium consisting
of high-glucose DMEM supplemented with 10% FCS, 0.1 lM
dexamethasone, 0.17 mM ascorbic acid 2-phosphate, 10 mM
b-glycero-phosphate (Sigma-Aldrich, Taufkirchen, Germany),
100 U ml–1 penicillin and 100 lgml–1 streptomycin. At days 1, 7
and 14 the alkaline phosphatase (ALP) enzyme activity of cell
lysate was measured as described previously [18]. For adipogenic
differentiation cells were seeded in duplicates at 3.5 104 cells
per well of a 24-well plate in high-glucose DMEM supplemented
with 10% FCS, 0.01 lM dexamethasone, 5 lgml–1 insulin (Sanofi-
Aventis, Frankfurt, Germany), 100 U ml–1 penicillin and
100 lgml–1 streptomycin [26]. Formation of lipid droplets was
evaluated by Oil Red O staining (Chroma, Münster, Germany) after
fixing the cells in 4% paraformaldehyde (PFA, Merck, Darmstadt,
Germany). Chondrogenesis was performed with 5 105 cells in a
3D pellet-culture in high-glucose DMEM supplemented with
5 lgml–1 transferrin, 5 ng ml–1 sodium selenite, 0.1 lMdexameth-asone,
0.17 mM ascorbic acid 2-phosphate, 1 mM sodium pyru-vate,
0.35 mM proline, 1.25 mg ml–1 BSA (Sigma-Aldrich,
Taufkirchen, Germany), 100 U ml–1 penicillin, 100 lg ml–1 strepto-mycin,
5 lgml–1 insulin and 10 ng ml–1 transforming growth fac-tor-
beta 3 (TGFb-3; Miltenyi Biotec GmbH, Bergisch Gladbach,
Germany). Differentiation was evaluated on day 14 by Safranin O
staining (Chroma, Münster, Germany) for proteoglycan deposition
and collagen type II immunohistochemistry as described previ-ously
[27].

3. 4732 E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741
2.5. Preparation of fibrin-MSC composites for implantation
MSCs were prepared separately for every animal, to limit the
time period between preparing the fibrinogen cell suspension
and implantation to 20 min. The fibrinogen solution (Baxter,
Wien, Austria) was diluted 1:2 and the thrombin (Baxter, Wien,
Austria) was diluted 1:50 in PBS containing protease inhibitor
cocktail (cOmplete Mini: Roche, Mannheim, Germany). 1 106
MSCs were resuspended in 40 ll of the fibrinogen solution, kept
at room temperature until 40 ll of the thrombin solution was
added. The solidifying gel was transferred into the bone defect.
Fibrin clots for the control animals were prepared without cells.
Five additional fibrin–MSC clots were frozen at 80 C and used
for gene expression analysis of MSCs before implantation. Three
additional fibrin(–MSC) clots were used for histological examina-tion
of non-implanted samples.
2.6. Implantation of fibrin–MSC composites in the bone defect
Rats were anaesthetized by intraperitoneal injection of
ketamine hydrochloride (Ketamin: 100 mg kg–1 body weight,
Orion Pharma, Hamburg, Germany) and medetomidine hydrochlo-ride
(Domitor: 0.2 mg kg–1 body weight, Orion Pharma, Hamburg,
Germany). A longitudinal incision (30 mm) of skin and fascia of
the right hind leg was performed. The vastus lateralis and biceps
femoris muscles were carefully separated and the anterolateral
side of the femoral shaft was exposed. The attached muscles were
stripped from the bone and a polyether ether ketone (PEEK) plate
(Rat Fix, AO, Davos, Switzerland) was adjusted to the femur. The
PEEK plate was held in position and pilot holes were drilled
through both cortices along the predrilled holes of the plate. The
plate was fixed to the bone by three screws (Rat Fix, AO, Davos,
Switzerland) at each side. A 2 mm bone defect was created with
a sawing wire (Rat Fix, AO, Davos, Switzerland). Bleeding was pre-vented
by pressing a gelatin sponge (Gelita-Spon: Gelita Medical,
Amsterdam, the Netherlands) into the bone defect for 2 min. The
polymerizing fibrin clot was quickly transferred into the bone
gap via a pipette and allowed to solidify for 3 min. Muscles, deep
fascia, subcutaneous fascia and skin were closed in a standard fash-ion.
Animals were treated once with 0.02 ml gentamicin sulfate
(Refobacin: 80 mg, Merck, Darmstadt, Germany) for antibiosis
and buprenorphine hydrochloride (Temgesic: 0.01 mg kg–1 body
weight, RB Pharmaceuticals, UK) was given subcutaneously for
analgesia. The animals were allowed full activity in their cages
and were medicated with buprenorphine hydrochloride (Temge-sic:
0.01 mg kg–1 body weight) for the first two postoperative days.
At days 3, 6, 14 or 28 after surgery animals were narcotized with
CO2 and killed by exsanguination via heart puncture. Femora were
dissected by opening the sutures and careful stripping off of the
surrounding tissue. Callus was carefully isolated from bone defect
and either directly frozen at 80 C for MSC detection and gene
expression analysis or fixed in 4% PFA for histology.
2.7. lCT
New bone formation of day 14 and 28 samples was evaluated
using a Sky-Scan 1076 in vivo X-ray microtomograph (Skyscan,
Antwerpen, Belgium). Femora were scanned with surrounding
muscles wrapped in plastic foil using the 0.025 mm titan filter,
with the following settings: voxel size 17.7 lm, voltage 65 kV, cur-rent
139 lA, exposure time 280 ms, frame averaging 3. Data were
recorded every 0.4 rotation step through 180. Reconstruction was
performed using NRecon software (version 1.6.3.2, Skyscan,
Antwerp, Belgium). 3-D pictures were made with CTan/CTVol
software (Skyscan, Antwerp, Belgium).
2.8. DNA isolation and SRY-gene-specific PCR
Genomic DNA from day 3 and 6 callus was extracted along with
total RNA according to the manufacturer’s protocol using the peq-
GOLD TriFast technique (peqlab, Erlangen, Germany). Day 14 or 28
callus was digested in lysis buffer with 100 ng ml–1 proteinase K
(Fermentas, St Leon-Rot, Germany) at 56 C overnight and DNA
was extracted by ethanol precipitation. A SRY-gene-specific DNA
fragment was amplified in a standard PCR using Taq DNA Polymer-ase
(Invitrogen, Karlsruhe, Germany). For detection of implanted
male MSCs in defined regions, day 6 callus was separated by laser
microdissection, and DNA was isolated using the QIAmp DNA
Micro Kit (Qiagen GmbH, Hilden, Germany) according to the man-ufacturer’s
protocol. DNA analogously isolated from equivalent
sections of the control samples was used as negative control.
