Drafting chemical patent specs and claims

Patenting “chemical” inventions
An appreciation topic to draft specifications
and claims in the Chemical Field

Caezar Angelito E. Arceo
Registered Patent Agent in the Philippines
(Non-chemical field, 2006; Chemical field, 2007)
Mentor, Patent Agent Qualifying Examinations 2011

Intellectual Property Management Training Cum Writeshop on Technology Disclosure and Claim Drafting
Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (PCAARRD)
Bulwagang Panday Karunungan, PCAARRD, Los Baños, Laguna (Philippines)
30 August 2012

Special notes
(1) Grateful acknowledgment:

Mr. Noel A. Catibog, PCAARRD Dr. Karl Rackette, EPO
Dr. Patricio S. Faylon, PCAARRD Dr. Ray Coleiro, EPO
Dr. Cecilia P. Reyes, NRCP The World Intellectual Property Office
Ms. Renia C. Corocoto, NRCP The men and women of the Sapalo Velez Bundang &
Mr. Jerry C. Serapion, PhilRice Bulilan Law Offices
Engr. Rey Negre, IPOPHIL Atty. Anna Mariae Celeste V. Jumadla, former boss
Ms. Rosa M. Fernandez, IPOPHIL Atty. Ronilo A. Beronio, former boss
Ms. Virginia M. Aumentado, IPOPHIL
Ms. Rudina Pescante, Patrick Miranda (Singapore)

(2) This presentation was designed not to teach claim drafting, which requires
at least one week training course, but to help interested participants to
appreciate the art, which is necessary for effective chemical claim drafting.

(3) Citing the source of slides in your public presentation/publication is humbly
requested.

(4) May this serve as an invitation to take the Patent Agent Qualifying
Examinations (PAQE).

(5) Enjoy!

Outline

1.0 Patenting quick review 3 min
2.0 Claims 10 min
3.0 Scenario: My awesome eureka! 30 min
4.0 The “chemical” claims 15 min
5.0 End 1 min

1.0 Patenting quick review
Our questions:

1.1 What is a patent?
1.2 Why patent?
1.3 What can be patented?
1.4 What cannot be patented?
1.5 What are the requirements of a patent?
1.6 What are the parts of a patent document?

1.1 What is a patent?
“A Patent is a grant issued by the
government through the Intellectual
Property Office of the Philippines (IP
Philippines).” “It is an exclusive right
granted for a product, process
or an improvement of a product
or process which is new,
inventive and useful.”

“A patent has a term of protection of twenty (20) years
providing an inventor significant commercial gain.”

Source: http://ipophil.gov.ph/
“A patent is a contract between
the government and the inventor.”

- Dr. Karl Rackette

© 2012 by Caezar AE. Arceo
Claim drafting crash course for the
Sapalo Velez Bundang & Bulilan

1.2 Why patent?
“There is no reason
anyone would want a computer
in their home.”
- Ken Olsen (1977)
Founding Chair, Digital
Equipment Corporation

1.3 What can be patented?
Any technical solution of a problem
in any field of human activity which
is new, involves an inventive step
and is industrially applicable shall be - Sec. 21, RA 8293
Patentable. It may be, or may relate to, a
product, or process, or an improvement
of any of the foregoing.

1.4 What cannot be patented?
EXCLUSIONS: An invention shall not be
considered new if it forms part of a
(1) Discoveries, scientific prior art.
theories and mathematical
methods; - Sec. 23, RA 8293
(2) Schemes, rules and methods - Rule 203, Patents IRR
of performing mental acts,
playing games or doing  Made available to the public
business, and programs for anywhere in the world.
computers;  Earlier applications.
(3) Methods for treatment of the - Rule 204, Patents IRR
human or animal body;
(4) Plant varieties or animal
breeds or essentially
biological process for the
Prohibited statements in the application:
production of plants or (1) Contrary to “public order” or morality.
animals. (2) Disparaging other products or
(5) Aesthetic creations; and processes of any person other than the
(6) Anything which is contrary to applicant.
public order or morality. (3) Obviously irrelevant or unnecessary
under the circumstances.
- Sec. 22, RA 8293 - Rule 412, Patents IRR

1.5 What are the requirements of a patent?

Novelty
1
An invention shall not be Inventive step
considered new if it forms
part of a prior art.
2
An invention involves an
- Sec. 23, RA 8293 inventive step if, having
regard to prior art, it is not
obvious to a person skilled in

