SlideShare une entreprise Scribd logo
1  sur  56
Coding & Best Practice in Programming
Why it matters so much in the NGS era
Lex Nederbragt
Norwegian Sequencing Centre and
Centre for Evolutionary and Ecological Synthesis
lex.nederbragt@ibv.uio.no
@lexnederbragt
OK
Who am I
@lexnederbragt flxlexblog.wordpress.com
How I became a bioinformatician
2007: a grant
GS FLX from Roche/454
Genome Analyzer from Solexa/Illumina
?
Let’s try them out!
Specimen
• Planktothrix rubescens NIVA CYA 98
• Cyanobacteria
• (blue-green algae)
Planktothrix
Half a million reads
Average length 260 nt
10 million reads
33 nucleotides each
Perl
Planktothrix
Newbler SHARCGS
Assembly
Half a million reads
Average length 260 nt
10 million reads
33 nucleotides each
Atlantic cod genome project
850 million bases (Mbp )‘Wild-caught’
GS FLX from Roche/454
Atlantic cod genome project phase 1
Cod genome project phase 2
From Wikimedia commons, user Sagar Joshi
In summary
From flickr, user lesterpubliclibrary
Challenges in the next-generation sequencing era
High-throughput sequencing
Phase 1: more is better
Phase 2: smaller is better
Phase 3: single-molecule
Phase 4: nanopores
Democratization of sequencing
MinION
512 nanopores
150mb/hour
Up to 6 hours
$900
Sequencing cost
Thanks to Matt Clark (TGAC), modified from http://bit.ly/1iiajcS
454 &
polony Solexa
&
SOLiD
HiSeq HiSeq X Ten
GAII
End of the gold rush?
More more more
Data Software
Mathias Bigge, Ricordisamoa, others (wikimedia commons)
TCTCCTAACAACCCCCcACACACACACACTGGTA
CTGATGCCATTCTGCTTTACACCTATACACATCA
TATACATtATACACACACACACACACACACAACA
CTCTCCTAACCCACACACACTGGTACAGATGCCA
GTCTGCTTAACACCTACGCACGTATTATACACAC
ACACACACAACGCTCTCCTAACCCACACACACAC
CAGTCTGCTTTAAACCTACACACATATTATACAA
ACGAGTTGGTGACGTAAGGTTGATAAGGGATATT
GGTAAGGGTTAAGGGTAGGGTTGGTGTTAGGGGC
AAGGGTTAGGGTTAGTGTAAGGGGTAAGGGTTAG
TGTAaGGAGTAAGGGTTAGTGTAAGGGGTTAGTG
TTATTGTAAGGGGCTAGTGTTAGTGTTAGTGTTC
AGGGTTAGTGTTAGGGGTAGGGTTAATgTTTAGG
GTAATGTTTAGGGTTAGGGGTATGGGTTAGTGCT
AGGGGTCAGGGTTAGTGTTAGGGTTAGACAACCC
ACCTGAGAGAACCAGTGCGATGCCGCCGCAGGCG
TTGGGCGAGGACATGGAGGTGCCGTTCATCAGCT
GGGTCCCCCGGAGGGTCCAGTTGGGGACGGAGGC
GATGGCTCCCCCCGGAGCGCTGATGCTGACCCCC
AGGGCGCCGTCGATGCTGGGTCCCCGAGACGACC
AGGTGTACTGGTTGGCCGGGAGCTTCTCCCTCAG
GGAGTACTCCGCCACCATCATGTCGGGGGTCACG
TAGGCCCCAACCCCTGGGGACAGACGGAGCGCGT
TACACACCTCAACCCCTTACCCTCGGAGCCTACA
Software
Constant stream of new software
http://wwwdev.ebi.ac.uk/fg/hts_mappers
88 short-read mappers
Software
Constant stream of new software
http://neidetcher.com/ubuntu_package_dependency.html
InstallationJudging quality
Wikimedia commons, user Thebestofall007
Do we need to be worried?
Do we need to be worried?
Self-taught bioinformaticians
ACCCCCcACACACACACACTGGTACTGATGCC
ACACCTATACACATCATATACATtATACACAC
ACACAACACTCTCCTAACCCACACACACTGGT
GTCTGCTTAACACCTACGCACGTATTATACAC
AACGCTCTCCTAACCCACACACACACCAGTCT
TACACACATATTATACAAACGAGTTGGTGACG
AAGGGATATTGGTAAGGGTTAAGGGTAGGGTT
GCAAGGGTTAGGGTTAGTGTAAGGGGTAAGGG
GAGTAAGGGTTAGTGTAAGGGGTTAGTGTTAT