SRY-gene-specific DNA was amplified by nested PCR. PCR products
were visualized on a 2% agarose gel and their specificity was con-firmed
by DNA sequencing.
2.9. Gene expression analysis
Callus was homogenized in peqGOLD TriFast and total RNA
was extracted according to the manufacturer’s protocol (peqlab,
Erlangen, Germany). cDNA synthesis was performed with 1 lg
total RNA using Omniscript reverse transcriptase (0.2 U ll–1), oli-go(
dT) primer (1 lM, both Qiagen GmbH, Hilden, Germany) and
a ribonuclease inhibitor (RNaseOUT: 40 U ll–1, Invitrogen, Kar-lsruhe,
Germany) according to the manufacturer’s instructions.
Expression levels of individual genes were analyzed by quantita-tive
PCR (Stratagene Mx3000P; Agilent Technologies, Böblingen,
Germany). cDNA were amplified using gene-specific primer sets
(Table 1) obtained from Eurofins (Ebersberg, Germany) and real-time
fluorimetric intensity of SYBR green I (Thermo Scientific,
Rockford, USA) was monitored. The apparent threshold cycles
(Ct) of the genes of interest were compared to the Ct of the refer-ence
gene hypoxanthine-guanine phosphoribosyltransferase-1
(HPRT-1) in the same cDNA sample. When indicated, the percent-age
of the reference gene expression levels shown in the figures
refer to relative levels as a percentage of HPRT-1. Melting curves
and agarose gel electrophoresis of the PCR products were used
for quality control.
2.10. Histology
Callus was isolated from the bone defect and subjected to his-tology
without proximal and distal bone ends to allow preparation
of the samples without decalcification. In brief, samples were fixed
in 4% PFA, dehydrated in a graded alcohol series and embedded in
paraffin. In vivo orientation of the callus was maintained through-out
the embedding process and callus was cut along this axis. For
histological investigations, sections (5 lm) from the callus center
were used and stained with haematoxylin and eosin (HE:
Chroma, Münster, Germany) or Movat’s Pentachrome (all colours:
Chroma, Münster, Germany) in a standard procedure.
For CD31 and CD68 immunohistochemistry, digestion with
20 ng ml–1 proteinase K (Fermentas, St Leon-Rot, Germany) for
20 min at 37 C was used for antigen retrieval. Sections for
CD163 staining were pre-treated with 1 mg ml–1 pronase (Roche,
Mannheim, Germany) for 30 min at 37 C. No antigen retrieval
was required for CCR7 staining. Unspecific binding was blocked
for 30 min with 5% BSA for CD31, CD68 and CD163, and with 5%
human serum for CCR7, and then sections were incubated with
the primary antibodies CD31 (1:200; Abbiotec, San Diego, CA,
USA), CD68 (1:100; Abcam, Cambridge, UK), CD163 (1:100, AbD
Serotec, Oxford, UK) and CCR7 (1:250; Epitomics, Burlingame, CA,
USA) overnight at 4 C. After washing sections were incubated with

4. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4733
the respective biotinylated secondary antibodies (CD31 and CCR7:
anti-rabbit IgG; CD68 and CD163: anti-mouse IgG; 1:500; both
Dianova, Hamburg, Germany), followed by ALP–streptavidin (Vec-tastain;
Vector Laboratories, Burlingame, CA, USA) and Fast Red
(Roche, Mannheim, Germany). The nuclei were counterstained
with haematoxylin (Chroma) and slides were covered in Aquatex
(Merck, Darmstadt, Germany). Negative controls were performed
by omitting the respective primary antibody. Histomorphometric
evaluation was performed on HE-stained sections of two zones
of every callus respectively (n = 10 per group). Total callus area
was marked black and the area infiltrated by host cells was labelled
grey using Photoshop 7.0 (Adobe Systems Inc., USA). ImageJ 1.44p
(Wayne Rasband, National Institutes of Health, USA) was used to
assess the total area and the infiltrated area. Cell invasion is stated
as the percentage of infiltrated area related to total area.
2.11. Laser microdissection
To evaluate persistence of implanted MSCs next to invading
host cells we searched for possible SRY-signals in the infiltrated
area of the callus vs. the non-infiltrated part of the MSC implant.
Appropriate parts of the tissue section were separated by laser
microdissection. In brief, sections (10 lm) of the MSC-containing
callus were taken up on manually foil-coated slides. After HE
staining, the area infiltrated by host cells was separated from the
remaining implant using a PALM MicroBeam Laser Microdissection
System (Carl Zeiss AG, Jena, Germany). To obtain enough material
for nested PCR, tissue collected from the infiltrated area (two sec-tions
per sample from five animals, n = 10) or of the remaining
fibrin clot were pooled, respectively (n = 10) and subjected to
DNA extraction. Analogously, tissue collected from the animals
receiving cell-free fibrin (n = 10) were pooled and further used as
female control.
2.12. Statistical analysis
For comparison of gene expression between the MSC groups
and control groups of days 3 and 6 a Kruskal–Wallis test with
post-hoc Mann–Whitney U-tests was conducted. Only if the Krus-kal–
Wallis tests indicated significance were data analyzed post hoc
and corrected with the Bonferroni test. The Mann–Whitney U-test
was furthermore applied for histomorphometric evaluation of the
MSC group and the control group at day 6 and for comparison of
genomic DNA content between the MSC group and the control
group at day 14. A two-tailed significance value of P 0.05 was
considered statistically significant. Data analysis was performed
with SPSS for Windows 16.0 (SPSS Inc., Chicago, IL, USA).
3. Results
3.1. Enhanced attraction of host cells into fibrin–MSC composites
One pool of MSCs from long bones of three male rats was pro-duced
and extensively characterized before application in all
experiments. Cells were strongly positive for the rat surface mark-ers
CD90 (97%) and CD106 (35%) while almost negative for CD45
(1.8%) and CD68 (1.7%) as expected for MSC populations
(Fig. 1A). During in vitro osteogenesis, cells showed a strong up-regulation
of the osteogenic markers bone sialoprotein (BSP) and
osteocalcin (OC) and an increasing ALP enzyme activity (Fig. 1B).
During adipogenic induction cells up-regulated mRNA levels of
the adipogenic marker peroxisome proliferator-activated recep-tor-
gamma (PPAR-c and deposited lipid droplets as visualized by
Oil Red O staining (Fig. 1C). Chondrogenic differentiation in high-density
pellets resulted in deposition of a proteoglycan- and colla-gen
type II-rich extracellular matrix (Fig. 1D).
