Dhara Desai- thesis

“STUDY THE EFFECTS OF PESTICIDES ON NEMATOPHAGOUS
FUNGI AND ITS MOLECULAR CHARACTERISATION”
A
Dissertation Thesis
Submitted for
The Partial Fulfillment of the Requirement for
The Award of the Degree of
Master of Science in
INTEGRATED BIOTECHNOLOGY
(GENERAL BIOTECHNOLOGY)
of
Sardar Patel University
November’2013
Submitted by:
DHARA DESAI
ARIBAS
Supervisor:
ANJU KUNJADIA
Associate Professor in Biotechnology,
Ashok & Rita Patel Institute of Integrated Study &
Research in Biotechnology and Allied Sciences
(ARIBAS) New Vallabh Vidyanagar.

CERTIFICATE
This is to certify that the work presented in the dissertation project report entitled
“Study the effects of Pesticides on Nematophagous Fungi and its molecular
characterization”submitted by Miss Dhara P. Desai of Ashok and Rita Patel Institute of
Integrated Study and Research in Biotechnology & Allied Sciences, New Vallabh
Vidyanagar comprises the results of independent and original work carried out under my
supervision for the partial fulfillment of the award of the degree of M. Sc. Integrated
Biotechnology of Sardar Patel University, Vallabh Vidyanagar.
I further certify that this work did not form a part of any other work published or
unpublished.
Dr. Anju Kunjadia,
Associate Professor,
Biotechnology.
24/10/2013
Forwarded by
Dr. Nilanjan Roy,
Director,ARIBAS.

UNDERTAKING
I, Miss Dhara P. Desai, of Ashok and Rita Patel Institute of Integrated Study and Research in
Biotechnology & Allied Sciences, New Vallabh Vidyanagar hereby undertake that the work presented
in the dissertation project report entitled “Study the effect of Pesticides on Nematophagous Fungi
and its molecular characterization”comprises the results of independent and original work carried
out by me under the supervision of Dr. Anju Kunjadia for the partial fulfillment of the award of the
degree of M. Sc. Integrated Biotechnology of Sardar Patel University, Vallabh Vidyanagar.
I further declare that this work did not form a part of any other work published or
unpublished.
Miss Dhara P. Desai
24/10/2013

Acknowledgement
My resolve towards the aim of designing and conducting a de novo dissertation has finally borne
conclusive and desired results. Although the journey was full of uncertainties and difficulties, I was
able to strive through the phase and achieve this important academic feat in my life owing to
contribution of a few enterprising people who stepped in to give their valuable guidance and
support.
I would like to express my deepest gratitude to my guide Dr. Anju Kunjadia for giving me an
opportunity to do my dissertation work under her coveted mentorship. It has indeed been a
resourceful and privileged experience to work under the guidance of a researcher of this stature and
rich experience and getting to know, practice and imbibe the investigative, logical and knack of
systematic working that is demanded of a newly up taken research project. I indeed thank you
madam, for obliging me with this unique opportunity
I convey my heartfelt thanks to research scholar Ramesh Pandit. It was because of his consistent
support and prudent solutions given at the time when I got stuck at certain places, that I was able to
carry out the work hitch free. I indeed thank him for being approcachable and ready to help always. I
will be ever indebted to him for his support extended in the need of hour.
Most respectfully I submit my acknowledgment to Dr. Nilanjan Roy for continuously being involved
in raising the standards of education in the institute and effectively teaching students to imbibe a
professional work culture, sincerity towards work, clarity of thought so as to is utilized upto the best
of the potential to develop skills at par with international standards.
My most humble and sincere thanks are to Dr. C.L. Patel, and CVM(Charutar Vidhya Mandal)for
providing such help and giving the opportunity to study this course.
I am thankful to all the lab assistants and peons Arvindbhai and Dineshbhai and for helping me in
whenever I need in anyway
My friends Vatsal, mittal, sheel stood always there for me during my entire work and I am very much
thankful to them for understanding my things and for sharing their important point of view and
correct me in my experiment work.
Lastly and most importantly I would like to thank my parents for their constant support and
encouragement that kept me sailing and triumphing out of challenging phases of life, this
dissertation being one of the same. I am indeed ever indebted to them.
Dhara P. Desai

INDEX
1. INTRODUCTION & REVIEW LITERATURE
1.1 Nematode infection in plants and animals…………………………………2
1.1.1 Plant parasitic nematode………………………………………………3
1.1.2 Animal parasitic nematode……………………………………………5
1.2 Harmful effects of parasitic nematodes on crop yield……………………..6
and live stock production
1.2.1 Loss of agriculture due to parasitic nematodes………………………..7
∑ Lesion nematode infection
∑ Root-knot disease
∑ Potato crop diseases
∑ Foliar nematode disease
1.2.2 Effect on live stock production………………………………………..10
1.3 Control strategies for nematodes…………………………………………..11
1.3.1 For plant parasitic nematodes………………………………………….11
(1) Crop rotation
(2) Chemical controls
(3) Use of resistant plants
(4) Use of biological agents
1.3.2 For animal parasitic nematodes………………………………………..13
1.4 Biocontrol for nematodes……………………………………….………….14
1.5 Nematophagous fungi as biocontrol of nematodes………………………...15
1.5.1 Nematode trapping fungi……………………………………………....16
1.5.2 The endo-parasitic fungi……………………………………………….17
1.5.3 The egg and cyst parasitic fungi……………………………………….17
1.6 Nematode fungus interaction mechanism………………………………….18
1.6.1 Recognition and host specificity……………………………………….18
1.6.2 Attraction………………………………………………………………19
1.6.3 Adhesion……………………………………………………………….19
1.6.4 Penetration……………………………………………………………..19
1.7 Non-targeted effect of pesticides…………………………………………..20
1.7.1 Pesticides and environmental effects…………………………………..20
1.7.2 Why to study effects of pesticides on growth of nematophagous fungi..21
1.8 Importance of serine protease in performing predatory activity…………...22
2. OBJECTIVES……………………………………………………………….……..25
3. MATERIALS AND METHODS

3.1 MATERIALS………………………………………………………………26
3.2 METHODS…………………………………………………………………30
3.2.1 Maintenance of fungal cultures…………………………………………30
3.2.2 Preparation of media……………………………………………………30
3.2.3 Microscopic study of fungi………………………...…………………...30
3.2.4 Optimization of growth conditions…………………………………….30
(1) Optimization of media
(2) Optimization of pH and Temperature
3.2.5 Effect of Pesticides on the growth of isolates………………………….31
(1) Effect of Fungicides
(2) Effect of herbicide
(3) Effect of insecticide
3.2.6 Fungal DNA isolation……………………………………………….32
3.2.7 Agarose gel electrophoresis………………………………………….33
3.2.8 Quantification of DNA………………………………………………33
3.2.9 PCR amplification of 18s rRNA and Serine Protease gene…………33
3.2.10 Identification of fungi……………………………………………….33
4. RESULTS AND DISCUSSION
4.1 Morphological characterization of isolates by microscopic study…….37
4.2 Optimization of growth media………………………………………....39
4.3 Optimization of pH………………………………………………….…40
4.4 Optimization of temperature…………………………………………...41
4.5 Effect of fungicide……………………………………………………..42
4.5.1 Effect of carbendazi………………………………………….…….42
4.5.2 Effect of tebucanazo……………………………………………….42
4.5.3 Effect of mencozeb….……………………………….…………….42
4.6 Effect of herbicide……………………………………….…………….44
4.6.1 Effect of glyphosate………………………………………………..44
4.6.2 Effect of methsulfuryl methyl………………………………………45
4.7 Effect of insecticides………………………………………………..,…46
4.7.1 Effect of Ethion…………………………………………………….46
4.7.2 Effect of prophenofos………………………………..…………….47
4.8 DNA Isolation……………………………………………………….…48
4.9 PCR product of 18s rRNA & Serine Protease…...…………………..…49
4.10 Identification and phylogenetic analysis of isolates based on 18s rRNA gene
and Serine Protease gene sequencing……………………………..……50
5. CONCLUSION
6. REFRENCES
7. APPENDIX

LIST OF FIGURES
Figure 1 Plant parasitic nematode life cycle
Figure 2 Animal parasitic nematode life cycle
Figure 3 Trapping structure of nematodes by
nematophagous fungi
Figure 4 Morphological characterization of isolates
GS1
Figure 5 Morphological characterization of isolates
GS2
Figure 6 % Growth inhibition of fungal isolates on
various media
Figure 7 Growth of fungal isolates at various pH
Figure 8 Growth of fungal isolates at various
temperatures
Figure 9 Effect of mencozeb on growth of GS 1 and
GS 2
Figure 10 Effect of Glyphosate on growth of GS1 and
GS2
Figure 11 Effect of Methsulfuryl methyl on growth of
GS1 and GS2
Figure 12 Effect of Ethion on growth of isolates
Figure 13 Effect of prophenofos on growth of GS1 and
GS2
Figure 14 DNA bands observed under UV
transilluminator
Figure 15 Amplified 18s RNA gene with 1Kb ladder
Figure 16 Amplified Serine Protease gene with 1kb
ledder on 1% agarose gel
Figure 17 Neighbour-joining tree based on 18s rRNa
gene sequence using MEGA5.1
Figure 18 Neighbour joining tree of Serine Protease
gene using CLCv4.9
Figure 19 Pairwise alignment of Serine Protease gene
using ClustalW in CLC4.9

LIST OF TABLES
Table 1 Reaction mixture
Table 2 Primer sequence for 18s rRNA
Table 3 PCR cycling condition for 18s rRNA
Table 4 Primer sequence for Serine Protease
Table 5 PCR cycling condition for Serine Protease
gene
ABBREVIATIONS
% Per cent
bp Base pair
ºC Centigrade/Degree celcius
CMA Corn Meal Agar
PDA Potato Dextrose Broth
DNA Deoxyribonucleic acid
DNTPs Dinucleotide(s) troposphere
EDTA Ethylenediaminetetraacetic acid
et al. et alit
EtBr Ethidium Bromide
Fig Figure
BCAs Biological control agents
Gms Grams
RKN Root knot nematode
i.e. id est. ( that is )
l Liter
M Molar

Min Minute
ml Milliliter
mM Milimolar
PCR Polymerase chain reaction
PPM Parts Per Million
psi Per square inch
Rpm Revolution per minute
SDS Sodium Dodecyl Sulfate
Sec. Seconds
Sp. Species
STD Standard
TBE Tris Borate EDTA
TE Tris EDTA
g Micro gram
l Micro liter