3 Industrial
the art at the time of the filing
date or priority date of the
application claiming the
applicability invention
- Sec. 26, RA 8293
An invention that can be produced and
used in any industry shall be industrially
applicable.
- Sec. 27, RA 8293 Claim drafting crash course for the

4 Abstract

3 Claims

2 Specifications

1 Request for Grant of
Patent (Application
form)

5 Drawings


Title Abstract

Authors and Affiliations Contact a Claims
patent agent
Abstract
Specifications
Introduction

Review of Literature

Methodology Request for Grant of
Patent (Application
Results and Discussion form)

Summary, Conclusions, Recommendations
Drawings
Literature cited

2.0 Patent claims
Our questions:

2.1 What is a claim?
2.2 Why claim?
2.3 How to draft claims?

2.1 What is a claim?

“Patent claims are the part of a patent or patent
application that defines the scope of protection
granted by the patent. The claims define, in technical
terms, the extent of the protection conferred by a
patent, or the protection sought in a patent
application.”

- http://en.wikipedia.org/wiki/Claim_patent

“...the extent of the protection
conferred by a patent shall be
determined by the claims...”
Sec. 75, RA 8293


2.2 Why claim?
(4) It is a MUST.

“[T]he name of the game
is the claim.”
In re Hiniker Co.,
150 F.3d 1362, 1369 (Fed.Cir.1998)

(1) Use the “Problem and solution approach”

Step 1
Determine the closest prior art.

Step 2
Evaluate the difference between the
closest prior art and the claimed invention.

Step 3
Formulate the technical problem.

Step 4
Determine obviousness.

(2) Follow basic steps in claim drafting.

Step 1
Evaluate the subject matter. Step 2
Identify basic elements of invention.

Step 3
Prepare outline of subject Step 4
matter. Draft set of claims.

Step 5
Prepare drawings/figures (whenever applicable).

Step 6
Draft abstract of disclosure. Based on “Claim Drafting in the Field of Biotechnology”
by Ms. Rosa M. Fernandez and Engr. Herminia T.
Maniquiz, PCARRD presentation, 30-31 August 2007.

(3) Use appropriate claim drafting style.
Philippine Patent No. 1-2004-000586:
1. A seed treating machine for applying chemical treatment to
seeds, comprising:
(a) a seed delivery assembly, where seeds are contained and Preamble  Should contain a
collected from source prior to a seed treating process; statement indicating
(b) a cone assembly, where seeds from the said seed delivery
assembly are allowed to pass through by gravity; and “the designation of
(c) a spinning disk assembly, which distributes a chemical the subject matter of
treatment to the seeds while being dropped from the said
seed delivery assembly and through the said cone the invention” and
assembly, said spinning disk assembly is rigidly fixed to the “technical
the said seed delivery assembly;
features of the prior
characterized in that the said seed delivery assembly and the
said cone assembly are detachably coupled to each other. art” (Rule 416)
 Basically: Recites the
The “switch’. Characterizing portion prior art.

Also can be used:  Should state the technical
whereby features it is desired to
wherein protect (Rule 416)
 In short: The invention.

3.0 Scenario: My awesome eureka!!!
Our simple question:

3.1 Can you help me file a patent application?

General instructions:
(1) Group yourselves and grab your writing materials.
(2) You may switch on your “specialist knowledge” for this exercise,
provided, that you will accept my disclosures as true.
(3) Listen to my disclosures and ask questions.
(4) Prepare a matrix like this for presentation. Defend your position.
Disclosure Patentable? Reason(s) If yes, list what to claim

Hello…I was wandering inside Makiling Forest and
this is what I found…

(1) Amazing morphology Leg!

Leg!

Leg! Leg!

Two nuclei!
Leg!
Leg!

Leg!

Leg!
0.01 mm

(2) Amazing locomotion

Unidirectional speed:
Steering speed: 0.01 mm min-1
0.005 mm min-1

Note: I used a novel
method of determining
speed of this
microorganism!

0.01 mm

(3) Amazing cell wall

Pinch-proof!!!