MSCs were seeded in fibrin hydrogel allowing a standardized
implantation of a defined concentration of cells into the 2 mm
plate-stabilized femur defect of female rats. The hydrogel was
directly transferred after starting the polymerization and solidified
within the defect, enabling a complete filling of the bone gap by
the implant with intimate contact to the open bone endings
(Fig. 2A). Six days after implantation cell-seeded and non-seeded
fibrin implants were still present in the bone defect (Fig. 2B). The
in vivo orientation was maintained for histology (Fig. 2C). As
shown in Fig. 3, staining of parallel non-implanted fibrin–MSC
composites showed a homogeneous distribution of the seeded cells
within the fibrin hydrogel (Fig. 3H inset). Six days post-implanta-tion,
overview staining of control samples revealed little infiltra-tion
of host cells into the MSC-free implant but indicated some
dissolution of the fibrin from the proximal side of the bone defect
in two out of five samples (Fig. 3A). This appeared to create space
for accumulation of some densely packed host cells in a callus
aside from the fibrin (Fig. 3B), while the fibrin matrix itself
remained almost empty (Fig. 3C, D). In contrast, large numbers of
host cells infiltrated the implant in the MSC group, especially from
the proximal bone ending (Fig. 3E). Interestingly, in three out of
five samples, a dense migration front was formed consisting of
packed cells which apparently moved through the defect from
the proximal to the distal side (Fig. 3F, G). The majority of MSCs
located in front of this border looked viable (Fig. 3H). Behind the
migration front, the first signs of tissue maturation and extracellu-lar
matrix deposition were observed (Fig. 3F) with evidence of
some proteoglycan deposition in the three most advanced
samples according to pentachrome staining (Fig. 3I). A comparable
Table 1
List of oligonucleotides used for qRT-PCR analysis and SRY-gene-specific PCR.
Gene GenBank no. Forward primer Reverse primer
BSP [NM_012587.2] ACGCTGGAAAGTTGGAGTTAG GACCTGCTCATTTTCATCCA
CD45 [NM_001109890.1] GCATGCATCAATCCTAGTCC GGCCATGATGTCATAGAGGA
HPRT-1 [NM_012583.2] GCCAGACTTTGTTGGATTTG CACTTTCGCTGATGACACAA
IL-1b [NM_031512.2] GACAAGCAACGACAAAATCC ACCGCTTTTCCATCTTCTTC
IL-2 [NM_053836.1] AGCGTGTGTTGGATTTGACT TCTCCTCAGAAATTCCACCA
IL-6 [NM_012589.2] AGCCAGAGTCATTCAGAGCA AGTTGGATGGTCTTGGTCCT
IL-10 [NM_012854.2] GACGCTGTCATCGATTTCTC TTCATGGCCTTGTAGACACC
MIP-2 [NM_053647.1] TGAAGTTTGTCTCAACCCTGA GGTGCAGTTCGTTTCTTTTCT
OC [NM_013414.1] AGGGCAGTAAGGTGGTGAAT CTAAACGGTGGTGCCATAGA
PPAR-c [NM_013124.3] ATAAAGTCCTTCCCGCTGAC ATCTCTTGCACAGCTTCCAC
SRY [X89730.1] CTTTCGGAGCAGTGACAGTT CACTGATATCCCAGCTGCTT
SRY nested [X89730.1] CTTTCGGAGCAGTGACAGTT CATGCTGGGATTCTGTTGA
TNF-a [NM_012675.3] TCTACTGAACTTCGGGGTGA CCACCAGTTGGTTGTCTTTG
VEGFa [NM_031836.3] CAATGATGAAGCCCTGGA CTATGCTGCAGGAAGCTCAT

5. 4734 E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741
Fig. 1. Characterization of rat MSCs. (A) Male rat MSCs pooled from three donors were expanded for two passages, labelled with the indicated antibodies and analyzed by
flow cytometry. Representative histograms are shown with the stained population in black and the respective controls (no primary antibody) as grey lines. (B–D) MSCs were
subjected to osteogenic (B), adipogenic (C) or chondrogenic conditions (D) for 2 weeks. (B) For osteogenesis, expression of bone sialoprotein (BSP) and osteocalcin (OC) was
quantified by RT-qPCR and ALP-enzyme activity was measured (n = 2 experiments). Results are expressed as mean ± standard deviation. (C) Adipogenesis was confirmed by
gene expression of peroxisome proliferator-activated receptor-gamma (PPAR-c) and Oil Red O staining of formed lipid droplets. (D) MSCs underwent chondrogenic
differentiation according to deposition of proteoglycans (Safranin O staining, left side) and collagen type II (immunohistochemistry, right side). Staining is representative for
three replicates. Scale bar: 100 lm.
Fig. 2. Implantation of fibrin–MSC composites into long bone defects in rats and processing of callus for histology. A plate-stabilized 2 mm bone defect was created in the
right femur of 42 female rats. Either 1 106 male MSCs embedded in a fibrin gel or empty fibrin gel (80 ll) were implanted into the defect. After 3, 6, 14 or 28 days femora
were removed and early callus was lifted out from the defect for further analysis. (A) View directly after implantation of the fibrin gel with MSCs. (B) Early callus formation
6 days after MSC implantation. (C) For histology, day 6 callus was separated by a scalpel from the bone endings and lifted out of the bone defect. In vivo orientation was
recorded throughout the embedding process and during histological evaluation.

6. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4735
Fig. 3. Histological and histomorphometric evaluation of day 6 callus. (A–H) Paraffin sections of formalin-fixed tissue were stained with HE by a standard procedure. (A, E)
Overview pictures of the callus at day 6 with the proximal explant side in the upper left and distal explant side in the lower right corner. Scale bar: 500 lm. Enlarged areas as
defined in (A) and (E) are shown in (B)–(D) and (F)–(H). (B) Host-derived callus; (C) contact zone between host tissue and implant; (D) empty fibrin clot. Inset: HE-stained
empty fibrin clot before implantation. (F) Highly infiltrated area from (E); (G) the migration front; (H) remaining MSC-seeded fibrin clot. Inset: HE stained MSC-seeded fibrin
clot before implantation. Representative pictures of five replicates are shown in (A)–(H). Scale bar: 100 lm. (I) Movat’s Pentachrome staining: the infiltrated area of the three
most mature samples of the MSC group showed deposition of glycosaminoglycan (light blue staining) next to fibrous tissue (red staining). Scale bar: 200 lm. (J) For
histomorphometric evaluation, callus was divided into infiltrated area (dark grey) and unaffected implant (light grey). (K) Histomorphometric evaluation of the area
infiltrated by host cells in relation to the total callus area (%, n = 10 sections per group, two per each of the five animals). Boxes represent the 25th and 75th percentile, median
is given as horizontal line and whiskers are maximal and minimal values. Significant difference (P 0.01) between with and without MSCs is designated by two asterisks.
maturation tissue was not seen in the fibrin control group.