Introduction & Review of Literature
1. INTRODUCTION & REVIEW OF LITERATURE
There is increasing interest in the exploitation of fungi for the control of invertebrate
pests, weeds and diseases, as evidenced by the number of commercial products available
and under development. Fungal biological control is an exciting and rapidly developing
research area with implications for plant productivity, animal and human health and food
production. This area includes a number of important disciplines, such as pathology,
ecology, genetics, physiology, mass production, formulation and application strategies.
The research, development and final commercialization of fungal biological control
agents (BCAs) continue to confront a number of obstacles, ranging from elucidating
important basic biological knowledge to socio-economic factors. Considerable advances
have been made in separate areas (Butt et al, 1998; Butt and Copping, 2000; Butt and
Goettel, 2000 and Butt et al, 2001).
There is considerable interest in the exploitation of naturally occurring organisms, such as
bacteria, viruses and fungi, for the control of crop pests, weeds and diseases. It is
generally recognized that some chemical pesticides contaminate groundwater and enter
food-chains that have an impact on a wide range of organisms. Furthermore, pesticides
can pose hazards to animal health and to the user spraying the chemical. Consumer
perceptions worldwide are that chemical usage in agricultural production needs to be
significantly reduced. In order to satisfy this demand, biological control strategies,
especially for the growing organic market, are urgently required. Unfortunately, there is
relatively little investment in the research and development of microorganisms compared
with that spent on the discovery of chemical pesticides (Whipps and Lumsden,1989). Two
reasons for this are that BCAs usually have a narrow host range and often give
inconsistent and poor control in field trials.
One major factor to consider is the market potential of BCAs. Currently, only specialized,
niche markets exist. Their full potential has not been realized because of the following:
a) Absence of strong incentives to develop these agents and/or discourage
chemical Pesticides.
b) Availability of new, biodegradable chemical pesticides.
c) Absence or breakdown of the infrastructure, which facilitates transfer of new
technologies
d) And research knowledge to the end-user (i.e. grower).

e) Absence of a universally acceptable registration procedure.
f) Restrictions in the use of exotic BCAs.
g) Lack of robust and reliable field effects.
h) Very few growers or extension workers know how to use BCAs.
Agricultural practice is changing as a result of demands to reduce the use of chemical
pesticides, including fungicides, and to provide abundant feed, food and fibre using
environmentally friendly, sustainable systems. IPM is defined as a systems approach to
pest management that combines multiple crop production practices with careful
monitoring of pests (including plant pathogens) and their natural enemies (such as fungal
antagonists). IPM as it relates to plant pathology is reviewed by Jacobsen, 1997. The
concept of IPM was first introduced in relation to insect pest control through integrating
the use of pesticides and biological control organisms. This is particularly important as
often the current need to resort the chemical treatment for disease control disrupts. One
strategy of IPM is to develop fungal BCAs with tolerance to fungicides or to incorporate
fungicide resistance into antagonists (Locke et al, 1985; Locke and Lumsden, 1989;
O’Neill et al, 1996).
With keep this concept in mind we have made an effort to study the effect of some widely
used pesticides on our nematophagous fungal isolates. Nematophagous fungi are natural
antagonist of nematodes and control nematode populations. Before going to this we have
to understand some of the concepts of ecology, pathology, infection strategies, how they
affect agriculture and livestock production, control measurements of plant and animal
parasitic nematodes. Further it is also important to understand some key concepts of
nematophagous fungi i.e. type, how they kills nematodes etc.
1.1 Nematode infection in plants and animals
In the field of agriculture the demand of new varieties of crops are increasing as per the
need of growing population. Along with that it is now become much more difficult to
manage the yielding varieties in presence of various insects and other microorganisms.
Nematodes are roundworms that belong to the phylum Nematoda. They are the most
abundant creatures on earth, occupying different ecological niches and living as parasites
of humans, animals and plants. Parasitic nematodes can cause a large-scale multiplication
and invasion of their hosts (Olsen, 2000). In modern era different types of pesticides are
used as per the requirement but most of them are unaffected on pests now, as pests

become resistance towards the chemical pesticides. These issues have increased
awareness of soil ecology and the importance of maintaining soil health is become crucial
now.
Pesticides cover other host specific chemicals like fungicide, insecticide and herbicides.
They have the beneficial effect on their targets. But due to the changes in environmental
conditions and increased resistivity of the insects these pesticides are less worth to use.
Other than that these pesticides are sometimes harmful for non-targeted crops and it leads
to unwanted reactions, which can change the originality of crop and its repeated
application of pesticides causes loss of biodiversity (Ellis & Rhodes, 2008). Else most
pesticides are not degradable and they can produce toxic compounds in soil which can
change the soil texture, lead to water pollution and can influence the human health
(Kiontke & Fitch, 2013).
1.1.1 Plant parasitic nematodes
Nematodes are microscopic organisms ranging in size from 0.25 mm to 3.0 mm long and
they are generally cylindrical in shape, whitish, transparent and non-segmented (lambert
& Bekal, 2002). Each year nematodes causes billion dollars of crop loss. They are highly
capable to survive in any environment. They are mainly known as plant parasitic
nematodes as they infect tones of plant every year and counting of numerous amount of
damage is uncountable. It is important to gain information about nematode identifications
to agriculture, the nematode problems and diseases on major crops, its symptoms and
diagnosis, identification of new and potentially harmful species of nematodes for the
success of agriculture and aids in the development and evaluation of qualitative or
regulatory procedures to minimize their spread, to obtain action against them and to know
the activity of nematode (Zafar, 1998).
Phytoparasitic nematodes can devastate several economically important crops, causing
significant losses in yield. These nematodes are obligate parasites, and they have
developed different parasitic strategies and relationships with their hosts to attain enough
nutrients for development and reproduction. The groups of phytoparasitic nematodes that
have great economical importance are the sedentary endoparasites, which include the
genera Heterodera and Globodera (cyst nematodes) and Meloidogyne, or RKN.
They live inside plants and they feed on all parts of the plant, including roots, stems,
leaves, flowers and seeds. Like they move between soil particles, between folded leaves
of plant buds, in air spaces of leaves and stems or in plan tissues themselves. Nematode

infection till now observed in several of plants and they act specifically according to the
plant size and plant age like soyabean cyst nematodes, corn parasitic nematodes, sugar-
beet cyst nematodes, potato cyst nematodes, tomato root-knot nematode and etc.
Nematodes can form problems as they can act like (1) vectors (e.g. for several viruses),
(2) wounding agents, (3) host modifiers, and (4) resistance breakers. Nematode infection
varies according plant species and their ages (Al, 2008). To develop soil ecosystem
management strategies to protect it against the damage caused by plant-parasitic
nematodes, ultimately leading to improvements in plant health and its become major
concern to find the solutions against its resistivity towards chemicals to save plant and
animal flora (Wang & McSorley, 2005 & Al, 2008)
The root feeding nematodes act on plant by 3 ways:
1. Endoparasites- feed from inside
2. Ectoparasites- feed from outside
3. Semi-endoparasitic- feed by partially inserting their anterior part into plant
(Niblack., 2005)
Most species of plant parasitic nematodes have a relatively simple life cycle. Nematodes
develop from eggs through four juvenile stages to adults and molt consisting of the egg,
four larval stages, and the adult male and female. Female nematodes produce eggs that
hatch into young nematodes called juveniles. If females and males are both present, they
mate and produce eggs. Females can produce from as many as a few to 500 or more eggs
depending on the species. Motile adults move in a wavelike motion in the soil searching
for suitable host plant roots on which to feed. Ectoparasitic nematodes feed during all life
stages once they hatch from the egg. In about half of the species, adults mate and females
lay fertilized eggs. They typically complete their life cycles in 30-60 days, however, some
adults may survive for or two year (Noling.,1999 and Ectoparasitic & Of, 1997).

http://www.sardi.sa.gov.au/pestsdiseases/plant_soil_health/nematology/nematodes_in_so
uth_australia
Figure 1: Plant parasitic nematode life cycle
1.1.2 Animal parasitic nematodes
Nematodes are as harmful for animals as it is for plants. Livestock industry worldwide is
severely affected by a number of infectious diseases caused by parasites mainly by
parasitic nematodes (Eysker and Ploeger, 2000). They are considered to be one of the
most economically harmful groups of parasites affecting the animal productivity around
the world. The most frequent one is gastrointestinal parasitic nematodes. In this group of
parasites the nematodes have a remarkable status as the main pathogens causing severe
damage to their hosts. The main parasites that affects small ruminants includes
Strongyloides papillosus, Haemonchus contortus, Muellerius capillaries, Nematodirus sp.
Trichostrongylus sp., Ostertagia sp. etc. Among these Haemonchus contortus which
cause Haemonchosis is probably the most important constraint to small ruminant
production on both commercial farms and resource-poor production systems (Waruiru et
al., 1993 and Amarante et al., 2009).

Nematodes belonging to the group of trichostrongylids is also a major concern because its
blood-sucking feeding habits cause anemia that can be so severe resulting in the death of
the animal. This group of parasites is widespread in almost all tropical and sub-tropical
countries and they are responsible for deteriorating animal health and productivity.
(Gives, Eugenia, & Arellano, 2010). The principal gastrointestinal nematodes infects and
affects small ruminants (sheep and goats). The life cycles of these nematodes follow a
similar pattern. Sexually dimorphic adults are present in the digestive tract, where
fertilized females produce large numbers of eggs that are passed in the feces. Strongly lid
eggs usually hatch within 1–2 days.
(Florian Roeber et al 2013)
Figure 2: Animal parasitic nematode life cycle
The severity of disease is mainly influenced by factors such as the parasite species
present, the number of worms present in the gastrointestinal tract, the general health and
immunological state of the host, and environmental factors, such as climate and pasture
type, stress, stocking rate, management and/or diet.
1.2 Harmful effects of parasitic nematodes on crop yield and live stock production
Parasitic nematode causes great damage to crops and live stock, in both the cases it
ultimately affects the productivity. For the control plant nematodes chemicals are used,
similarly in case of animals anihelmanthic drugs are used. Both of them have drawback
that is their residual effect and nematodes getting resistant. Due to the residual effect it
may cause damage to other lives. Similarly when the antihelmanthic drug are used in case

of animals the nematodes get resistant to the dosage of drugs used. So, the dosage of the
drug is required to be increased. This may lead to the increase in the level of drug in the
bovine milk sample.
1.2.1 Loss of agriculture due to parasitic nematodes
Nematode infection is now major concern in all over the world and major issue to discuss
about is to how to save crop losses which occurs due to nematode infection. Crop-loss
due to phytoparasitic nematodes for selected crops on a worldwide basis were estimated
reported in 1987. Michigan and North Carolina maintained comprehensive estimates of
crop losses in response to nematodes. Progress has been made in determining damage
functions, conducting surveys on the distribution of plant-parasitic nematodes, and
developing the methodology for obtaining loss estimates (Duncan and Noling, 1998 and
Koenning et al, 1999) Estimates on potential and actual losses despite the current crop
protection practices are there for wheat, rice, maize, potatoes, soybeans, and cotton for
the period 2001–03 on a regional basis (19 regions) as well as for the global total. Among
crops, the total global potential loss due to pests varied from about 50% in wheat to more
than 80% in cotton production. The responses are estimated as losses of 26–29% for
soybean, wheat and cotton, and 31, 37 and 40% for maize, rice and potatoes, respectively
(Oerke, 2005).
Typical symptoms of nematode injury can involve both above ground and below ground
plant parts. They secrete enzymes into individual root cells, and ingest the partially
digested cell contents. Primary symptoms of nematode infection of roots generally
involve premature wilting, leaf yellowing, nutrient deficiency and drought are visible
damage by nematodes, roots may appear discolored. A gradual decline in yield over a
period of years often indicates a nematode problem.
In plant parasitic root- knot nematodes second-stage juveniles hatch from eggs, move
through the soil and invade roots near the tips. These juveniles affect the plant cell
differentiations and form giant cell formation, after that nematodes can feed on that giant
cells (W.S.Cranshaw 2013)
The presence of nematodes in the root stimulates the surrounding tissues to enlarge and
produce the galls which are the typical symptom of infection by root knot nematode.
Galling restricts root volume and hinders the normal translocation of water and nutrients