TAGTGTTAGTGTTAGTGTTCAGGGTTAGTGTT
TTAATgTTTAGGGTAATGTTTAGGGTTAGGGG
TGCTAGGGGTCAGGGTTAGTGTTAGGGTTAGA
GAGAGAACCAGTGCGATGCCGCCGCAGGCGTT
ATGGAGGTGCCGTTCATCAGCTGGGTCCCCCG
TTGGGGACGGAGGCGATGGCTCCCCCCGGAGC
ACCCCCAGGGCGCCGTCGATGCTGGGTCCCCG
GTGTACTGGTTGGCCGGGAGCTTCTCCCTCAG
GCCACCATCATGTCGGGGGTCACGTAGGCCCC
GACAGACGGAGCGCGTTACACACCTCAACCCC
AGCCTACATAACCCAACCCTCTGGAGACGGCA
AGTCAGAAATAGaGCTGACCGATTCATCAAAT
lot’s of data
lot’s of software
recipe for disaster?
Correctness of results
http://www.it.bton.ac.uk/staff/je/java/jewl/tutorial/tutorial.html
Reproducibility
doi:10.1038/sj.embor.7401143
A reproducibility crisis?
Reproducibility and reusability
http://upload.wikimedia.org/wikipedia/commons/4/48/Recycle.jpg
What it boils down to
My (given) title
Coding & Best Practice in Programming
Why it matters so much in the NGS era
Why it matters so much in science
Next-generation sequencing specific?
Diagnostic sequencing
Wikimedia commons, user Bill Branson
Diagnostic sequencing
Diagnostic sequencing
Solutions
Solutions
Flickr: http://farm4.staticflickr.com/3319/3265787219_bfbc654b5e_o.jpg Wikimedia commons
Best practices
10.1371/journal.pbio.1001745
Best practices
Automate repetitive tasks
Wikimedia commons, user Pzucchel
Best practices
Coding styles, variable naming etc
def test_seq:
def sequence_is_DNA:
Best practices
Use version control
https://www.atlassian.com/git/workflows
Best practices
From my own work:
$ cd scripts
$ ls
blat_parse4.pl old_versions snps_flanks_2_fastq.pl
$ ls old_versions/
blat_parse2.pl blat_parse_attemp1.pl
blat_parse.pl.bak blat_parse.pl
blat_parse3_backup.pl
blat_parse3.pl
Best practices
test, test, test
def test_zero:
assert run_the_function(0) == 0
Assert x > 0, ”cannot handle negative numbers"
Best practices
Document well
Best practices
Collaborate
http://howdoitradestocks.com/wp-content/uploads/2011/12/share-ideas1.jpg
khmer, a 'case study'
khmer
Crusoe et al. doi: 10.6084/m9.figshare.979190Michael
Crusoe
Titus
Brown
khmer
https://github.com/ged-lab/2013-paper-ssspe
khmer
Integrated code
coverage analysis
The “GitHub Flow”
model of code review
Semantic
versioning
Continuous
integrationIntegration and
acceptance testing
Beyond best coding practices
Benchmarks
http://assemblathon.org/
Benchmarks
http://www.genome.org/cgi/doi/10.1101/gr.131383.111
Benchmarks
http://www.genomeinabottle.org/
~8300 10ug vials of DNA for NA12878
(Assembly) validation
(Assembly) validation
Assembly
doi:10.1186/1471-2105-15-126
Reproducibility ‘platforms’
usegalaxy.org
taverna.org.uk/
pythonhosted.org/Sumatra/
Action points
Action points
Attend a software Carpentry Boot Camp
http://software-carpentry.org/
Action points
Look for signs of best practice
Action points
Look for signs of best practice
during peer review
nature.com
Action points
Benchmarking/validation
Action points
Develop (under)graduate curriculum
My goal today
Flickr: http://farm4.staticflickr.com/3319/3265787219_bfbc654b5e_o.jpg