Histomorphometric assessment of the host cell-infiltrated vs. non-infiltrated
areas (Fig. 3J) revealed a significantly larger invaded
area in the fibrin–MSC composites compared to control samples
(P = 0.01; Fig. 3K).
3.2. M1 macrophages and endothelial progenitor cells as main
invaders
Immunohistochemical staining revealed that the fibrin–MSC
composites were mainly infiltrated by CD68- and CD31-positive
cells indicative of macrophages and endothelial cells (Fig. 4).
CD68-positive macrophages were present throughout the infil-trated
area and were enriched in the migration front (Fig. 4B).
Among ‘‘pioneer cells’’ migrating ahead of the more crowded zone
and penetrating deep into the fibrin clot, many cells stained CD68
positive (Fig. 4B, lower right corner). In several areas, elongated
CD31-positive cells apparently migrated from the proximal to the
distal part of the implant forming primitive structures consistent
with the formation of immature microvessels (Fig. 4D, black
arrows).
Macrophages can occur in a predominantly pro-inflammatory
subtype M1 characterized by CCR7 expression and a predomi-nantly
anti-inflammatory subtype M2 characterized by CD163
expression [28,29]. Staining for M1 and M2 macrophage markers
at day 6 revealed that CCR7 signals were dominant in cell-dense
areas. CCR7-positive cells also surrounded elongating structures,
presumably areas of primitive vessel formation and tissue matura-tion
(Fig. 4F, black arrows). In contrast, rather few CD163-positive
cells were present in the host cell infiltrated area. Only in the sam-ple
with the most advanced tissue regeneration had CD163-
positive cells accumulated, especially in the cell-dense migration
front (Fig. 4H). In the control group, the host tissue-derived callus
contained CD31-, CD68- and/or CCR7-positive cells but hardly any
cells were present in the fibrin hydrogel (Fig. 4A, C, E). CD163-
positive (M2) cells, however, were not observed (Fig. 4G).
3.3. Cytokine expression in the early callus
In order to analyze the trophic and immune modulatory effects
of MSCs in the early callus, implants were harvested 3 and 6 days
after surgery, respectively, to assess mRNA levels by quantitative
PCR for a panel of pro- and anti-inflammatory mediators (Fig. 5).
At the time of implantation, MSCs expressed vascular endothelial
growth factor (VEGF), interleukin-6 (IL-6) and macrophage inflam-matory
protein-2 (MIP-2, Fig. 5A). In vivo, median VEGF expression
per cell increased from day 0 to day 3, reaching significantly higher
levels in the MSC group vs. controls at day 3 (3.7-fold; P = 0.009)
suggesting an enriched pro-angiogenic environment (Fig. 5D).
IL-6 and MIP-2 were also expressed in vivo (Fig. 5E, F). Negligible

7. 4736 E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741
Fig. 4. Characterization of infiltrated host cells present in the callus 6 days after MSC implantation. (A, B) Macrophages were typed by immunohistochemistry for pan-marker
CD68. (C, D) CD31 staining was performed to detect endothelial progenitor cells as indicators for neo-vascularization (black arrows: primitive vessel formation). (E, F) M1-
typing of the infiltrated macrophages by CCR7 staining (black arrows: positive cells surrounding maturating tissue). (G, H) M2-typing of the infiltrated macrophages by
CD163 staining. Positive cells are expressed with Fast Red and nuclei are counterstained with haematoxylin. Staining under omission of primary antibody served as negative
controls (insets). Pictures are representative for five replicates. Scale bar: 100 lm.
CD45 signals characterizing leukocytes were recorded in the
fibrin–MSC composite before implantation (Fig. 5A). Day 3 and
day 6 in vivo samples of both groups contained CD45 signals, con-firming
the presence of leukocytes in the explants (Fig. 5B). As can
be predicted from our histological findings, the relative signal for
CD45 gene expression per cell (input RNA related to reference gene
level) was significantly higher in the fibrin-only group compared to
the MSC group (P = 0.016), which is in line with the notion that
most host cells seen next to the implant in the control group were
immune cells. In the MSC group, less CD45 expression per cell was
observed since a large fraction of the mRNA was derived from the
implanted (CD45-negative) MSCs. In line with the higher expres-sion
levels of CD45, significantly higher mRNA levels for IL-1b
tumor necrosis factor-alpha (TNF-a) and IL-10 (Fig. 5G–I) were
obvious per cell in day 3 explants without MSCs vs. the group with
MSCs, and a similar trend was seen for IL-2 (Fig. 5C) as well as for
day 6 samples.
In order to determine alterations in cytokine expression levels
per immune cell in each sample, IL-1b, TNF-a and IL-10 expression
levels were referred to the corresponding CD45 signal of the same
sample. After adjustment per immune cell (Fig. 5J–L) no variation
in the pro-inflammatory cytokines IL-1b (Fig. 5J) and TNF-a
(Fig. 5K) or the anti-inflammatory cytokine IL-10 (Fig. 5L) was evi-dent
between the controls and the MSC group at day 3 and day 6,
indicating no major shift of the immune response by implanted
MSCs.
3.4. No long-term engraftment of fibrin-implanted MSCs
At day 14, healing of the bone defect in the MSC group was
more advanced at the proximal bone ending compared to the distal
side (Fig. 6A). The amount of genomic DNA in the callus increased
considerably until day 28 in line with an increasing cell content
(Fig. 6B). The presence of significantly more DNA in the MSC group

8. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4737
Fig. 5. Characterization of expression of specific immunomediators in day 3 and day 6 callus. RNA was isolated from (A) fibrin–MSC composites before implantation and (B–
M) early callus with and without MSCs at day 3 and day 6. Relative mRNA levels were detected by RT-qPCR and expression was standardized to the signals of the reference
gene HPRT-1. (A) Basal gene expression of rat CD45, VEGF, IL-6 and MIP-2 by the MSC-population (day 0) with n = 5 replicates. (B–I) Relative mRNA levels per cell of rat CD45,
IL-2, VEGF, IL-6, MIP-2, IL-1b, TNF-a and IL-10 in the MSC-seeded fibrin clots before implantation (day 0) and 3 or 6 days after implantation (n = 5 per time-point and group).