within the plant, so that plants exhibit above-ground symptoms of stunting, wilting and
chlorosis.
There are numerous diseases occurring by nematodes and they produce specific
symptoms which studied by scientist, helpful to identify it as nematode infection. There
are specific root knot disease, potato crop disease, foliar nematode disease, lesion
nematode disease.
∑ Lesion nematode infection- The head of the nematode can be recognized by the
presence of a short, dark spear with basal knobs (the "stylet"), helps in penetrating
plant tissues. Lesion nematodes penetrate plant roots completely and migrate
throughout the root tissue, mainly the cortex, as they feed. They can penetrate
anywhere along the roots, but they show some preference for the region near the
start of the root hair zone. They penetrate the root epidermis either intra- or
intercellularly, but once inside, they migrate intracellularly. The nematodes feed
on cells within the root, usually until the cells lyses and cavities are formed, and
then the nematodes move forward within the root to feed on healthy plant cells.
Lesion nematodes produce characteristic necrotic lesions (darkened areas of dead
tissue) on the surface and throughout the cortex of infected roots. The lesions turn
from reddish-brown to black and are initially spotty along the root surface. As the
nematodes continue to migrate and feed within the roots, the lesions can coalesce
to become large necrotic areas of tissue that may eventually girdle the root. Severe
damage from high populations of lesion nematodes can result in a stunted and
necrotic plant root system (Davis & MacGuidwin, 2000).
∑ Root-knot disease- Nematodes of the genus Meloidogyne are also known as
RKN, because they develop knots in the roots of infected plants during their
parasitic life-cycle. They infect some other staple crops, such as cereals (rice,
maize, soybean, banana, plantains, sweet potato, yam), as well as to industrial
crops, such as tobacco, coffee, sugar cane, sugar beet, cotton, and black pepper.
Economic losses have also been reported in fruit crops, such as guava, pineapple,
papaya, and grapes (Lamberti, 1997). Root-knot nematodes were first reported in
1855 by Berkeley, who observed them causing damage on cucumbers (Kiontke &
Fitch, 2013) As a result of nematode feeding, large galls or "knots" can form
8

throughout the root system of infected plants. Severe infections result in reduced
yields. The degree of root galling generally depends on four factors like nematode
population density, species type, race and host plant species. As the density of
nematodes increases in a particular field, the number of galls per plant also will
increase. Large numbers of nematodes penetrating roots in close proximity also
will result in larger galls. Each crop responds differently to root-knot nematode
infection. Most root-knot nematodes have a very wide host range. While the most
diagnostic root-knot nematode damage occurs below ground, numerous symptoms
can also be observed above ground. Severely affected plants will often wilt
readily. Plants also may exhibit nutrient deficiency symptoms because of their
reduced ability to absorb and transport nutrients from the soil. Stunting is
frequently observed on host crops grown in root-knot nematode-infested fields,
and crop yields are reduced. At high densities, root-knot nematodes can actually
kill host plants (Mitkkowski, 2011).
∑ Potato crop disease- Occur by potato cyst nematodes. Nematode infection on a
potato crop results in tuber yield decline and/or reduction in quality, thereby
contributing economic loss to the industry. They live on the roots of plants of the
Solanaceae family, such as potatoes and tomatoes. The estimates for actual losses
due to nematodes are 11%. Nematode then invades the tips of the root and
establishes a feeding site. Both susceptible and resistant potato varieties will
suffer from major problems at low and medium population densities. Symptoms
are deficient growth, stunting, yellowing, and early senescence. (Lima, 1996.,
Oerke, 2005., & Department of Environment, 1999.)
∑ Foliar nematode disease- The foliar nematodes, also known as bud and leaf
nematodes, attack plant parts that are above ground. The symptoms foliar
nematodes cause are often diagnostic. The nematodes penetrate through open
stomata and feed on the spongy mesophyll tissue inside the leaf. They cannot
penetrate between cells that are packed tightly together and are thus restricted to
areas in the leaf that are demarcated by main leaf veins. As the nematodes feed
and reproduce inside leaf tissues, these areas begin to turn pale green, yellow, and
eventually brown (Nematode & Of, 2000). Foliar nematodes are microscopic
9

roundworms that live in leaf tissue and cause significant injury to many
ornamental plants (Hartman, 1993).
It is clear that nematode infection can be a serious threat to the producer. Nematodes can
vector many plant viruses or create wounds that allow the entry of other root pathogens.
There are multiple ways to handle these insects most of them are also gives the negative
effects over killing it. There are certain ways like crop rotation, fumigation, sanitation,
increase the resistivity of plants, infected root destruction and much more but they come
out with many disadvantages and there are no countable results in crop improvement so,
many biological ways are used from which one of the method is to use Nematophagous
fungi. Nematophagous fungi is the type of a fungi which prey on nematodes with
specialized structure and effective predatory mechanism.
1.2.2 Effect on live stock production
This growing demand for livestock products offers an opportunity to the 675 million rural
poor who depend on livestock to improve their livelihoods. Globally, parasitic and other
endemic diseases continue to be a major constraint on profitable livestock production.
Parasitic nematodes cause serious infections in small ruminants and, as one of the greatest
causes for loss of productivity plus compromised welfare in grazing ruminants throughout
the world, constitute a serious problem for small ruminant livestock producers (Perry &
Randolph 1999). Beside the direct losses due to drop in production and deaths of animals,
most of the economic losses are due to sub-clinical effects and although not immediately
noticed by the owner, these can be substantial. Lanusse and Prichard (1993) estimated
that worldwide 1.7 billion US$ is spent annually to combat helminth parasites in cattle.
The systematic use of relatively inexpensive pesticide agents that are effective and easy to
apply has made it possible to control pests which affect wide range of production systems
but at the same time worrying, because of the possibilities of developing parasite
resistance, creating ecological imbalances and leaving residues in food. In developing
countries a sustainable and economically viable program to combat parasitic diseases in
general and resistance in particular, has become ever more crucial. Parasitic nematodes
(roundworms) of small ruminants and other livestock have major economic impacts
worldwide. Despite the impact of the diseases caused by these nematodes and the
discovery of new therapeutic agents (anthelmintics), there has been relatively limited
progress in the development of practical molecular tools to study the epidemiology of

these nematodes. Parasites of livestock cause diseases of major socio-economic
importance worldwide. The current financial and agriculture losses caused by parasites
have a substantial impact on farm profitability (Animal & Paper., 2002). Nematodes
mostly effect to pigs, sheeps, cattles and goats.
Sheep- Infection is normal in sheep and the number of nematodes found in individual
animals varies with essentially all animals having some nematodes. Most infections result
in minimal damage unless conditions change that alter the ability of the host to maintain
control, and then damage can become more severe, possibly leading to death depending
on the nematode species present (Miller & Horohov, 2006) sheep gazing rotation or other
grazing management strategies are used to control infections (Kelly., & Kahn, 2010)
Pig- . Internal parasites can kill, but loss of appetite, reduced daily rate of gain, poor
feed conversion, and increased susceptibility to other pathogens are the more common
results of parasitism observed on pigs (Lee & Coordinator, 2012)
Goats- The life cycle includes small ruminants as definitive hosts and numerous
terrestrial snails as intermediate hosts. Infected sheep and goats shed first-stage larvae
with their faeces and once within the intermediate host will grow and develop into second
and then third-stage larvae ,which are in turn infective for the definitive hosts. Infection
of small ruminants occurs through ingestion of infected snails or just by eating released
larvae with grass.(Paraud, & Chartier, 2005)
Cattle- Nematodes have severe effect on cattle as it has on sheep it has come from
gazing all over. Nematodes strike on cattle and infect its intestine which leads to failing in
eating and increase mortality (Kloosterman et al., 1992 and Stromberg; Waruiru et
al.,1998 and Averbeck,1999).
1.3 Control strategies for nematodes
1.3.1 For plants parasitic nematodes
Since 1950, the control of phytoparasitic nematodes has been based on chemical
pesticides, although several of them are being withdrawn from the market due to issues
related to the environment and public health. Methyl bromide was widely used against
nematodes, but now it has been withdrawn from the market because of its adverse effects
on the ozone layer. Nematodes also developed resistance against most of the known

pesticides, and this triggered worldwide research for new alternative agents and methods
for nematode control (Fernandez et al., 2001).
(1) Crop rotation
This is an important method for maintenance and improvement of soil fertility, and for
enhancing yield. In crop rotation, various crops are followed in a certain order in the same
soil. Crop rotation is used to starve nematodes by growing crops on which they cannot
feed and/or reproduce. Rotation programs have an advantage like the treatment can
provide some income, depending on the value of the rotational crop (Crow & Dunn,
2012) and (Nyczepir., 2008.)
(2) Chemical Controls
The goal is to protect plants early in the growing season allowing them to produce deep,
healthy root systems.
ÿ
Fumigants. These are non-selective materials that vaporize when applied in the
soil. As gases, they move up through air spaces in the soil, killing nematodes and
other microorganisms. After applying most fumigants, a waiting period is required
before planting.
ÿ
Non-fumigants. These are available in liquid or granular forms. They are applied
either in a band or in the seed furrow at planting. These materials move down
through the soil killing nematodes directly, or by interfering with feeding and
reproduction.
ÿ
Seed treatments
These are the products applied to the seed coat. They may kill nematodes directly
or interfere with feeding and reproduction. It seems to be the popular method due
to ease of application.
(3) Use of resistant plants
Plants are resistant to nematodes when they have a reduced level of reproduction.
Nematode resistance genes are present in several crops, and are an important
component of various multiplication programs in tomatoes, potatoes, cotton,
soybean, and cereals. Resistance to nematodes can be either broad with action
against several species of nematodes or narrow against only selected specific
biotypes (Williamson and Hussey, 1996).