Contenu connexe

Tendances

A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...Alexander Jueterbock
 
Microbiome Profiling with the Microbial Genomics Pro Suite
Microbiome Profiling with the Microbial Genomics Pro SuiteMicrobiome Profiling with the Microbial Genomics Pro Suite
Microbiome Profiling with the Microbial Genomics Pro SuiteQIAGEN
 
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...Joseph Hughes
 
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...Next Generation Sequencing (NGS) in food safety-Game changer or just another ...
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...ExternalEvents
 
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...eventi-ITBbari
 
BioChain Next Generation Sequencing Products
BioChain Next Generation Sequencing ProductsBioChain Next Generation Sequencing Products
BioChain Next Generation Sequencing Productsbiochain
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
 
Molecular characterization of Pst isolates from Western Canada
Molecular characterization of Pst isolates from Western CanadaMolecular characterization of Pst isolates from Western Canada
Molecular characterization of Pst isolates from Western CanadaBorlaug Global Rust Initiative
 
2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngs2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngsDin Apellidos
 
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...EMC
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisDespoina Kalfakakou
 
Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Matthew Holguin
 
Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Yaoyu Wang
 
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA Roberto Scarafia
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeJustin Johnson
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyQIAGEN
 
Next generation sequencing & microarray-- Genotypic Technology
Next generation sequencing & microarray-- Genotypic TechnologyNext generation sequencing & microarray-- Genotypic Technology
Next generation sequencing & microarray-- Genotypic TechnologyGenotypic Technology
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
 

Tendances (20)

A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...
 
Microbiome Profiling with the Microbial Genomics Pro Suite
Microbiome Profiling with the Microbial Genomics Pro SuiteMicrobiome Profiling with the Microbial Genomics Pro Suite
Microbiome Profiling with the Microbial Genomics Pro Suite
 
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
 
Poster ESHG
Poster ESHGPoster ESHG
Poster ESHG
 
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean fo...
 
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...Next Generation Sequencing (NGS) in food safety-Game changer or just another ...
Next Generation Sequencing (NGS) in food safety-Game changer or just another ...
 
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
 
BioChain Next Generation Sequencing Products
BioChain Next Generation Sequencing ProductsBioChain Next Generation Sequencing Products
BioChain Next Generation Sequencing Products
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
Molecular characterization of Pst isolates from Western Canada
Molecular characterization of Pst isolates from Western CanadaMolecular characterization of Pst isolates from Western Canada
Molecular characterization of Pst isolates from Western Canada
 
2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngs2011 jeroen vanhoudt_ngs
2011 jeroen vanhoudt_ngs
 
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...
White Paper: Next-Generation Genome Sequencing Using EMC Isilon Scale-Out NAS...
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysis
 
Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17Illumina-General-Overview-Q1-17
Illumina-General-Overview-Q1-17
 
Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Rnaseq basics ngs_application1
Rnaseq basics ngs_application1
 
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
 
Advances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell TechnologyAdvances and Applications Enabled by Single Cell Technology
Advances and Applications Enabled by Single Cell Technology
 
Next generation sequencing & microarray-- Genotypic Technology
Next generation sequencing & microarray-- Genotypic TechnologyNext generation sequencing & microarray-- Genotypic Technology
Next generation sequencing & microarray-- Genotypic Technology
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 

En vedette

Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingDayananda Salam
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewDominic Suciu
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applicationsAGRF_Ltd
 
NGS in cancer treatment
NGS in cancer treatmentNGS in cancer treatment
NGS in cancer treatmentNur Suhaida
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisBastian Greshake
 
Overview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence dataOverview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence dataThomas Keane
 
Introduction to NGS
Introduction to NGSIntroduction to NGS
Introduction to NGScursoNGS
 
Workshop NGS data analysis - 1
Workshop NGS data analysis - 1Workshop NGS data analysis - 1
Workshop NGS data analysis - 1Maté Ongenaert
 
Making your science powerful : an introduction to NGS experimental design
Making your science powerful : an introduction to NGS experimental designMaking your science powerful : an introduction to NGS experimental design
Making your science powerful : an introduction to NGS experimental designjelena121
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGBilal Nizami
 
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth Alira Health
 
Computational infrastructure for NGS data analysis
Computational infrastructure for NGS data analysisComputational infrastructure for NGS data analysis
Computational infrastructure for NGS data analysiscursoNGS
 
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...QIAGEN
 
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1QIAGEN
 
Expanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSExpanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSIntegrated DNA Technologies
 
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...QIAGEN
 
“Next-Generation Sequencing (NGS) Global Market – Forecast To 2022”
“Next-Generation Sequencing (NGS) Global Market  – Forecast To 2022”“Next-Generation Sequencing (NGS) Global Market  – Forecast To 2022”
“Next-Generation Sequencing (NGS) Global Market – Forecast To 2022”Vinay Shiva Prasad
 

En vedette (20)

Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology Overview
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applications
 