(J–L) Relative expression of IL-1b, TNF-a and IL-10 per CD45-positive immune cell. Boxes represent the 25th and 75th percentile, median is given as horizontal line and
whiskers are maximal and minimal values. Outliers (1.5- to 3-fold interquartile range, IQR) are depicted as circles, and extreme values (3-fold IQR) as diamonds. Significant
differences (P 0.05) between groups are designated by an asterisk.
at day 14 is in line with an enhanced host cell attraction into MSC-containing
fibrin implants and/or may indicate more cell prolifera-tion
in the MSC-treated defects. This difference was no longer seen
at day 28 (Fig. 6B). When DNA from day 3, 6, 14 or 28 callus was
analyzed for the persistence of implanted male MSCs, SRY-gene
specific signals were detected in all MSC-containing explants from
postoperative days 3, 6 and 14, whereas no signals were detected
in the controls (Fig. 6C, D). Remarkably, at day 28, all explants were
SRY-negative (Fig. 6E). Furthermore, no signals were obtained from
the distal and proximal 2 mm bone endings (day 28), indicating no
migration of male MSCs into the bone. Even an attempt to detect
signals by a nested PCR approach with greatly enhanced sensitivity
yielded no residual signals, suggesting a loss of male cells from the
regeneration tissue and newly forming bone.
In order to decide whether the implanted MSCs had already
been eliminated during host cell infiltration of the fibrin–MSC
composite or whether they persisted beside invaders, histological
sections from day 6 were processed by laser microdissection to
assess non-infiltrated and infiltrated areas separately. Genomic
DNA from both areas revealed a clear SRY-gene signal after nested

9. 4738 E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741
Fig. 6. Bone regeneration at day 14 and day 28 after surgery and persistence of implanted MSCs at the defect site. (A) 3-D reconstruction of the bone defect 14 days after
surgery based on lCT scanning. Sides of the defect gap were rotated apart to give an open view into the proximal (left) and distal (right) bone endings. Newly formed bone
tissue is depicted by colour. (B) Total callus was digested for DNA extraction and absolute content of genomic DNA was determined spectrophotometrically (control group:
day 14: n = 3 and day 28: n = 2; MSC-treated group: day 14 and day 28: n = 4). Boxes represent the 25th and 75th percentile, median is given as horizontal line and whiskers
are maximal and minimal values. Significant difference (P 0.05) between with MSCs and fibrin alone at day 14 is designated by an asterisk. (C–E) Detection of implanted
male MSCs by SRY-gene-specific PCR at indicated time points: () animals of control group and (+) animals receiving MSCs. Arrows indicate the SRY-gene-specific fragment
with a length of 159 bp. (F) Evaluation of implanted male MSCs persisting besides invading host cells: histological sections of the MSC-callus were subjected to laser
microdissection to separate areas infiltrated by host cells and non-infiltrated areas. Dissected samples of similar areas were pooled, DNA was extracted and SRY-gene-specific
nested PCR was performed. P, positive control (male MSCs); N, control (water); 0, laser microdissection cDNA control; 1, remaining fibrin clot; 2, area infiltrated by host cells;
3, female control callus.
PCR (Fig. 6F), while control samples from sections of cell-free
explants were negative. This indicated that the MSCs implanted
in fibrin hydrogel were not immediately disappearing behind the
invasion front after host cell infiltration.
4. Discussion
Recent investigations in tissue regeneration have focused on the
activation of endogenous mechanisms at the defect site by trophic
and immunomodulatory activity of implanted MSCs [12,13]. Our
study for the first time investigates prevailing early cellular and
molecular actions of fibrin–MSC composites implanted into a long
bone defect to stimulate long bone healing. Our results highlight a
strong early impact of implanted MSCs on host M1 macrophage
and endothelial progenitor cell recruitment into the fibrin carrier
which may be due to the presence of higher pro-angiogenic VEGF
levels in MSC implants vs. controls. However, other chemokines,
such as IL-6 and MIP-2 and other molecules of the MSC secretome
[30,31], may contribute to this effect. Furthermore, activation of
the MSCs by the fibrin hydrogel itself should be considered [32].
Since local expression of pro-inflammatory cytokines IL-1b and
TNF-a and of anti-inflammatory IL-10 per immune cell was unal-tered
in the MSC group vs. control callus at day 3 and day 6, MSCs
here displayed no evident early immunomodulatory activity in
fully immune competent animals. Accelerated early tissue matura-tion
in the MSC group occurred despite a loss of implanted male
MSCs before day 28 in our model. Overall, the fibrin carrier proved
attractive for MSC implantation into bone defects permitting
generation of a trophic and pro-angiogenic microenvironment by
which MSCs stimulated implant integration and endogenous repair
mechanisms without evident early immunomodulation or long-term
osteogenic contribution to the repair tissue.
4.1. MSCs as a trigger for cell invasion into fibrin hydrogel
Cellular and molecular mechanisms of natural bone remodel-ling
revealed a crucial role for resident tissue macrophages for full
functional differentiation of osteoblasts and their maintenance
in vivo [33]. In wound healing, one important early wave of
cell migration towards a site of tissue injury is conducted by

10. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4739
macrophages around 2–6 days after injury [34]. Macrophage-secreted
cytokines affect endothelial cell proliferation, angiogene-sis
and collagen synthesis [34], suggesting that they may act in
concert with other resident cells to stimulate vascularization. Our
model took advantage of an empty and a MSC-seeded fibrin
hydrogel clot, allowing us to distinguish early arriving and possibly
faster migrating cells penetrating deep into the implant, from later
arriving and/or later migrating cells that are still closer to the
implant edges on day 6. We consistently observed earlier host cell
infiltration from the proximal defect side which is possibly caused
by a relative shortage of blood-borne invading host cells at the dis-tal
defect ending after disruption of blood flow by defect creation.
Remarkably, host cell infiltration was only initiated in fibrin–MSC
composites while host cells apparently showed little interest in
invading a cell-free fibrin hydrogel in a bone defect. This demon-strated
that signals from viable MSCs represented an important
trigger for implant integration and remodelling, emphasizing the
importance of—most likely—soluble factors as trophic mediators
of MSC action. Most importantly, although the local number of
osteoprogenitor cells in the bone cavity is high and may suffice
to initiate bone healing, defect filling with empty fibrin hydrogel
alone cannot be recommended due to its rather inert persistence
without evident cell invasion.