(4) Use of Biological agents
These are living organism that interferes with growth and reproduction of some species of
nematodes. Many fungi and bacteria are natural antagonist of nematodes and suppresses
nematode population. And Nematophagous is one of the known biological control agents
which kills nematodes efficiently (Stirling et al., 1991; Weibelzahl-Fulton et al. 1996;
Whipps, 1997; Alabouvette, 1999; Westphal and Becker 2001; Waller et al., 2002;
Mazzola, 2007 and Noel et al. 2010 ).
1.3.2 Control strategies for animals parasitic nematodes
(1) Rotational grazing
In rotational grazing systems the area is divided into a series of fields or paddocks
which are grazed in sequence (Hcc, 2011).
(2) Vaccination
Alternative check up and vaccination at the primary stage of disease is necessary
(3) Increase the host resistivity
By genetic manipulation and by using drug, resistivity of the animals can be
increased.
(4) Biological treatment
Using nematophagous fungi.
1.4 Biocontrol of nematodes
An eco-friendly pest management strategy draws the attention and it deliberately
introduced to kill natural enemies and to lower the population level of a target pest
(Delfosse, 2005). These enemies are commonly referred to as BCAs, which must
demonstrate some characteristics for success in the field, including ability for rapid
colonization of the soil, persistence, virulence, predictable control below economic
threshold, easy production and application, good viability under storage, low cost of
production, compatibility with agrochemicals, and safety (Kerry, 2000). In nature, it
is observed that many natural enemies, such as viruses, bacteria, fungi, and others,
can attack plant parasitic nematodes, but in the search for suitable BCAs more
attention has been given to fungi and bacteria. Biological control can be either
natural (i.e., when a natural population of a particular organism inhibits the growth
and development of nematodes), or induced (i.e., when BCAs have been introduced

artificially). There are two approaches for introduction: microbial pesticide application
for rapid control of a pest, and the introduction or mass release of a biocontrol agent to
provide long lasting control. The suppression can be specific or non specific, when only
one or two organisms are involved (Davies, 1991; Akhtar and Malik, 2000). Nematode
can be controlled by various biocontrol agents. This method is safe in comparison to
using chemical methods, as biocontrol agents are target specific and they does not
contain any harmful effects over plants and animals. Biocontrol agents are directly
applied on the host. Bacterial and fungal species can grow well over the nematodes, as
nematodes work as a nutrient source for them.
(1) Bacterial parasites- Bacterial insecticides have been found useful in controlling
nematodes. Researchers have made several attempts to utilize bacteria for
nematode control. Nematicidal bacteria are of two types: nematode parasites and
rhizobacteria. The most studied bacteria are Pasteuria penetrans, an obligate
endoparasite of Meloidogyne, followed by strains of Pseudomonas (Payne, 1992;
Dabier et.al, 2001; Ali et al, 2002 and Siddiqui and Shaukat, 2003). The infective
stage was initiated by attachment of endospores to the surface of a bacterial
larva. A germ tube then penetrated the nematode cuticle and filamentous
microcolonies of the bacterium formed in the pseudocoelum (Sayre, 1986).
(2) Fungal parasites of nematodes- Parasitic fungi are members of the kingdom
fungi, which thrive by latching on to other organisms and taking nutrients from
them. They are a type of symbiotic fungi, but they are not mutualistic because
they do not tend to give anything of value back to their host in return for
sustenance. The effective natural control of specific nematode pests in intensive
agricultural systems has been well documented and the causal microbial parasites
and pathogens have often been identified (Kerry, 1987; Dickson et al., 1994).
Fungi can be separated into distinct groups, based on how they interact with their
hosts. One group of natural enemies of nematodes are nematophagous fungi.
Fungal parasites act effectively, their effects are easily visible and they can be
easily cultured. Currently, over 200 or more fungal species have been identified
which attack or have been associated with egg, adult stages or larvae of
nematodes. There are thousands of species of fungi that are parasitic, and some
have adapted to be extremely specialized (Sayre, 1986).

1.5 Nematophagous fungi as biocontrol of nematodes
One of the most recommended idea to control nematodes in biological way, without
harming other non-targeted host is to use nematophagous fungi. Nematophagous fungi
are carnivorous fungi that have developed methods and structures that enable them to
successfully trap and consume prey nematodes. They are mainly known as natural
enemies of nematodes. These groups of fungi are responsible for keeping the nematode
population in check and are an important part of the subsoil ecosystem. These fungi
contain the potential biocontrol agents against plant- and animal-parasitic nematodes.
They have unique ability to kill the nematodes either by attack and feed on living
nematodes by their specialized structure or their eggs
The nematophagous fungi are found in all major taxonomic groups of fungi, and they
occur in all sorts of soil environments. They comprise more than 200 species of
taxonomically diverse fungi including lower and higher fungi. They are commonly found
in soils and decaying leaf litter, decaying wood, dung, compost and mosses. When grown
in soils, nematode-trapping fungi can grow as saprophytes as mycelium. The nematode-
trapping fungi develop special mycelial structures in the form of traps in response to the
presence of nematodes in the soil. Several species of microfungi are able to trap and kill
the developing larval stages of parasitic nematodes in a fecal environment. After passing
through the intestine, spores of this fungus germinate in feces, forming specialized, three-
dimentional networks that trap the parasite larvae (Larsen et al., 1997). Research on
cattle, horses, pigs, and sheep has demonstrated the potential of this organism as a
biological control agent against the free-living stages of parasitic nematodes in livestock
under both experimental and natural conditions. (Handrawathania, & Arsend., 2002
Roeber, & Gasser, 2013).
Nematophagous fungi present a high diversity not only in respect of taxonomic
distribution but also in respect of the trapping structures formed (Niblack, 2005.) These
fungi more useful in killing nematodes than chemical method as adding fungi to the host
does not arises any environmental impact, else nematodes become more resistance
towards chemical substances. Else low toxicity to humans and wildlife, low residues in
food, genetic stability and compatibility with integrated pest management are also the
major advantages of using nematophagous fungi.

The mechanisms behind the capture process, including attraction, adhesion, penetration
and digestion of nematodes. The ability to capture nematodes is connected with a specific
developmental phase of the fungal mycelium. The type of nematode-trapping structures
formed depends on species or even strains of species as well as on environmental
conditions, both biotic and abiotic conditions. The most important biotic factor is living
nematodes, which not only induce the formation of trapping structures by interacting with
fungi but also serve as a food source for the fungi after they have been invaded by the
fungi.
(Koon-hui wang et.al., 2013) (Davis, E.L. and A.E. MacGuidwin. 2000)
Figure 3: Trapping structure of nematodes by nematophagous fungi
Nematophagous fungi comprise three main groups:
1. The nematode trapping fungi
2. The endoparasitic fungi-that attack nematodes by using specialized structures, and
3. The egg- and cyst-parasitic fungi-that attack various life stages of nematodes with
their specialized structures.(Niblack,.2001., Tholander, 2007., Philip, 2002).
1.5.1 Nematode trapping fungi
The nematode-trapping fungi are the best known group among the nematophagous fungi
probably due to their remarkable morphological adaptations and their effective infection
of nematodes. They enter into the parasitic stage of nematodes by developing special
hyphal structures called traps, such as nets, knobs, branches or rings, in which nematodes
are captured mechanically or by adhesion. The killed nematodes provide the fungi with
an additional nutrient source that is rich in nitrogen. Other method used by fungi to trap
nematodes is the fungal ring. The fungus produces hyphae that end in an open

constricting loop. When a nematode swims through this loop, the loop suddenly fills with
water. This sudden change in the physiology of the loop causes the diameter of the inside
of the loop to narrow and in turn constricts around the nematode. Within 24 hours,
hyphae form from within the loop and penetrate the nematode as it begins to digest it. The
fungus creates such structures in order to trap the nematode within the structure.Examples
of this group are Arthrobotrys spp., such as A. oligospora, A. conoides, A. musiformis and
A. superba, which all form three-dimensional adhesive nets, whereas A. dactyloides uses
constricting rings to capture nematodes mechanically by the swelling of the ring cells.
Adhesive branches and adhesive knobs appear in the genus Monacrosporium. M.
haptotylum (Dactylaria candida) produces both adhesive knobs and no constricting rings.
(Nordbring-hertz, 2001).
1.5.2 The endoparasitic fungi
The endoparasitic fungi are often obligate parasites and are dependent on nematodes for
their survival. They infect nematodes with adhesive or non-adhesive spores which are
swallowed by the nematode or adhere to the nematode surface fungi develop an adhesive
bud on their conidia with which they infect the nematode. Fungi produce spores with
special shapes, which are ingested by the nematodes. Because of their shapes, the spores
get stuck in the nematodes and from there initiate infection of the nematodes. Examples
of this group are D. coniospora , H. rhossoliensis and C. anguillulae are the examples of
endoparasitic nematodes (Nordbring-hertz, 2001).
1.5.3 The egg and cyst parasitic fungi
Egg and cyst parasitic fungi that parasitize these non-motile stages of nematodes with
their hyphal tips. Hyphae of fungi grow towards the eggs and hyphal tips penetrate the
eggshell. The fungi then digest the contents of the egg and by this way they kill the
insects. Several fungi are capable of penetrating nematode eggs. The fungus Dactylella
oviparasitica grows rapidly through egg-masses of the root-knot nematode Meloidogwe
sp. and hyphae of the fungus penetrate egg-shells (Stirling & Mankau, 1979). Fungal egg-
parasites, isolated from eggs of the cyst nematode Heterodera avenae, were investigated
with respect to their ability to infect cyst nematode eggs of H. scbachtii by Dackman e t
al. (1989). Another widely studied egg parasitic fungi is Paecilomyces Lilacinus (Jatale et
al., 1980; Cabanillas and Barke, 1989; Gaspard et al., 1990; Siddiqui Mahmood, 1994;
Ciarmela et al., 2005 ; Kiewnick and Sikora, 2006; Anastasiadis et al., 2008; Carvalho et
al., 2010 and Sun et al., 2011).

Thus, the relationship of Nematophagous fungi to nematodes is also beneficial to it in two
way; first, nematodes may induce the formation of the structures in which they are later
captured (help in structural growth) and, second after invasion of the nematodes by the
fungus they serve as an additional food source to fungi. Many of the fungi do not form
traps spontaneously but the fungi are dependent on environmental conditions, especially
the presence of nematodes for induction of traps. There are evidences which suggest that
nematophagous fungi had to adapt this kind of parasitic habit of nematode killing due to
the nitrogen limiting habitat, which is more or less required for fungi growth. In such
crisis nematophagous fungi start attracted towards nematodes as they are rich of nitrogen
sources. Plant parasitic nematodes have shown that the level of fungal parasitism is
dependent on the nematode density. Most of all the fungi can be used for the control of
plant parasitic nematodes which global pests in agriculture and horticulture, causing
severe yield losses as nematodes widely attack on plants, mainly on plant roots for their
nutrient requirement. Therefore, the ability of the nematophagous fungi to grow in the
rhizosphere is of great importance for their capacity to control these nematodes.
Nematophagous fungi have the capacity to colonize plant roots (Monfort et al., 2005).
1.6 Nematode fungus interaction mechanism
Nematophagous fungi-nematode interactions provide excellent model system for
interaction study. (Nordbring-hertz, 2001., Tholander, 2007, &Al, 2008). There is cell -
cell interactions observed between the fungus and nematodes includes multiple steps that
could cause the final biochemical, physiological or morphological response. Nematodes
are attracted by compounds released from the mycelium and traps of nematode-trapping
fungi, and the spores of endoparasites. Both the morphology and consequently the
saprophytic/parasitic ability strongly influence the attractiveness of the fungi. After
contact, fungal nets are surrounded by a layer of extracellular fibrils. These fibrils
facilitate the anchoring and further fungal invasion of the nematode. The adhesion of the
traps to the nematode results in a differentiation of the fungi. A penetration tube forms
and pierces the nematode cuticle. After that the nematode is digested by the infecting
fungus. Fungus form a ring like structure. When a nematode moves into the ring, it
triggers a response such that the ring rapidly swell inward and close around the nematode.
1.6.1 Recognition and host specificity
(Nordbring-hertz, 2001)