Ngs ppt
Ngs pptNgs ppt
Ngs ppt
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
NGS in cancer treatment
NGS in cancer treatmentNGS in cancer treatment
NGS in cancer treatment
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome Analysis
 
Overview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence dataOverview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence data
 
Introduction to NGS
Introduction to NGSIntroduction to NGS
Introduction to NGS
 
Workshop NGS data analysis - 1
Workshop NGS data analysis - 1Workshop NGS data analysis - 1
Workshop NGS data analysis - 1
 
Making your science powerful : an introduction to NGS experimental design
Making your science powerful : an introduction to NGS experimental designMaking your science powerful : an introduction to NGS experimental design
Making your science powerful : an introduction to NGS experimental design
 
High throughput sequencing
High throughput sequencingHigh throughput sequencing
High throughput sequencing
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING
 
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth NGS for Infectious Disease Diagnostics: An Opportunity for Growth
NGS for Infectious Disease Diagnostics: An Opportunity for Growth
 
Computational infrastructure for NGS data analysis
Computational infrastructure for NGS data analysisComputational infrastructure for NGS data analysis
Computational infrastructure for NGS data analysis
 
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...
Step by Step, from Liquid Biopsy to a Genomic Biomarker: Liquid Biopsy Series...
 
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
 
Expanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGSExpanding Your Research Capabilities Using Targeted NGS
Expanding Your Research Capabilities Using Targeted NGS
 
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...
Advanced NGS Data Analysis & Interpretation- BGW + IVA: NGS Tech Overview Web...
 
“Next-Generation Sequencing (NGS) Global Market – Forecast To 2022”
“Next-Generation Sequencing (NGS) Global Market  – Forecast To 2022”“Next-Generation Sequencing (NGS) Global Market  – Forecast To 2022”
“Next-Generation Sequencing (NGS) Global Market – Forecast To 2022”
 

Similaire à Coding & Best Practice in Programming in the NGS era

2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshopc.titus.brown
 
Lab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptxLab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptxkarlos64
 
Use of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial geneticsUse of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial geneticsDebtanu Chakraborty
 
Health, Data Analytics and Decision Support
Health, Data Analytics and Decision SupportHealth, Data Analytics and Decision Support
Health, Data Analytics and Decision Supportimec
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part Ihhalhaddad
 
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...InsideScientific
 
Molecular Biology Intro.pdf
Molecular Biology Intro.pdfMolecular Biology Intro.pdf
Molecular Biology Intro.pdfssuser432659
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Jonathan Eisen
 
Wild Strawberry: An emerging model for ecological and evolutionary genomics
Wild Strawberry: An emerging model for ecological and evolutionary genomicsWild Strawberry: An emerging model for ecological and evolutionary genomics
Wild Strawberry: An emerging model for ecological and evolutionary genomicsAaron Liston
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Torsten Seemann
 
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Robert (Rob) Salomon
 
US2TS presentation on Gene Ontology
US2TS presentation on Gene OntologyUS2TS presentation on Gene Ontology
US2TS presentation on Gene OntologyChris Mungall
 
DNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsDNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsJeffrey Funk
 

Similaire à Coding & Best Practice in Programming in the NGS era (20)

2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
Lab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptxLab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptx
 
Use of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial geneticsUse of bio-informatic tools in bacterial genetics
Use of bio-informatic tools in bacterial genetics
 
Brochure Algae Engineering Kits
Brochure Algae Engineering KitsBrochure Algae Engineering Kits
Brochure Algae Engineering Kits
 
Health, Data Analytics and Decision Support
Health, Data Analytics and Decision SupportHealth, Data Analytics and Decision Support
Health, Data Analytics and Decision Support
 
Submitted sequence (strains)
Submitted sequence (strains)Submitted sequence (strains)
Submitted sequence (strains)
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part I
 
Introduction to 16S Microbiome Analysis
Introduction to 16S Microbiome AnalysisIntroduction to 16S Microbiome Analysis
Introduction to 16S Microbiome Analysis
 
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
 
Molecular Biology Intro.pdf
Molecular Biology Intro.pdfMolecular Biology Intro.pdf
Molecular Biology Intro.pdf
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....
 