A large panel of trophic factors is secreted by MSCs [30,31] of
which IL-6, VEGF and the neutrophil-attracting factor MIP-2 were
here shown to be expressed by the fibrin-embedded MSCs before
implantation. This first demonstration of significantly higher VEGF
mRNA levels in vivo and differential expression patterns between
fibrin–MSC composites and cell-free controls suggest VEGF as an
important candidate molecule for endothelial cell attraction, angi-ogenesis,
implant remodelling and bone regeneration in line with
the literature [35–37]. Whether the higher VEGF mRNA levels
resulted from an up-regulation of VEGF in MSCs or is contributed
by attracted macrophages and endothelial cells remains to be
determined. However, MSCs not only secrete growth factors and
chemokines but also produce matrix-degrading proteases and
extracellular matrix molecules which might act on angiogenesis
and help in cell migration [38,39]. Overall our study, thus, demon-strates
that fibrin supports MSCs in organizing a beneficial envi-ronment
for bone regeneration by facilitating host macrophage
invasion relevant for tissue remodelling and enhancing endothelial
progenitor cell migration indispensible for new blood vessel
formation.
4.2. The cascade of invading cells
Pioneering cells penetrating deep into the implant were mainly
CD68-positive macrophages accompanied and followed by CD31-
positive endothelial progenitor cells. To our knowledge this is the
first study demonstrating a cell-dense migration front as a domi-nant
structure of in vivo integration and remodelling of a fibrin–
MSC composite. This cell-dense structure developing always from
the proximal bone ending may thus be a special feature of long
bone healing or be related to the fibrin hydrogel. At ectopic sites
in immune-competent [40,41] and immune-deficient host animals
[42,43] no cell-dense invasion front of host cells into tissue engi-neering
constructs has been observed. This structure may so far,
however, have escaped detection either because only late observa-tion
time points were chosen or because no histology was
performed at the early time points.
In many stress situations monocytes enter the damaged area
and differentiate into a spectrum of mononuclear phagocytes.
These newly recruited cells usually exhibit pro-inflammatory
action, and in the tissue inflammatory mediators such as IL-1,
IL-12 and TNF-a must be balanced with the need to protect tissue
integrity [44]. Our data for the first time provide evidence that
pro-inflammatory M1 macrophages also prevailed early during
long bone healing, while CD163-positive ‘‘anti-inflammatory’’ M2
macrophages [45] remained rare at day 6. Macrophages remain
responsive to further stimuli after their initial activation, are by
no means restricted to only these two categories [46], and M1 mac-rophages
can convert themselves into anti-inflammatory macro-phages
with an M2 wound-healing phenotype [47]. Further
studies at later time points are important to fully understand the
cascade of invading cells and their fate during long bone healing.
4.3. Immunomodulation by fibrin-based MSC implantation
To analyze the effect of fibrin-implanted MSCs on the inflam-matory
phase of bone healing, we looked for gene expression of
CD45 as well as IL-1b, TNF-a and IL-10 which represent relevant
immune mediators during early bone regeneration [48,49]. The
natural callus adjacent to cell-free fibrin hydrogel in the control
group contained a higher concentration of CD45-positive immune
cells than MSC-seeded implants and thus contained higher mRNA
levels of pro- and anti-inflammatory cytokines at day 3. The pres-ence
of MSCs in the cell-seeded fibrin hydrogel did not only dilute
the inflammatory cytokine-producing immune cells of the early
callus, but can also be expected to actively contribute with a broad
panel of trophic factors. These beneficial effects ultimately pro-duced
a stimulatory microenvironment evident from histology,
organizing remodelling of the fibrin hydrogel. Suppressive actions
of MSCs towards immune cells, as reported in other settings
in vitro and in vivo [50], were not apparent at this stage, since
the average levels of IL-1b, TNF-a and IL-10 per CD45-positive
immune cell were unaltered.
Although Sprague–Dawley rats have frequently been used for
studying outcome after cell and tissue transplantation between
animals with no evidence for strain-intern rejection [51–53], we
looked for local gene expression of the T-cell mediator IL-2 as an
early rejection marker after allogeneic implantation of MSCs. IL-2
mRNA levels were not increased in the MSC group at day 3 and
day 6, indicating that no acute T-cell-mediated rejection of the
implanted MSCs occurred within the fibrin hydrogel within the
first 6 days, in line with the findings in a syngeneic ectopic mouse
model [40]. Overall, this argues in favour of a microenvironment in
MSC-seeded fibrin hydrogel without early silencing of host
immune cells at days 3 and 6.
4.4. Tissue maturation and the fate of fibrin-implanted MSCs
According to detection of the implanted MSCs in our histologi-cal
sections at day 6, fibrin hydrogel was stable and cell supportive
enough to enable a local persistence of implanted MSCs for at least
6 days in a bone defect without connection to the vasculature. Fur-thermore,
according to detection of male DNA in laser-dissected
tissue areas behind the migration front, arriving immune cells
did not immediately degrade implanted MSCs during invasion.
However, since all cells were lost within 4 weeks after implanta-tion,
either their limited lifespan, a failure of re-adaptation to
changing needs during tissue maturation or other weaknesses
may have caused their ultimate replacement by host-derived
osteoprogenitor cells localized in adjacent bone marrow. In ectopic
models a mineral component such as beta-tricalcium phosphate
(b-TCP) or hydroxyapatite-tricalcium phosphate (HA/TCP) is
required for long-term MSC engraftment and MSC-mediated bone
formation [18,54]. Due to our interest in the early immunomodu-latory
actions of implanted MSCs, we decided to use a fibrin carrier
without ceramic particles since some inflammatory activity has
been reported for b-TCP [55,56] which would bias our results. In
our setting it remains unclear whether or not fibrin-implanted
MSCs have physically contributed to the maturing osteogenic

11. 4740 E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741
tissue of the MSC group until day 14 before replacement by host
bone. Although sex-mismatched animal models are well estab-lished
for studying MSC-mediated bone formation [21,57] and ele-gantly
permit the detection of persisting male cells in female
recipients without a need for cell labelling [58], a long-term rejec-tion
of male cells by the female immune system may have contrib-uted
to our result. The transient role of fibrin-implanted MSCs seen
here is, however, in line with data from genetically engineered
ASCs, which effectively stimulated femoral bone healing in rabbits,
despite some induction of a humoral- and cell-mediated immune
response and limited cell persistence over 4 weeks [59].
5. Conclusions
In summary, by using fibrin hydrogel—known for its biocom-patibility,
biodegradability and cell support for implantation of
MSCs into a long bone defect—we identified attraction of M1 mac-rophages
and endothelial progenitor cells into the implant as a
main early beneficial action of fibrin–MSC composites, promoting
implant integration, angiogenesis and tissue maturation during
bone regeneration. No evidence for an early immune suppression
by fibrin-implanted MSCs was obtained, as expression levels of
the pro-inflammatory cytokines IL-1b and TNF-a as well as the
anti-inflammatory cytokine IL-10 by the invading immune cells
were unaltered. Trophic and pro-angiogenic stimulation during
bone regeneration occurred independently of a long-term engraft-ment
of the implanted MSCs at the defect site. Early recruitment of
host repair cells into fibrin hydrogel was most likely stimulated
through the secretion of bioactive factors including VEGF whose
elevated levels may have generated a pro-angiogenic environment
beneficial for bone regeneration. With this advanced understand-ing
of the mechanisms involved in fibrin hydrogel-based MSC-sup-ported
bone regeneration, we suggest fibrin hydrogel can serve as
an attractive carrier for MSC-based tissue engineering approaches
in long bone repair, supporting early trophic and pro-angiogenic
activities to improve clinical treatment of atrophic pseudarthrosis,
bone injury or tumor resection.