The question of how nematophagous fungi recognize them is interesting part of study to
know nematode-fungus interaction. There are recognition events in the cell–cell
communication at several steps of the interaction between fungus and nematode, which
can produce a defined biochemical, physiological or morphological response. Nematodes
are attracted to the mycelia of the fungi in which they may induce trap formation and they
are attracted even more to fully developed traps and spores. This is followed by contact
communication or say adhesion. This step may involve an interaction between a
carbohydrate-binding protein in the fungus and a carbohydrate receptor on the nematode.
Recognition of the host is probably also important for the subsequent steps of the
infection, including penetration of the nematode cuticle (Swe et al., 2011)
1.6.2Attraction
Nematodes are attracted by compounds released from the mycelium and traps of
nematode-trapping fungi, and the spores of endoparasites. The structure and consequently
the parasitic ability strongly influence the attractiveness of the fungi. Fungi that are more
parasitic appear to have a stronger attraction than the other ones.
1.6.3 Adhesion
Nets are surrounded by a layer of extracellular fibrils even before the interaction with the
nematodes. After contact, these fibrils become directed perpendicularly to the host
surface, probably to facilitate the anchoring and further fungal invasion of the nematode.
The endoparasites show a completely different type of adhesive that seems to be
composed of fibrils. Spore adheres to the head of the nematode, thereby blocking
nematode attraction.
1.6.4 Penetration
The adhesion of the traps to the nematode results in a differentiation of the fungi. A
penetration tube forms and pierces the nematode cuticle. This step probably involves both
the activity of enzymes solubilizing compounds of the cuticle and the activity of a
mechanical pressure generated by the penetrating growing fungus. The nematode cuticle
is composed mainly of proteins including collagen, and several proteases have been
isolated from nematophagous fungi that can hydrolyse proteins of the cuticle. Following
penetration, the nematode is digested by the infecting fungus. Fungal ultrastructure
become change and the dense bodies are degraded in the trap cells and in that. The trap

structure typically contain normal cell organelles, helps in storage of nutrients obtained
from the infected nematode ad it support the growth of the fungus.
Thus, by this specialized mechanism of trapping of nematodes, Nematophagous fungi helps
to improve the plant health in efficient way. By applying various pesticides on insects along
with Nematophagous fungi may increase the activity of fungi to work better.
1.7 Non targeted effects of pesticides
1.7.1 Pesticides & environmental effects.
Pesticides are meant to kill the pests. They are purposely applied on field to suppress the
activity of pests. Pesticides contain sub specific compounds like fungicide; herbicide and
insecticide, each of them are specified for a perticulae pest. Pesticides have both
advantages and disadvantages but it is used from long old times and for farmer it becomes
necessity to fight against it. Increased demand for food and verity has lead to the
chemicalization of agriculture and we have reached on such a stage that modern
agriculture depends on high yielding varieties, which can only be grown under the
presence of pesticides as they are not susceptible to sustain against the pests. Majority of
these pesticides are beneficial when used for specific purpose, handled properly and
applied in proper amount. These modernization and industrialization act of human has
added pollution to the environment and it is a threat for ecology and life. Many pesticides
have the potential to harm non-target organisms, especially if the organisms are exposed
to high levels or for a long period of time (Breen, & Patterson, 1974). Pesticides form
negative impact after long duration of its usage. It causes changes in soil microbial genes
which lead to change in activity of microbes. They start doing breakdown of organic
matter, influence nutrient cycling and increase the resistivity towards pesticides.
(Sciences,. 2004) Pesticides affect the structure of ecosystem as when they applied to
ground they contaminate soil, air and water systems, which is harmful for healthy crop
yield. Organism develop tolerance to chemicals by frequent application of pesticides as
genetic adaptation, regulation at the rate at which chemical is taken up, excrete toxic
product in response of chemicals and many more. The levels of pesticides are found much
higher than expected level because of heavy contamination of environment. Nematodes
have broad range of activity which can change the natural soil flora and fauna. It is
studied that because of the all day use of pesticides in farms, required beneficial
microorganisms get reduced. Bacterial genera and species get decreased. Additionally,

changes in plant growth occur and originality of soil system vanished. Management of
plant-parasitic nematodes in crop production systems currently relies primarily on
nematicides, host-plant resistance and crop rotation. Still with the help of some successful
nematicides it is possible to control nematodes.
1.7.2 Why to study effects of pesticides on growth of nematophagous fungi
Pesticides are used to control nematodes but it carries as equal number of disadvantages
as it has advantages. Pesticides are chemical compounds which are way better effective
than biocontrol agents but pesticides can harm non-targeted host, they form harmful
contamination in soil, water and air. It inhibits the growth of beneficial non target fungi.
(Meyer, & Huettel, 1991)
Over the years many chemical pesticides has been invented which allows many
improvements in agriculture and horticulture yields. But most of these chemicals are
powerful and indiscriminate poisons and produce many adverse environmental effects.
Fungi proves very effective creature for controlling nematodes (Expos, Fungi, & York,
2001). field experiments are carried out, products are developed and successfully
marketed but then the fungal products are replaced by more effective chemical
insecticides.
By studying effects of various pesticides we get to know the resistivity of the
Nematophagous fungi towards the pesticides so, farmers can use it to more beneficial
purpose. If fungi are more resistant towards pesticides, both they can applied on field
together and it can increase the crop productivity. It can increase the activity of fungi if
the fungi are genetically engineered, by applying the pesticides the gene of fungi activates
and it is helpful for the a better activity of fungi. it can decrease the use of chemicals and
so the cost get decreases of using chemicals. Moreover, the harmful effects of pesticides
can be decreased. More the resistant fungi, more it is useful in agriculture field (Affairs,
1997).
∑ CARBENDAZIM- Carbendazim is widely used broad-spectrum benzimidazole
fungicide and a metabolite of benomyl. It is a systematic fungicide used on fruits,
vegetables, field crops, ornamentals, and turf. It has low toxicity and available
commercially in the form of a wettable powder and concentrated suspensions.
There is no specific treatment for carbendazim poisoning in animals. Symptomatic
treatment is applied to promote excretion. Inhibition of mitosis and cell division.
21

∑ MANCOZEB- mancozeb is a fungicide belonging to the class of the
dithiocarbamates. It is useful against a broad spectrum of fungal diseases. Acts by
distrupting lipid metabolism. Mancozeb inhibits enzyme activity by complexing
with meatl-containing enzymes including those involved with the production of
ATP.
∑ TEBUCANAZOL- Tebuconazol is a triazol fungicide used in agricultural to treat
plant pathogenic fungi. Its acute toxicity is moderate. Broad spectrum fungicide
and cause disruption of membrane function and inhibitors.
∑ ETHION- Ethion is an organophosphate pesticides used to kill aphides, mites,
scales, thrips and foliar feeding larvae. These chemicals act by interfearing with
the activities of cholinesterase, an enzyme that is essential for the proper working
of the nervous systems of both humans and insects. It may be used on a wide
variety of food, fiber and ornamental crops, including greenhouse crops.
∑ PROFENOFOS- It is an organophosphate insecticides. Profenofos was first
registered by the Agency in 1982 for use as an insecticide. Its chemical name is O-
(4-bromo-2-chlorophenyl) O-ethyl S-propyl phosphorothioate. Profenofos mainly
used to control tobacco budworm, cotton bollworm, armyworms (States &
Protection, 2006)
∑ GLYPHOSATE- Glyphosate is a widely popular herbicide known for its
effective control of competing vegetation, rapid inactivation in soil and low
mammalian toxicity. It is a broad-spectrum systematic herbicide used to kill
weeds. Mode of action of this herbicide is to inhibit Glyphosate's mode of action
is to inhibit an enzyme involved in the synthesis of the aromatic amino acids:
tyrosine, tryptophan and phenylalanine. It is absorbed through foliage and
translocated to growing points. Because of this mode of action, it is only effective
on actively growing plants; it is not effective as a pre-emergence herbicide (Busse,
& Powers, 2001)
1.8 Importance of Serine Protease and its association with Predatory activity of
nematophagous fungi
Parasitic nematodes cause great damage to crops and livestock. During the past 50 years,
nematicides have been used extensively to control nematodes in both plants and animals,
but their use has become increasingly restricted due to public health and environmental
22

concerns. Nematophagous fungi are natural enemies of nematodes and its role is
interesting to study infection biology and biochemistry associated with the capturing,
cuticle penetration and colonization process. Nematophagous fungi have attracted much
attention due to the use many enzymes, mainly extracellular proteases have been
implicated in the penetration and digestion of host tissues by many plant and animal
parasitic fungi. For genetic improvement of these organisms, it is necessary to understand
the molecular basis of biological control and to identify the different genetic components
that play a role during the process of nematode predation (Nagee., & Aich, 2008)
This is an important virulence factor of nematophagous fungi to produce extracellular
proteases and most of these proteolytic enzymes belong to the family of serine proteases
(Lopez-Llorca et al., 2010) During the infection of nematodes, nematophagous fungi must
penetrate the nematode cuticle, which is a rigid and flexible exoskeleton composed
mainly of proteins, including collagens (Cox et al 1981, Maizels et al 1993). Although the
proteinaceous nematode cuticle is an effective barrier against most pathogens,
nematophagous fungi can breach it using these enzymes. Several extracellular proteases
isolated from nematophagous fungi belong to serine proteases, and it has been
demonstrated that they have high homology to members of the subtilase family (Segers et
al 1994, Tunlid et al 1994, Bonants et al 1995). The importance of serine proteases during
the infection of nematodes has been indicated by treating nematophagous fungi with
various protease inhibitors (Tunlid and Jansson 1991) by localizing the protease during
the infection of eggs (Minglian,& Keqin, 2004) The dynamic structural features of a
classical serine protease were investigated using molecular dynamics (MD) simulation
technique. It has different degree of flexibility of the substrate binding region and it can
increase substrate binding affinity and catalytic activity (Shu-Qun Liu et al., 2009)
Understanding the 3-dimensional structures of these proteins can provide crucial
information for improving the effectiveness of these fungi in biocontrol applications, e.g.,
by targeted protein engineering. One way to improve the biocontrol potential of
nematophagous fungi is to increase the pathogenicity by increasing the number of copies
of cuticle-degrading genes in nematophagous fungi, using genetic engineering techniques.
Another way is to change the key amino acid residues of protease or other virulence
factors using site-directed mutagenesis. some fungi can infect both nematodes and insects,
and opportunistically infect human patients. Thus, the role of proteases during the
interaction between nematophagous fungi and nematodes could be an ideal model to
study the general roles of these proteases in fungi-host interaction. Solving the structures

of cuticle degrading proteases will thus not only facilitate virulence improvements for
fungi against nematodes or insects, but will also provide potential therapeutic drug targets
against fungi in clinical treatment (Liang et al., 2009)

Objectives
2. OBJECTIVES:
The present work was aimed to study the effect of some commercially available
pesticides on growth of our two isolates of nematophagous fungi. Objectives of the
present study were
1. Optimization of growth conditions i.e. media, pH and Temperature
2. To study the effect of fungicides on growth of isolates
3. To study the effect of herbicides and insecticides on growth of isolates
4. Amplification of Serine protease gene and its sequencing
5. Bioinformatics analysis
6. Identification of isolates by 18S rRNA gene sequencing