Novel compound:
DNA
CTGGTGAAGCCTTCACAGACCCTGTCCCTC
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGA

Protein
LVKPSQTLSLQVQLQESGPG

(4) Amazing chemical compounds produced
TiO2

Negrein, with unknown use

Catibein, with anti-
dengue properties

??? Unknown structure

(5) Amazing magical features

If temperature drops
to below 10 degrees
Celsius, it turns to
pink or red!!!

Sample answer
Disclosure Patentable? Reason(s) If yes, list what to claim
1. Morphology No Naturally occurring
2. Locomotion Speed, Naturally occurring
ability: No
Tool: Yes Perhaps novel method Method of determining speed
3. Cell Wall Features: No “Pinch proof” is a
natural characteristic
of a naturally occurring
organism
Compound: Perhaps novel Allegedly novel compound,
Perhaps compound depending on the patent agent;
Better: with industrial application
4. Chemical Negrein: No No industrial
compound application yet
Catibein: Yes Medical use Catebein’s use; better if structure
is already available
5. “Magic” No No industrial
application yet

4.0 The “chemical” claims
Our questions:

4.1 What are “chemical” inventions?
4.2 How are “chemical” inventions protected?
4.3 What can be claimed in “chemical” inventions?
4.4 What cannot be claimed in “chemical” inventions?
4.5 How to draft “chemical” claims?

(1) They are not mechanical inventions. ^_^

 Relatively tough to claim.
 Differences between chemical and non-chemical (mechanical) claims:

Type/format Brief description Chemical Non-chemical
Jepson claims Basic two-part claim type √ √
Beauregard Generally used to circumvent √
claims unpatentability of software
Markush claims Claims species/groups √
Means-plus- Apparatus and its functional √
function features
Product-by- Chemical product as a product of a √
process process
Swiss type Equivalent of “second medical use” √
format in the Philippines

(2) They encompass a broad range of inventions.

Based on “Claim Drafting in the Field of Biotechnology”
by Ms. Rosa M. Fernandez and Engr. Herminia T.
Maniquiz, PCARRD presentation, 30-31 August 2007.

4.2 How to protect “chemical” inventions?

(1) File a patent application before publication.

 Necessary if you intend to file through PCT, or in countries that require
absolute novelty.
 Applicable if you intend to upload your sequences or compound
structures in public databases.
 Practical re: “First to file rule”.

(2) Test and claim within the group, class, or category.
 Applicable for chemical compounds (re: Markush claim).
 May be applicable for microoganisms with potential antimicrobial use
(i.e., within the genus instead of species)

(3) Deposit microorganisms.

 Budapest Treaty.
 Find a suitable (read: cost-effective) depositary institution.

4.3 What can be claimed in “chemical” inventions?
Three types of claims based on the subject matter
1. Claims to a physical entity
Entity Classes/sub-classes Examples
Products Chemical compounds, Insecticide compositions, Has broader
compositions proteins commercial
Microorganisms Vectors for plant application
transformation (conventional
patent agent
Apparatus Machine used to Gene gun view).
manufacture the products
2. Claims to an activity
Entity Classes/sub-classes Examples
Process Chemical production Biopesticide production
Method of application of a “Ballistic” biopesticide
chemical product
Use First use Biopesticide
Second use Biopesticide as foliar spray
3. Combination of both.
 “Product-by-process”

4.4 What cannot be claimed in “chemical”
inventions?
(1) Method of treating human or animal bodies.

 Methods of surgery or therapy and diagnostic methods.
 Any treatment or diagnostic method that will be carried out on the living
human or animal body.

(2) Lacking “industrial applicability”.

 Method of contraception vs. “purely cosmetic treatment of a human by
administration of a chemical product”

- p. 55, Ch IV, 4.3, Manual of Substantive Examination Practice

4.4 What cannot be claimed in “chemical”
inventions?
(3) Anything that is contrary to morality or public order.

 Example 1: Abortion pill vs. medical drug.
 Example 2: Dynamite to kill people vs. blast mountains for mining
purposes.
 Example 3: Stem cell to create human parts vs. treat diseases.
 Example 4: Sex enhancement drugs vs. medicine for sexual dysfunction.


(1) Spot the invention!

Shortcut: Identify the closest prior art.

For a process invention, the closest prior art is usually a similar process.

For a method of use invention, the closest prior art is usually a
disclosure of a similar use of the same product, or the same use of a
structurally similar product.

For a product invention, the closest prior art is usually another product
having the same intended use or purpose. This product will normally also
have the greatest number of technical features in common with the
invention.