Disclosure
The authors indicate no potential conflicts of interest.
Acknowledgements
We thank Svenja Schäfer and Viviana Grajales for their support
with the surgery and with animal care. Furthermore we thank
Nicole Buchta and Birgit Frey for their help with the experiments
and Simone Gantz for her statistical support. This study (grant RI
707/8-1) was funded by the priority program SPP1468 ‘‘Immuno-bone’’
of the German Research Foundation (DFG).
Appendix A. Figures with essential color discrimination
Certain figures in this article, particularly Figs. 1, 2 and 6 are
difficult to interpret in black and white. The full color images can
be found in the on-line version, at http://dx.doi.org/10.1016/
j.actbio.2014.07.017.
References
[1] Patterson TE, Kumagai K, Griffith L, Muschler GF. Cellular strategies for
enhancement of fracture repair. J Bone Joint Surg Am 2008;90(Suppl. 1):111–9.
[2] Wu X, Ren J, Li J. Fibrin glue as the cell-delivery vehicle for mesenchymal
stromal cells in regenerative medicine. Cytotherapy 2012;14:555–62.
[3] Bensaid W, Triffitt JT, Blanchat C, Oudina K, Sedel L, Petite H. A biodegradable
fibrin scaffold for mesenchymal stem cell transplantation. Biomaterials
2003;24:2497–502.
[4] Dickhut A, Gottwald E, Steck E, Heisel C, Richter W. Chondrogenesis of
mesenchymal stem cells in gel-like biomaterials in vitro and in vivo. Front
Biosci 2008;13:4517–28.
[5] Sierra DH. Fibrin sealant adhesive systems: a review of their chemistry,
material properties and clinical applications. J Biomater Appl 1993;7:309–52.
[6] Steck E, Fischer J, Lorenz H, Gotterbarm T, Jung M, Richter W. Mesenchymal
stem cell differentiation in an experimental cartilage defect: restriction of
hypertrophy to bone-close neocartilage. Stem Cells Dev 2009;18:969–78.
[7] Jung M, Kaszap B, Redohl A, Steck E, Breusch S, Richter W, et al. Enhanced early
tissue regeneration after matrix-assisted autologous mesenchymal stem cell
transplantation in full thickness chondral defects in a minipig model. Cell
Transplant 2009;18:923–32.
[8] Friedenstein AJ, Petrakova KV, Kurolesova AI, Frolova GP. Heterotopic of bone
marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues.
Transplantation 1968;6:230–47.
[9] Sacchetti B et al. Self-renewing osteoprogenitors in bone marrow sinusoids can
organize a hematopoietic microenvironment. Cell 2007;131:324–36.
[10] Dominici M et al. Minimal criteria for defining multipotent mesenchymal
stromal cells. The International Society for Cellular Therapy position
statement. Cytotherapy 2006;8:315–7.
[11] Pittenger MF et al. Multilineage potential of adult human mesenchymal stem
cells. Science 1999;284:143–7.
[12] Meirelles Lda S, Fontes AM, Covas DT, Caplan AI. Mechanisms involved in the
therapeutic properties of mesenchymal stem cells. Cytokine Growth Factor
Rev 2009;20:419–27.
[13] Caplan AI, Correa D. The MSC: an injury drugstore. Cell Stem Cell 2011;9:11–5.
[14] Kadiyala S, Jaiswal N, Bruder SP. Culture-expanded, bone marrow-derived
mesenchymal stem cells can regenerate a critical-sized segmental bone defect.
Tissue Eng 1997;3:173–85.
[15] Bruder SP, Kraus KH, Goldberg VM, Kadiyala S. The effect of implants loaded
with autologous mesenchymal stem cells on the healing of canine segmental
bone defects. J Bone Joint Surg Am 1998;80:985–96.
[16] Quarto R et al. Repair of large bone defects with the use of autologous bone
marrow stromal cells. N Engl J Med 2001;344:385–6.
[17] Marcacci M et al. Stem cells associated with macroporous bioceramics for long
bone repair: 6- to 7-year outcome of a pilot clinical study. Tissue Eng
2007;13:947–55.
[18] Janicki P, Boeuf S, Steck E, Egermann M, Kasten P, Richter W. Prediction of
in vivo bone forming potency of bone marrow-derived human mesenchymal
stem cells. Eur Cell Mater 2011;21:488–507.
[19] Janicki P, Kasten P, Kleinschmidt K, Luginbuehl R, Richter W. Chondrogenic
pre-induction of human mesenchymal stem cells on beta-TCP: enhanced bone
quality by endochondral heterotopic bone formation. Acta Biomater
2010;6:3292–301.
[20] Giannoni P, Scaglione S, Daga A, Ilengo C, Cilli M, Quarto R. Short-time survival
and engraftment of bone marrow stromal cells in an ectopic model of bone
regeneration. Tissue Eng Part A 2010;16:489–99.
[21] Boukhechba F et al. Fate of bone marrow stromal cells in a syngenic model of
bone formation. Tissue Eng Part A 2011;17:2267–78.
[22] Zimmermann CE, Gierloff M, Hedderich J, Acil Y, Wiltfang J, Terheyden H.
Survival of transplanted rat bone marrow-derived osteogenic stem cells
in vivo. Tissue Eng Part A 2011;17:1147–56.
[23] Prockop DJ. Repair of tissues by adult stem/progenitor cells (MSCs):
controversies, myths, and changing paradigms. Mol Ther 2009;17:939–46.
[24] Hughes PC, Tanner JM. The assessment of skeletal maturity in the growing rat.
J Anat 1970;106:371–402.
[25] Dobson KR, Reading L, Haberey M, Marine X, Scutt A. Centrifugal isolation of
bone marrow from bone: an improved method for the recovery and
quantitation of bone marrow osteoprogenitor cells from rat tibiae and
femurae. Calcif Tissue Int 1999;65:411–3.
[26] Meirelles Lda S, Nardi NB. Murine marrow-derived mesenchymal stem cell:
isolation, in vitro expansion, and characterization. Br J Haematol
2003;123:702–11.