Materials & Methods
3.MATERIALS & METHODS
3.1 MATERIALS
FUNGAL ISOLATS:
Nematophagous fungal isolates GS1 and GS2 that were used in present study
were previously isolated and provided to me by my guide.
1. GLASS WARES
∑ Petri plates
∑ Conical flasks (250ml and 500ml)
∑ Sugar tubes
∑ Slides and cover slips
∑ Mortar and pestle
2. PLASTIC WARES
∑ Microfuge tubes (1.5ml and 2ml)
∑ Microtips (0.5 to 10µl, 20-200µl, 200-1000µl)
∑ PCR tubes (0.2ml)
∑ Centrifuge tubes (50ml)
∑ Measuring cylinder (100ml, 1000ml)
∑ Tip box
3. MEDIA
∑ Corn meal agar (17g/L, HI MEDIA)
∑ Czapak dox broth (35.01g/L,HI MEDIA)
∑ Sabouraud dextrose agar
∑ Jensen’s medium (24.1g/L,HI MEDIA)
∑ Martin’s medium
∑ Yeast extract peptone soluble starch medium
∑ Richard’s medium
∑ Nutrient agar medium(HI MEDIA)
∑ Potato dextrose agar (24g/L,HI MEDIA)
26

Materials & Methods
4. ANTIBIOTICS
∑ Tetracyclin
5. STAIN AND DYES:
∑ Bromo Pheno Bule (BPB)
∑ Lacto phenol blue
∑ Ethium bromide (EtBr)
6. PESTICIDES
(1) FUNGICIDES
∑ Tebucanazol (25%, Folicure)
∑ Carbendazim (50%, Bavistin)
∑ Memcozeb (75%, Dithane M-45)
(2) HERBICIDES
∑ Glyphosate (41%,Roundup )
∑ Methsulfuron methyl (20%, Algrip)
(3) INSECTICIDES
∑ Profenofos (40%, Profex Super)
∑ Ethion (50%, )
% concentration of active ingredient and Trade names are given in bracket.
7. CHEMICALS:
1) FOR FUNGAL DNA ISOLATION and GEL ELECTROPHORESIS
∑ Phenol
∑ Tris Base
∑ EDTA
∑ β- mercapto ethanol
∑ Boric acid
∑ Chloroform
∑ Ethanol
27

Materials & Methods
∑ Bromophenol blue
∑ Tris-Hcl
∑ SDS (Sodium dodicyl sulphate)
∑ Agarose
2) FOR PCR
∑ 2x PCR master mix, ( Genei, Banglore)
∑ Sterile mili q water
∑ Template DNA (100 ng)
∑ Agarose ( Hi-Media)
∑ Gel loading dye (BPB)
∑ 1X TBE buffer (dilute from 10X stock)
∑ Ethidium Bromide ( Hi-MediA)
∑ Serine protease gene specific forward and reverse primer
3) Buffer used
∑ Cell lysis buffer
ÿ
50mM Tris chloride (pH-7.1)
ÿ
300mM EDTA(pH-8)
ÿ
1% SDS
∑ TBE buffer (10X) (pH-8)
ÿ
Tris base- 108g/L
ÿ
Boric acid- 55g/L
ÿ
EDTA- 40ml of 0.5M EDTA (pH-8.0)
8. INSTRUMENTS
∑ Autoclave (big-BLS)
∑ Incubator (NOVA)
∑ Micropipettes (BIOSYSTEM, ACCUPIPETTE)
∑ Laminar air flow (SELE)
∑ pH meter (SYSTRONIC)
∑ Gel-electrophoretic unit(APELEX)
∑ Shaker(NOVA)

Materials & Methods
∑ Nano drop (THERMO SCIENTIFIC)
∑ Waterbath (CINTEX DIGITAL)
∑ Electrophoretic power pack (APELEX)
∑ Hot air oven (BLS)
∑ Microscope (RADIAL)
∑ Weighing machine (SCALE-TEC)
∑ Magnetic stirrer (REMI)
∑ Refrigerator (SAMSUNG)
∑ Glass distillery
∑ Centrifuge (MPW)
∑ UV transilluminator (LABNET)
∑ Thermocycler (NYX TECHNIK)
∑ PCR workstation (AIRCLEAN)
9. SOFTWARE USED
∑ MEGA (Molecular Evolutionary Genetics Analysis) v5.1
∑ CLC genomics workbench v4.9
29

Materials & Methods
3. 2 METHODS
3.2.1. Maintenance of fungal cultures
Fungal isolates were maintained by inoculating CMA slant and incubating at 28
º
C for
7days. Slants were stored at 4ºC until used.
3.2.2 Preparation of media
Readymade formulation of dehydrated media from the maker of ‘HI MEDIA’ was used
for preparing solid as well as liquid media. Media that were not available as readymade
were prepared by dissolving extra pure chemicals purchased from Hi media. All solid and
liquid media were amended with Tetracycline 30µg/ml to prevent bacterial
contamination.
3.2.3. Microscopic study of fungi
Fungal mycelia picked form 7 days old were stained with lacto phenol blue and observed
under 10X and 40X in light microscope. Conidia spores of nematophagous fungi were
harvested by washing a fully grown plate with 2ml sterile distilled water and using 10µl
of it for slides were prepared. Conidaio spores were also observed directly on Czapk Dox
Agar plates. Similarly trapping structures were also directly observed on plates under 40X
in light microscope(RADIAL) and photographs were taken.
3.2.4. Optimization of growth conditions
Different growth parameters i.e. Media, pH and Temperature were optimized form
luxurious growth of fungi.
(1) Optimization of media: Nine different media (Corn meal agar, czapak dox broth,
Jenson’s media, Richard’s media, nutrient agar media, potato dextrose agar, Martin’s
media, Sabouraud dextrose agar, Yeast extract peptone soluble starch media), were used
to show which media promotes luxurious growth of isolates. CMA plates were inoculated
centrally with 8mm diameter agar block from previously grown for 14 days. Plates were
prepared in triplicate for all the media for each fungus. Plates were incubated at 28º C for
7 days. Growth diameters in cm were measured, mean value was calculated and graph
was plotted.

Materials & Methods
(2) Optimization of pH and Temperature
For determination of optimum pH, isolates were grown on cornmeal agar with different
pH that is 4, 5, 6, 7, 8 and 9. For temperature, isolates were allowed to grow on cornmeal
at different temperatures that is 15, 25, 30, 37, 45 and 55ºC. All these studies were
performed in triplicate by inoculating plates centrally with 8 mm diameter agar block
from 15 days old CMA plates. For optimizing media and pH plates were incubated at
28ºC for 7 days. After 7 days mean value of growth diameter in cm was calculated and
graphs were plotted.
3.2.5 Effect of pesticides on the growth of isolates
(1) Effect of fungicides on growth of isolates
Corn meal agar (CMA) was prepared and autoclaved at 121 ºC at 15psi. Stock solutions
of the fungicides, mencozeb, tebucanazole and carbendazim were prepared in sterilized
distilled water. Appropriate volumes from the stock solutions of were added into corn
meal agar flask to achieve the final concentration of 0.5µg/ml, 1µg/ml, 2µg/ml, 3µg/ml,
4µg/ml and 5µg/ml. Plates were inoculated centrally with 8mm mycelia disc, taken from
the edge of an actively growing 7 days-old culture of isolates from CMA. CMA without
pesticides was used as control. The inoculated petri plates were incubated at 28ºC for 7
days. The diameter of growth in test and control was measured and % growth inhibition
was calculated.
(2) Effect of herbicides on growth of isolates
Corn meal agar (CMA) was prepared and autoclaved at 121ºC at 15psi. Stock solutions of
the herbicides were prepared in sterilized distilled water. Appropriate volumes from the
stock solutions of glyphosate and methsulfuron methyl were added into media to achieve
the final concentration of 50µg/ml, 100µg/ml, 500µg/ml, 1000µg/ml. Plates were
inoculated centrally with 8mm agar dick taken from the edge of an actively growing 7
days-old culture of isolates. The inoculated petri plates were incubated at 28ºC for 7 days.
The diameter of growth in test and control was measured and % growth inhibition was
calculated.
(3) Effect of insecticides on growth of isolates
Corn meal agar (CMA) was prepared and autoclaved at 121ºC at 15psi. Stock solutions of
the insecticides were prepared in sterilized distilled water. Appropriate volume from the

Materials & Methods
stock solutions of Ethion and Profenofos were added into CMA flask to achieve the final
concentration of 50µg/ml, 100µg/ml, and 500µg/ml. Plates were inoculated centrally with
8mm mycelia disc, taken from the edge of an actively growing fungus. Plates without
insecticide were serves as control. The inoculated petri plates were incubated at 28ºC for
7 days. The diameter of growth in test and control was measured and % growth inhibition
was calculated.
Percentage of fungal growth inhibition = (C-T)/C×100
Where: C= growth of the fungus in control and
T= growth of the fungus in media containing pesticides
3.2.6 Fungal DNA isolation
(1) Growth of fungi in liquid media
Spore suspension was prepared by pouring 5ml sterile distilled water on previously grown
CMA plates. 50ml potato dextrose broth containing 30µg/ml of tetracycline was
inoculated with 2ml of above spore suspension and was allows growing at 28ºC under
shaking conditions at 120rpm for 6days. Mycelia were harvested by centrifugation broth
at 10000rpm for 15min.
(2) Isolation of the genomic DNA
∑ Fungi were grown in 50ml PDB medium containing tetracycline(30µg/ml) for 7
days.
∑ Fungal mycelia were collected from broth and 200mg were taken for DNA
isolation.
∑ Mycelia were crushed in chilled mortar.
∑ To this 4ml of cell lysis buffer (pH 8) was added and further crushed to
homogeneity and transferred to 2ml sterile microfuge tubes.
∑ 50µl of 0.1% of β-mercaptoethanol was added, mixed thoroughly and incubated at
65ºC in water bath for 1hour. Samples were mixed gentally at an interval of
10mins.
∑ After incubation samples were centrifuged at 10,000 rpm for 10 minutes.
32

Materials & Methods
∑ Supernatant was transferred to another microfuge tubes and protein were
precipitated with equal volume of equilibrated phenol and further centrifuged at
10,000 rpm for 10 minutes.
∑ To the supernatant equal volume of phenol: chloroform added, mixed and
centrifuged at 10,000 rpm for 10 mins.
∑ Again to the supernatant chilled chloroform was added and centrifuged at 10,000
rpm for 10 minutes.
∑ DNA from aqueous phase were precipitation using double the volume of chilled
ethanol (70%) added and incubated at 4ºC for overnight.
∑ tubes were centrifuged at 12,000 rpm for 15 min, supernatant was decant off and
pellets were allowed to air dry.
∑ Finally pellets were suspended in 20µl of milliQ water.
3.2.7 Agarose gel electrophoresis
∑ 1% agarose gel was prepared in 1X TBE buffer with ethidium bromide. 4µl of
DNA and 2µl of loading dye (BPB) were mixed and loaded into wells.
Electrophoresis was carried out at 100mA for 30 min and gel was observed for
bands of genomic DNA on UV transilluminator and photographed.
3.2.8 Quantification of DNA
DNA was quantified by using ND-1000 Spectrophotometer
(NanoDropTechnologies Inc.) using the convention that 1 absorbance unit at 260
nm equals 50µg DNA/ml. The U.V. absorbance was measured at 260 and 280 nm
for determination of sample concentration and purity. Purity of DNA was judged
on the basis of absorbance ratio at 260/280 and 230/260.
3.2.9 Amplification of 18S r RNA gene and Serine Protease gene by Polymerase
Chain Reaction:
18S rRNA gene was amplified by using universal forward and reverse primers.
The reaction mixture was prepared as given below and the cycling conditions are
also given below.
33