Wild Strawberry: An emerging model for ecological and evolutionary genomics
Wild Strawberry: An emerging model for ecological and evolutionary genomicsWild Strawberry: An emerging model for ecological and evolutionary genomics
Wild Strawberry: An emerging model for ecological and evolutionary genomics
 
Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013Prokka - rapid bacterial genome annotation - ABPHM 2013
Prokka - rapid bacterial genome annotation - ABPHM 2013
 
2014 naples
2014 naples2014 naples
2014 naples
 
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
 
2014 ucl
2014 ucl2014 ucl
2014 ucl
 
PAG-2004-Roe
PAG-2004-RoePAG-2004-Roe
PAG-2004-Roe
 
US2TS presentation on Gene Ontology
US2TS presentation on Gene OntologyUS2TS presentation on Gene Ontology
US2TS presentation on Gene Ontology
 
DNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsDNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implications
 
proteome.pdf
proteome.pdfproteome.pdf
proteome.pdf
 

Plus de Lex Nederbragt

Why of version control
Why of version controlWhy of version control
Why of version controlLex Nederbragt
 
Assembly: before and after
Assembly: before and afterAssembly: before and after
Assembly: before and afterLex Nederbragt
 
Improving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBioImproving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBioLex Nederbragt
 
Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)? Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)? Lex Nederbragt
 
A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...Lex Nederbragt
 
Combining PacBio with short read technology for improved de novo genome assembly
Combining PacBio with short read technology for improved de novo genome assemblyCombining PacBio with short read technology for improved de novo genome assembly
Combining PacBio with short read technology for improved de novo genome assemblyLex Nederbragt
 
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Lex Nederbragt
 
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...Lex Nederbragt
 
How and why I use blogging
How and why I use bloggingHow and why I use blogging
How and why I use bloggingLex Nederbragt
 
How to sequence a large eukaryotic genome
How to sequence a large eukaryotic genomeHow to sequence a large eukaryotic genome
How to sequence a large eukaryotic genomeLex Nederbragt
 
Assembly of metagenomes
Assembly of metagenomesAssembly of metagenomes
Assembly of metagenomesLex Nederbragt
 
NGS techniques and data
NGS techniques and data NGS techniques and data
NGS techniques and data Lex Nederbragt
 

Plus de Lex Nederbragt (12)

Why of version control
Why of version controlWhy of version control
Why of version control
 
Assembly: before and after
Assembly: before and afterAssembly: before and after
Assembly: before and after
 
Improving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBioImproving and validating the Atlantic Cod genome assembly using PacBio
Improving and validating the Atlantic Cod genome assembly using PacBio
 
Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)? Repeat after me: Is our research reproducible (enough)?
Repeat after me: Is our research reproducible (enough)?
 
A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...A different kettle of fish entirely: bioinformatic challenges and solutions f...
A different kettle of fish entirely: bioinformatic challenges and solutions f...
 
Combining PacBio with short read technology for improved de novo genome assembly
Combining PacBio with short read technology for improved de novo genome assemblyCombining PacBio with short read technology for improved de novo genome assembly
Combining PacBio with short read technology for improved de novo genome assembly
 
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
Updated: New High Throughput Sequencing technologies at the Norwegian Sequenc...
 
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
New High Throughput Sequencing technologies at the Norwegian Sequencing Centr...
 
How and why I use blogging
How and why I use bloggingHow and why I use blogging
How and why I use blogging
 
How to sequence a large eukaryotic genome
How to sequence a large eukaryotic genomeHow to sequence a large eukaryotic genome
How to sequence a large eukaryotic genome
 
Assembly of metagenomes
Assembly of metagenomesAssembly of metagenomes
Assembly of metagenomes
 
NGS techniques and data
NGS techniques and data NGS techniques and data
NGS techniques and data
 

Dernier

Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Nistarini College, Purulia (W.B) India
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptMAESTRELLAMesa2
 
Boyles law module in the grade 10 science
Boyles law module in the grade 10 scienceBoyles law module in the grade 10 science
Boyles law module in the grade 10 sciencefloriejanemacaya1
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksSérgio Sacani
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxpradhanghanshyam7136
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisDiwakar Mishra
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )aarthirajkumar25
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...Sérgio Sacani
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptxRajatChauhan518211
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...jana861314
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...anilsa9823
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfSumit Kumar yadav
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSérgio Sacani
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfmuntazimhurra
 

Dernier (20)

Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.ppt
 
Boyles law module in the grade 10 science
Boyles law module in the grade 10 scienceBoyles law module in the grade 10 science
Boyles law module in the grade 10 science
 
Engler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomyEngler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomy
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disks
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptx
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptx
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
 
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdf
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdf
 

Coding & Best Practice in Programming in the NGS era

Notes de l'éditeur

  1. pre-merge code reviews.pair programming issue tracking
  2. develop the reference materials, reference data, and reference methods needed to assess performance of human genome sequencing.