[27] Winter A et al. Cartilage-like gene expression in differentiated human stem
cell spheroids: a comparison of bone marrow-derived and adipose tissue-derived
stromal cells. Arthritis Rheum 2003;48:418–29.
[28] Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine
system in diverse forms of macrophage activation and polarization. Trends
Immunol 2004;25:677–86.
[29] Brown BN, Valentin JE, Stewart-Akers AM, McCabe GP, Badylak SF.
Macrophage phenotype and remodeling outcomes in response to biologic
scaffolds with and without a cellular component. Biomaterials
2009;30:1482–91.
[30] Wagner W et al. Molecular and secretory profiles of human mesenchymal
stromal cells and their abilities to maintain primitive hematopoietic
progenitors. Stem Cells 2007;25:2638–47.
[31] Kinnaird T, Stabile E, Burnett MS, Lee CW, Barr S, Fuchs S, et al. Marrow-derived
stromal cells express genes encoding a broad spectrum of arteriogenic
cytokines and promote in vitro and in vivo arteriogenesis through paracrine
mechanisms. Circ Res 2004;94:678–85.
[32] Huang NF, Chu J, Lee RJ, Li S. Biophysical and chemical effects of fibrin on
mesenchymal stromal cell gene expression. Acta Biomater 2010;6:3947–56.
[33] Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone
remodeling. J Biol Chem 2010;285:25103–8.
[34] Park JE, Barbul A. Understanding the role of immune regulation in wound
healing. Am J Surg 2004;187:11S–6S.

12. E. Seebach et al. / Acta Biomaterialia 10 (2014) 4730–4741 4741
[35] Geiger F et al. VEGF producing bone marrow stromal cells (BMSC) enhance
vascularization and resorption of a natural coral bone substitute. Bone
2007;41:516–22.
[36] Kumar S, Wan C, Ramaswamy G, Clemens TL, Ponnazhagan S. Mesenchymal
stem cells expressing osteogenic and angiogenic factors synergistically
enhance bone formation in a mouse model of segmental bone defect. Mol
Ther 2010;18:1026–34.
[37] Lin CY et al. Long-term tracking of segmental bone healing mediated by
genetically engineered adipose-derived stem cells: focuses on bone
remodeling and potential side effects. Tissue Eng Part A 2014;20:1392–402.
[38] Choi YA et al. Secretome analysis of human BMSCs and identification of SMOC1
as an important ECM protein in osteoblast differentiation. J Proteome Res
2010;9:2946–56.
[39] Polacek M, Bruun JA, Elvenes J, Figenschau Y, Martinez I. The secretory profiles
of cultured human articular chondrocytes and mesenchymal stem cells:
implications for autologous cell transplantation strategies. Cell Transplant
2011;20:1381–93.
[40] Tasso R et al. Recruitment of a host’s osteoprogenitor cells using exogenous
mesenchymal stem cells seeded on porous ceramic. Tissue Eng Part A
2009;15:2203–12.
[41] Tasso R, Fais F, Reverberi D, Tortelli F, Cancedda R. The recruitment of two
consecutive and different waves of host stem/progenitor cells during the
development of tissue-engineered bone in a murine model. Biomaterials
2010;31:2121–9.
[42] Tortelli F, Tasso R, Loiacono F, Cancedda R. The development of tissue-engineered
bone of different origin through endochondral and
intramembranous ossification following the implantation of mesenchymal
stem cells and osteoblasts in a murine model. Biomaterials 2010;31:242–9.
[43] Ghanaati S et al. Scaffold vascularization in vivo driven by primary human
osteoblasts in concert with host inflammatory cells. Biomaterials
2011;32:8150–60.
[44] Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage
subsets. Nat Rev Immunol 2011;11:723–37.
[45] Ambarus CA et al. Systematic validation of specific phenotypic markers for
in vitro polarized human macrophages. J Immunol Methods 2012;375:
196–206.
[46] Novak ML, Koh TJ. Macrophage phenotypes during tissue repair. J Leukoc Biol
2013;93:875–81.
[47] Arnold L et al. Inflammatory monocytes recruited after skeletal muscle injury
switch into antiinflammatory macrophages to support myogenesis. J Exp Med
2007;204:1057–69.
[48] Mountziaris PM, Mikos AG. Modulation of the inflammatory response for
enhanced bone tissue regeneration. Tissue Eng Part B Rev 2008;14:179–86.
[49] Kolar P et al. The early fracture hematoma and its potential role in fracture
healing. Tissue Eng Part B Rev 2010;16:427–34.
[50] Ghannam S, Bouffi C, Djouad F, Jorgensen C, Noel D. Immunosuppression by
mesenchymal stem cells: mechanisms and clinical applications. Stem Cell Res
Ther 2010;1:2.
[51] Larsson J, Juliusson B, Holmdahl R, Ehinger B. MHC expression in syngeneic
and allogeneic retinal cell transplants in the rat. Graefes Arch Clin Exp
Ophthalmol 1999;237:82–5.
[52] Troum S, Dalton Jr ML. Osteogenesis in a rat model: use of bone marrow cells
and biodegradable gelatin matrix carrier. J South Orthop Assoc 2001;10:
37–43.
[53] Yang Y, Rossi FM, Putnins EE. Periodontal regeneration using engineered bone
marrow mesenchymal stromal cells. Biomaterials 2010;31:8574–82.
[54] Krebsbach PH, Kuznetsov SA, Satomura K, Emmons RV, Rowe DW, Robey PG.
Bone formation in vivo: comparison of osteogenesis by transplanted mouse
and human marrow stromal fibroblasts. Transplantation 1997;63:1059–69.
[55] Lange T, Schilling AF, Peters F, Haag F, Morlock MM, Rueger JM, et al.
Proinflammatory and osteoclastogenic effects of beta-tricalciumphosphate
and hydroxyapatite particles on human mononuclear cells in vitro.
Biomaterials 2009;30:5312–8.
[56] Curran JM, Gallagher JA, Hunt JA. The inflammatory potential of biphasic
calcium phosphate granules in osteoblast/macrophage co-culture.
Biomaterials 2005;26:5313–20.
[57] Nakamura A et al. Cell sheet transplantation of cultured mesenchymal stem
cells enhances bone formation in a rat nonunion model. Bone 2010;
46:418–24.
[58] An J, Beauchemin N, Albanese J, Abney TO, Sullivan AK. Use of a rat cDNA probe
specific for the Y chromosome to detect male-derived cells. J Androl
1997;18:289–93.
[59] Lin CY et al. Immune responses during healing of massive segmental femoral
bone defects mediated by hybrid baculovirus-engineered ASCs. Biomaterials
2012;33:7422–34.