Materials & Methods
Table 1: Reaction Mixture:
Reagent Quantity (µl)
TaqA Buffer (10X) 2.5
dNTPs Mix (2.5mM each) 2.5
Forward Primer (10µM) 1.0
Reverse Primer (10µM) 1.0
Genomic DNA (70-100ng/µl) 1.0
Taq polymerase (5U/ µl) 0.2
MiliQ water 16.8
Total 25.0
Table 2: Primer sequence for 18s rRNA
FR 5’AGGGTTCGATTCCGGAGA3’
RE 5’TTGGCAAATGCTTTCGC3’
Table 3: PCR cycling condition for 18s rRNA
Temperature Time (min) Cycle
(˚C)
Initial denaturation 94 5 -
Denaturation 94 1
Annealing 58 1
35
Extension 72 1
Final extension 72 7 -
Hold 4 -

Materials & Methods
Table 4: Primer sequence for serine protease
FR 5’GACCGTATCTCCCACGAGGA3’
RE 5’TGCCGTCAGAGTCGGTATTG3’
Table 5: PCR cycling condition for serine protease gene
Temperature Time (min) Cycle
(˚C)
Initial denaturation 94 5 -
Denaturation 94 1
Annealing 60 1
35
Extension 72 1
Final extension 72 7 -
Hold 4 -
(1) Agarose gel electrophoresis of Amplified PCR Products:
1% agarose gel was prepared in 1X TBE buffer. Then it was cooled nearly to 45
°C and 3µl of ethidium bromide solution was added. The prepared agarose gel
was poured into the gel casting stand with comb. After having a rigid gel, combs
were taken out to have wells for loading. 3 μl of PCR products and 2μl of loading
dye were mixed and loaded into well with 1kb DNA ladder. Electrophoresis was
carried out at 100 mA for 30 min and visualized in a UV transilluminator.

Materials & Methods
3.2.10 Identification of fungi
Fungi were identified based on 18S rRNA gene. For that amplified products were
sent to Xcleris Labs Ahmadabad for sequencing. Sequences were blast against nr
data base of NCBI using BlastX.
(1) Identification and phylogenetic analysis of isolates based on 18S rRNA and
Serine Protease gene sequencing
Nucleotide sequences of 18S rRNA genes of different nematophagous fungi with
different trapping mechanisms were downloaded from NCBI
(http://www.ncbi.nlm.nih.gov/). Phylogenetic tree was constructed using MEGA V5.1
(Tamura et al., 2011). The evolutionary history was inferred using the Neighbor-Joining
method (Saitou and Nei, 1987). Pairwise alignment of sequences was performed using
ClustalW in built feature of MEGA, with default parameters. The bootstrap consensus
tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa
analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less
than 30% bootstrap replicates are collapsed. The percentage of replicate trees in which the
associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to
the branches. The evolutionary distances were computed using the Maximum Composite
Likelihood method (Tamura K., Nei, 2004).
(2) Molecular analysis of serine protease gene
Primers that were used to amplify the serine protease genes were provided by my guide.
The following conditions were applied. Further a Neighbor-Joining tree was constructed
using CLC genomic work bench (CLC Bio4.9) (http://www.clcbio.com/) with bootstrap
value1000.

Results And Discussion
4. RESULTS AND DISCUSSION
4.1 Morphological characterization of isolates
Pattern of trapping structure and conidia and chlamydospores were used to identify fungi
on the base of morphology (Cook and Godfrey 1964; Schenck et al., 1977 and Rubner,
1996). Typical radial growth on CMA of both the fungi is shown in Figure 4(a) and 5(a).
Both the isolates were forming single septet on erect conidiophores Figure 4(b) and 5(b).
Similarly isolates were forming forming walled chlamydospores figure 4(c) and figure
5(c). Chlamydospores are highly resistant structure as stated previously can survive gut
passage of ruminants. Isolates were producing three dimensional ring networks figure
4(d) and 5(d). Nematodes are captured by these trapping devices. On the basis of
morphology both the fungi were identified to Duddingtonia flagrans.
(a) (b)
Trapping
structure
of GS1
(C) (d)
Figure 4: Morphological characterization of isolates GS1, (a) Fungus growth on
CMA after 7 days b) Single septed conidiospore under 40X c) Chlamydospores
under 40X (d) Trapping structure.

Septa
(a) (b)
Septa
Trapping
structure
of GS2
(C) (d)
Figure 5: Morphological characterization of isolates GS2. (a) Typical Fungus growth
on CMA after 7 days b) Single septed conidiospore under 40X c) Chlamydospores
under 40X (d) Characteristic ring like trapping structure.

4.2 Optimization of growth media
Fungal isolates were grown on nine different media to evaluate which media support
maximun growth(Potato dextrose broth,Corn Meal agar,Czapak dox agar,Jenson’s
broth,Richard’s media,Yeast extract peptone soluble media,Sabouraud dextrose
agar,Martin’s edia,Nutrient agar). Results shows that Czapak dox agar and Jenson’s
medium support healthy growth of both the isolates. This was followeed by PDA and
CMA. Marition’s medium and Nutrient agar supports comparatelty poor growth (Figure
6).On other media isolates were growing moderately.
PDB
GS1 GS2
inhibition
12
10
8
6
Growth
4
2
%
0
Media
Figure 6: % Growth inhibition of fungal isolates on various media.

4.3 Optimization of pH :
The fungus is to be used in the field as well as will be used to feed the animals. In both
the case the pH variation will be there. So efforts were made to study the pH at which the
fungus can grow as ultimately to perform its job its very much required.
cm
Avggrowthmeasurementin
10
8
6
4
2
0
GS1 GS2
4 5 6 7 8 9
pH
Figure 7: Growth of fungal isolates at various pH.
Fungi were grown on CMA with different pH. From the figure it is clear that neutral to
basic pH supports luxurious growth of both the isolates. Acidic pH was found to growth
inhibitory, at pH 4 very stunted growth was observed. At pH 6 fungi were growing
moderately.

4.4 Optimization of Temperature
Different regions have different temperature. So it’s required to check the effect of
different temperature on the growth of fungi. From this we get idea that in which season it
will be good if we use it for biological control and if it’s found that it can grow at broad
range of temperature then we can use it any time.
cm
Avggrowthmeasurementin
10
8
6
4
2
0
GS1 GS2
15 25 30 37 45 55
Temp.
Figure 8: Growth of fungal isolates at various temperatures.
Results of temperature optimization are shown in figure. Temperature 25 ºC was found to
optimum for the growth. Fungi were failed to grow at 15, 45 and 55ºC. Comparatively
poor growth was observed at 30 and 37ºC .

4.5 EFFCT OF FUNGICIDE
Both fungi were sensitive to all the fungicide tested.
4.5.1 Effect of carbendazim (systematic fungicide) on growth of GS1 and GS2.
Carbendazim cause 100% inhibition of both the fungi at all the concentrations i.e. 10, 20,
30, 40 and 50µg/ml. This, indicate that the growth of all isolates were completely
inhibited by carbendazim even at its very low concentration (10µg/ml). So, application of
this fungicide is not suitable in field where Nematophagous fungi used as biocontrol
agent for plant parasitic nematodes.
Its been already reported by Goltapeh & Pakdaman that carbendazim causes complete
fungal growth inhibition at significant concentration in comparison to other fungicide
(Goltapeh & Pakdaman, 2008a).
4.5.2 Effect of Tebucanazole (systematic fungicide) on growth of GS1 and GS2
All isolates were sensitive to Tebucanazole at concentration event at 5µg/ml. So
application of this fungicide will have negative impact on our fungal isolates when
applied to field together.
Tebucanazol were used in fields by Sarkar and co-workers and this fungicide shows
complete growth inhibition upto the level of 200µg/ml. (Sarkar, et.al 2010)
4.5.3 Effect of mencozeb (contact fungicide) on growth of GS1 and GS2
Mencozeb causes 100% growth inhibition of GS1 and GS2 at 10 µg/ml concentration.
We have further analyze effect of mancozeb at low concentrations. Results show both the
isolates were partially resistant at 0.5-5 µg/ml concentration. It causes 28.4% growth
inhibition of GS1 and 21.48% growth inhibition of GS2 at 5µg/ml.
Goltapeh and co-worker reported mencozeb shows partial inhibition of fungal growth,
lesser than other fungicide that is observed (Goltapeh & Pakdaman, 2008b) at higher
conc.(500µg/ml) it inhibits the growth but at lower conc. it does not show its effect and it
is completely similar with the experiment done here, as it can be observed from the
graph(fig.9)

As avowed previously, one strategy of Integrated Pest Management (IPM) is to develop
fungal BCAs with tolerance to fungicides or to incorporate fungicide resistance into
antagonists. But our fungal isolates are not resistant to fungicides studied. So it is clear
that if we use these two fungi for the field application, these fungicides should not be
applied together.
The results of our study proves that our isolates of nematophagous fungus were partially
resistant to tested fungicides upto 5-10 µg/ml, so when these fungi applied in the field as
a biocontrol agent, such fungicides should be used upto a certain level of concentration
otherwise it may interfere with the performance of both the fungi.
%Growthinhibition
GS1 GS2
30
25
20
15
10
5
0
0.5 1 2 3 4 5
Conc. µg/ml
Figure 9: Effect of Mencozeb on growth of GS1 and GS2.

4.6 EFFECT OF HERBICIDE- Isolated Nematophagous fungi were found to resistant to
tested herbicide up to certain concentrations.
4.6.1 Effect of Glyphosate (systematic herbicide) on growth of GS1 and GS2.
Both the isolates were partially resistant to glyphosate as only 67.4% and 68.1% growth of
GS1 and GS2 respectively was inhibited at 500µg/ml concentration. Up to 300µg/ml
concentration only about 50% growth was inhibited, it shows that isolates are resistant to
Glyphosate (Busse et al., 2001) Herbicides are mainly for herbs and weeds. Here, it is
observed from the graph that Glyphosate has very low inhibitory effect on nematophagous
fungi and it shows same result in (Schuster, 1990) So, herbicides are preferable to use
along with nematophagous fungi in field.
%Growthinhibition
GS1 GS2
80
70
60
50
40
30
20
10
0
50 100 200 300 400 500
Conc. µg/ml
Figure 10: Effect of Glyphosate on growth of GS1 and GS2.