- p. 78, Annex 2 to Ch IV, 9, Manual of Substantive Examination Practice


(2) Follow appropriate claim set format.
Preamble

Independent claim
 Also known as (1)
main claim; (2)
mother claim.
 The most important
claim in the set.

Characterizing portion
Dependent claims
 Include all the features of
any other claim(s).
 Contain a reference to the
other claim. (i.e., “according
to claim 1”, etc)


(3) Follow appropriate claim style.

function features
process process



claims About Jepson of software
unpatentability claims:
(1) Basic claim construction acceptable in the Philippines.
Means-plus- (2) Rule 416(a) its functional
Apparatus and and (b) on Patents define the two-part form √
function features a claim should adopt “wherever appropriate.”
which
process Example:
process
“1. A continuous on-line steam purity monitoring system for
geothermal power generation plants comprising the steps of
xxx, whereby the sodium concentration in the steam is used
as an indication of purity.”
(Philippine Pat. No. 1-2007-000448)

4.5 How to draft Markush claims: claims?
About
“chemical”
(1) Usually used in chemical patents although also
applicable in other fields.
(2) A "Markush claim" can be considered as a shortened
formulation of a claim. (Rule 605, Rules on Patents)
Type/format (3) Markush grouping is allowable only if all alternatives
Brief description Chemical Non-chemical
have a common property or activity AND a common
structure is present. (Rule 605, Rules on Patents)
function features Examples:
process process “1. A composition comprising a copper compound
and a dimerised thiourea derivative of Formula

wherein the two substituents R, which may...
(Manual of Substantive Examination and Practice)

About Product-by-Process claims:

(3) Follow appropriate claiminstyle. inventions, as a chemical
(1) Usually used medical
product can be characterized as the product of a
process. Acceptable if compound is new.
Type/format Brief description #1: Only when a process used is
(2) Application Chemical Non-chemical
Jepson claims Basic two-part claim typethe case of microorganisms.
repeatable, as in √ √
(3) Application #2: A recombinant vector, being a chemical
product, may be characterized by (i) its formula, (ii) as
the product of a process, (iii) a combination of
Markush claims √
Claims parameters, or (iv) composition of sub-parts. (p. 161,
species/groups
Means-plus- Ch. 7, Manual of Substantive Examination Practice)
Apparatus and its functional √
function features
process process
Example: format in the Philippines
“1. Product prepared by reacting the reaction product of A and B with substances
X and Y.” (p. 137, Ch. 7, Manual of Substantive Examination Practice)

4.5 How to draft Swiss-type claims:claims?
About
“chemical”
(1) Equivalent of “second medical use” claim format in the
Philippines.
(2) Allowed even if the compound is already known and the
medical use is also known, but a second medical use was
Type/format Brief description before.
not disclosed Chemical Non-chemical
(3) Some acceptable formats:
(a) compound X for use as a medicament
Beauregard Generally (b) compound X for use as an analgesic
used to circumvent √
claims unpatentability of software for use in curing disease Y
(c) compound X
√
(d) medicament containing the compound X
Markush claims Claims species/groups
(e) use of X for preparing a medicament
function features
Example:
process process of an oculosurface selective glucocorticoid for the
“1. Use
Swiss type Equivalent ofof a topical ophthalmic composition for treating
preparation “second medical use” √
format in dry eye conditions, xxx wherein the oculosurface
chronic the Philippines
selective glucocorticoid comprises rimexolone and wherein the
composition contains rimexolone at a concentration of 0.001 to
less than 0.1 w/v%.” (Phil. Pat. 1-2005-501206)

5.0 Any questions?

And...thank you!

© 2012 by Caezar Angelito Estioko Arceo

cangear@yahoo.com
http://www.youtube.com/cangear
http://www.twitter.com/cangear
http://www.slideshare.net/cangear
http://www.scribd.com/cangear

Drafting chemical patent specs and claims

Recommandé

Recommandé

Contenu connexe

Tendances

Tendances (20)

En vedette

En vedette (20)

Similaire à Drafting chemical patent specs and claims

Similaire à Drafting chemical patent specs and claims (20)

Plus de Caezar Angelito E Arceo

Plus de Caezar Angelito E Arceo (6)

Dernier

Dernier (20)

Drafting chemical patent specs and claims

Notes de l'éditeur