4.6.2 Effect of Methsulfuryl methyl (systematic herbicide) on growth of GS1 and
GS2
Same as Gylphosat, Methsulfuryl methyl doesn’t inhibit the growth of both the isolates. At
500µg/ml only about 50% growth of both isolates was inhibited.
To conclude the effect of herbicides it can be said that GS1 and GS2 are resistant to herbicides
and that they can be used along with the fungi. Thus, in field both herbicides and nematophagous
fungi will perform their activity without interfering each other avidity.
50µg/ml
100µg/ml
%growthinhibition
70
GS1 GS2
500µg/ml

6050
40
30
20
10
0
200µg/ml 50 100 200 300 l 400 500500µg/ml
Conc. µg/ml
Figure 11. Effect of Methsulfuryl methyl on growth of GS1 and GS2.
200µg/ml
50µg/ml 100µg/ml
45

4.7 EFFECT OF INSECTICIDES
4.7.1 Effect of Ethion on growth of GS1 and GS2
Isolates were moderately sensitive to Ethion at 200-500µg/ml concentration. Nearly 50%
growth of both the isolates was observed up to 100µg/ml conc. Only 43.4 and 37.4 % growth
was inhibited at 50µg/ml concentration.
%Growthinhibition
GS1 GS2
80
70
60
50
40
30
20
10
0
50 100 200 300 400 500
Conc. µg/ml
Figure 12. Effect of Ethion on growth of isolates.
500µg/ml

4.7.2 Effect of Profenophos on growth of GS1 and GS2
Both isolates were comparately more sensitive to profenophose than ethion. Complete
inhibition of growth was found at 300µg/ml concentration. Even at 5µg/ml a very stunted
growth was observed. This showes that the isolates are very sensitive to profenophose.
To conclude it can be said that both isolates are sensitive to profenophose while resistant to
ethion up to certain concentartion. Our study demonstrate that profenophose cannot be
applied to field together with our fungal isolates.
Profenophos act differently on different nematphagous fungi, in general it has moderate
effect on fungi. But in our cases it has more toxic effect (Amutha et.al, 2010)
%Growthinhibition
90 GS1 GS2
80
70
60
50
40
30
20
10
0
5 10 20 30 40 50 100 200
Conc. µg/ml
Figure 13: Effect of Profenophos on growth of GS1 and GS2

4.8 DNA Isolation
Fungal Genomic DNA was isolated by standard protocol. The DNA was visualised by gel
electrophoresis by running on 1% (w/v) agarose gel. The gel was visualised in UV
transilluminator and photographed subsequently. Isolated DNA was appeared as a faint
band below the wells.
Isolation of DNA was done to perform 18s rRNA gene amplification in order to do
identification of the isolaes at the molecular level. Also the amplification of the seriane
protease gene was done, the gene which is reported to play inmportant role in predation.
Figure 14: DNA bands observed under UV transilluminator
GS2

4.9 PCR product of 18s rRNA & Serine Protease
Both 18s rRNA and serine proease gene specific primer were used. DNA of isolates GS1 and GS2
were amplified and around 550 bp of amplified products were obtained with 18s rRNA primer and
224bp of amplified products were obtained with serine protease that resolved by 1.0% agarose gel.
Amplified products was appeared as single intact band under UV transillumiator. 18s rRNA
amplification is done to identify the fungal isolates at the molecular level. Serine protease is the
extracellular enzyme produced by the fungi which is involved in the degradation of the cuticle wall
of the nematodes which is very much required when the fungi is performing its predatory activity,
Figure 15. Amplified 18s rRNA gene Figure 16. Amplified Serine protease gene with
with 1kb ladder on 1% agarose gel. 1kb ledder on 1% agarose gel.

4.10 Identification of fungal isolates: The amplified 18s rRNA DNA sample was send for
sequencing. The sequence obtain were BLAST in order to know the identity of the fungal
isolates. Based upon this information the isolates were identified below:
∑ GS1:
AAAACGGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAG
GTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAA
TGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT
GCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGC
AGTTAAAAAGCTCGTAGTTGAATTTTGGGTTTGGCTGCTCGGTCCGCCTAA
CCGCGTGCACTGATGCGGCCGGATCTTTCTTTCTGGCTAACCTCATGCCCTT
CACTGGGTGTGCTGGGGATCCAGGACATTTACTTTGAAAAAATTAGAGTGT
TCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAAAATAAGA
CGGGGGTGTCTATTTTGTTGGTTTCTAGAGCCACCGTAATGATTAATAGGG
ATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTA
TTGAAGACTAACTACTGCGAAAGATTTTGCCAAAAAAA
Sequence shows 99% similarity with Duddingtonia flagrans sp.
∑ GS2:
ATCCCACGCAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAG
GTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAA
TGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT
GCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGC
AGTTAAAAAGCTCGTAGTTGAATTTTGGGTTTGGCTGCTCGGTCCGCCTAA
CCGCGTGCACTGATGCGGCCGGATCTTTCTTTCTGGCTAACCTCATGCCCTT
CACTGGGTGTGCTGGGGATCCAGGACATTTACTTTGAAAAAATTAGAGTGT
TCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAAAATAAGA
CGGGGGTGTCTATTTTGTTGGTTTCTAGAGCCACCGTAATGATTAATAGGG
ATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTA
TTGAAGACTAACTACTGCGAAAAATTTGTTGCCAAAAAAA
Sequence shows 99% similarity with Duddingtonia flagrans sp.

Sample ID Organism identified Sequence length (bp) % similarity with
NCBI Subject
sequence
GS1 Duddingtonia flagrans 547 99%
GS2 Duddingtonia flagrans 549 99%
GenBank Accession no.
∑ GS1 KF741374
∑ GS2 KF741375
Figure 17: Neighbor-Joining tree based on 18S RNA gene sequence using
MEGA5.
4.11 Molecular analysis of serine protease gene
224bp gene fragment was amplified using the primer mentioned in the material and
methods. Sequence was 99% similar to D. flagrans serine protease PII. Further we
have aligned the nucleotide sequence our gene with the serine protease gene
sequences of nematophagous fungi and Neighbor-Joining tree was constructed
using CLC genomic work bench V4.9. Serine protease gene of our fungi was very
similar to the cuticle degrading serine protease (PII) gene of D. flagrans
(AY444725) and A. oligospora (AY444607) Figure 18. Pairwise alignment of
conserved region is shown similarity between the three serine protease nucleotide
sequences Figure 19.

∑ GS1 (using serine protease primer)
CCAACAAACATTCCTTATGAAAACGAAGAAATGCCGCCGGCGCTGGCACC
ACCGTCTACGTCATCGACACCGGTATCCGCATTACCCACGATGTAAGTTCC
CTTGTCTCCTAAAACGAATTGATCAATTTATTAACCATATTGTAGGAATTCA
AAACCTCCAACGGCACAAGCCGAGCTACTTGGGGATTCAACTCTGTCGACA
ATACCGACTCTGACGGCAAA
99% similrity with serine protease PII of D. flagrans strain 1351
Sample ID Organism identified Sequence length (bp) % similarity with
NCBI Subject
sequence
Serine protease Extra cellular serine 224 99%
D1 protease gene (partial)
Figure 18: Neighbour Joining tree of serine protease gene using CLC v4.9.

Figure 19: Pair wise alignment of serine protease gene using ClustalW in CLCv4.9.

Conclusion
Parasitic nematode cause huge loose in agriculture and livestock production. To protect
agriculture crop and livestock from the attack of nematode is very much needed as it affects
the economics of any nation. Use of pesticide is very common method to control pest but due
to resistant against pesticides, environment pollution and presence of pesticide in the food
residues is of concern. Hence an alternative methods is very much required which could be
applied . Use of nematophagous fungi as a biocontrol agent is one of the most prominent
strategy. However for it to be successfully implemented in to the field, the fungi must be
resistant to the fungicide, herbicide and insecticide applied to field. In the present study
efforts were mane to study their effect on our isolates. Before this the isolates were
characterized morphologically, nutrient requirements wise and physiologically. On Czapak
Dox agar the optimal growth was observed and in case of pH, neutral to slight alkaline (7-9)
was optimum for growth. While in case of temperature, 25°C was optimum temperature for
the growth of the isolates. Both the isolates were sensitive to very low concentration of
fungicides, where as in case of herbicides, isolates were resistant upto 100 µg/ml
concentration but sensitive to higher concentration i.e. 500µg/ml. Both isolates were partially
resistant to Glyphosate and Methsulfuron methyl at 500µg/ml.. Similar type of effects were
also seen with insecticides Ethion, it did not affect growth of isolates at lower concentration
and were found partially resistant to Ethion at higher concentration. However insecticide
Profenophose affect growth of both the isolates of nematophagous fungi even at low
concentration. So we can say that insecticide Ethion can be used but not Profenophose along
with the nematophagous fungi as it does not affect the nematophagous activity. Overall
results indicate that except fungicides and some insecticides at higher concentration i.e.
500µg/ml, isolated fungi can
be used for the control of nematodes. Both the isolates were identified base 18S rRNA
gene sequencing as Duddingtonia flagrans, showing 99% homology. Neighbor-Joining
tree using MEGA 5 shows that both the isolates were showing homology with nematode
trapping fungi. In addition to this we have also studied serine protease gene form isolate,
blast search shows 99% similarity with serine protease (PII) gene of D. flagrans
(AY444725). Further N-J tree using CLC genomic work bench V9 shows that serine
protease gene of D. flagrans-1 was homologous to serine protease (PII) gene of D.
flagrans (AY444725) and A. oligospora(AY444607).

References
Affairs, S. (1997). Health & Environmental Effects of Pesticides How does Toronto
Public Health weigh the risks ? take preventive action. How does science help us
understand the health effects of pesticides ?, 9–16.
Akhtar, M. and A. Malik.,(2000). Roles of organic soil amendments and soil organisms in
the biological control of plant-parasitic nematodes: a review. Bioresource Technol. 74:
35-47.
Al, M. (2008). In vitro Studies on Nematode Interactions with their Antagonistic Fungi in
the Rhizosphere of Various Plants.
Alabouvette C (1999) Fusarium wilt suppressive soils: an example of disease-suppressive
soils. Australas Plant Pathol 28:57–64
Ali, N. I., I. A. Siddiqui, S. S. Shaukat and M. J. Zaki.,(2002) Nematicidal activity of
some strains of Pseudomonas spp. Soil Biol. Biochem. 34:1051-1058.
Amarante, A.F.T., Susin, I., Rocha, R.A., Silva, M.B., Mendes, C.Q., Pires, A.V., (2009).
Resistance of Santa Ines and crossbred ewes to naturally acquired gastrointestinal
nematode infections. Vet. Parasitol. 165, 273–280.
Amutha, M., Banu, J. G., Surulivelu, T., & Gopalakrishnan, N. (2010). Effect of
commonly used insecticides on the growth of white Muscar dine fungus , Beauveria
bassiana under labor ator y conditions, 3, 143–146.
Animal, F. A. O., & Paper, P. (2002). Biological control of nematode parasites of small
ruminants in Asia.
Bonants PJM, Fitters PFL, Thijs H, Den-Belder E, Waalwijk C, Henfling JWDM., (1995).
A basic serine protease from Paecilomyces lilacinus with biological activity against
Meloidogyne hapla eggs. Microbiology 141:775–784.
Breen, K. J., Wentz, D. A., & Patterson, G. (1974). Pesticides used to control weeds,
insects, and other pests on farms and in urban areas can be harmful to humans and the
environment if they contaminate our water resources, 56–79.

Dhara Desai- thesis

Recommandé

Recommandé

Contenu connexe

Similaire à Dhara Desai- thesis

Similaire à Dhara Desai- thesis (20)

Dhara Desai- thesis