Gene tagging

1. Molecular tagging of genes- an
overview
Submitted to: Submitted by:
Dr. V.K. Chaudhary Kirti
(Department of Molecular Ph.D (MBB)
Biology and Biotechnology) 2012BS26D
Advances in crop improvement (MBB 604)

2. Gene tagging
Gene tagging refers to the identification of existing DNA or the
introduction of new DNA that can function as a tag or label for the
gene of interest.
 Gene tagging is a most common method used today for selection
against different biotic and abiotic stress resistances studies in crop
plants.
 There are four different strategies used for gene tagging.

3. Types of gene tagging
 Marker based gene tagging
 Transposon tagging
 T-DNA tagging
 Epitope tagging

4. Marker based gene tagging
A Molecular marker is a DNA sequence which is readily detected and whose
inheritance can be easily monitored.
The effectiveness of molecular markers depends on their ability to identify
variation in the DNA of a population, known as marker polymorphism
Molecular markers are detected as differences in DNA fragment size, which arise
from differences in DNA sequence.
Molecular markers are widely used in marker-assisted breeding for tagging of
an important trait or traits in a breeding program.

5. Types of DNA Marker can be differentiated based on molecular technique used to
develop the marker
- Hybridization (eg, RFLP)
- PCR (eg, SSR)
- Sequencing (eg, ESTs)
The genome size of most plant species ranges between 108 to 1010 base pairs, so even a
small proportion of variation in DNA can yield a large number of potential markers
(Paterson et al., 1991).
Desirable properties for a good molecular marker
High Polymorphic
Co-dominant inheritance
Easy, fast and cheap to detect
High resolution with large number of samples
Nondestructive assay
Random distribution throughout the genome
Assay can be automated

6. Polymorphism
-Parent 1 : one band
-Parent 2 : a smaller band
-Offspring 1 : heterozygote = both bands
-Offspring 2 : homozygote
Polymorphism
Parent 1 : one band
-Parent 2 : no band
-Offspring 1 : homozygote parent 1
P 2P 1 O 2O 1
Gel configuration
Co-dominant marker
P 2
Gel configuration
P 1 O 1 O 2
Dominant marker

7. .
Restriction Fragment Length Polymorphism
RFLP (The first type of DNA markers that were used for genetic mapping were RFLPs
(Botstein et al., 1980)
co-dominant
marker
Disadvantages
– Time
consuming
– Expensive
– Use of
radioactive
probes
RFLP

8.  The term microsatellites was coined by Litt and Lutty (1989).
 Regions of genome where a short (1-6 base) motif is repeated many times (can be
repeated 10 to 100 times).
 If the nucleotide sequences in the flanking regions of microsatellites are known, specific
primers can be designed to amplify the microsatellite by PCR.
Simple Sequence Repeats (SSR): Microsatellites
Sequence Primer
ACTGTCGACACACACACACACGCTAGCT (AC)7
TGACAGCTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACGCTAGCT (AC)8
TGACAGCTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACGCTAGCT (AC)10
TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA
ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12
TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA

9. AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2
P1 P2
SSR polymorphisms
Gel configuration
 These microsatellite repeat sequences are usually polymorphic in different lines
because of variations in the number of repeat units.
 These are used as co-dominant genetic markers.
 They have high genomic abundance.
 SSR offer the additional advantage that they do not involve the use of
restriction endonucleases, thus avoid the problems associated with partial
digestions.
 Evenly distributed throughout the genome.
 Interpretation of result is simple.
 Easily automated, allowing multiplexing.
 Good analytical resolution and high
reproducibility.
 Require very little and not necessarily high
quality DNA.
 Costly primer developing.

10.  These markers are based on variation of single nucleotide between two or more
genotypes or individuals.
 They are more abundant polymorphic marker with 2-3 polymorphic sites
every kilobase (Cooper et al., 1985).
 In plants, SNPs are very abundant- in wheat 1 SNP per 20 bp and in maize 1 SNP
per 70 bp in certain regions of their genotype.
DNA strand 1 differs from DNA strand 2 at
a single base-pair location (a C/T
polymorphism).
Single Nucleotide Polymorphisms (SNPs)
 .
Hybridization using fluorescent dyescostly
labour oriented

11. Expressed Sequence Tags (ESTS)
 ESTs are small pieces of DNA usually 200-500 nucleotide long.
 Their location on the chromosome and sequence are known
 ESTs are created from cDNA, a single strand of DNA that has been copied
from an mRNA molecule i.e. it consist only of exon.
 - the method is fast
 - doesnot require
 radioactive material

 - sequence information
 is required

12. Molecular tagging of genes for biotic stress resistance
Biotic Stress is stress that occurs as a result of damage done to plants by
other living organisms, such as bacteria, viruses, fungi, parasites, beneficial
and harmful insects, weeds, and cultivated or native plants.
To combat resistance to biotic stresses different molecular techniques are
used these days. Restriction fragment length polymorphism (RFLP) have
been used for the molecular tagging of various agronomic traits in different
crop species.

13. Journal of Plant Pathology (2010), 92 (2), 495-501
Marker-assisted breeding for resistance to bacterial leaf blight in
popular cultivar and parental lines of hybrid rice
M.L. Shanti, V.V. Shenoy, G. Lalitha Devi, V. Mohan Kumar, P. Premalatha, G. Naveen Kumar, H.E.
Shashidhar, U.B. Zehr and W.H. Freeman
 Bacterial blight (BB) elicited by Xanthomonas oryzae pv. oryzae (Xoo) is one of the
most devastating diseases across the tropics and semi-tropics.
 Molecular markers are becoming essential components in breeding programs involving
gene pyramiding.
 Using marker-assisted selection in a backcross-breeding program, four bacterial blight
resistant genes namely Xa4, xa5, xa13 and Xa21 have been introgressed into the
hybrid rice parental lines KMR3, PRR78, IR58025B, Pusa 6B and the popular Mahsuri.
 IRBB60, a near isogenic line carrying the four resistant genes Xa4, xa5, xa13 and Xa21
served as the donor for all the crosses attempted.

14.  DNA isolation for PCR analysis of the parents and backcross progenies was carried out. Three
sequence-tagged-site (STS) markers Npb 181, RG 136 and pTA 248, tightly linked to Xa4,
xa13 and Xa21 and one simple sequence repeat (SSR) marker RM 122 tightly linked to xa5
was used to confirm the presence of each gene and the different combinations.
 Screening for BB resistance. The pyramided lines in the backgrounds of Mahsuri, KMR3 and
PRR78 were evaluated for their reaction to BB under glasshouse conditions.
 Marker-assisted selection for BB resistant genes :Nine F1 plants from each of the
crosses between Mahsuri/IRBB60 , KMR3/IRBB60, PRR78/IRBB60, IR58025B/IRBB60,
Pusa 6B/IRBB60 were tested for their heterozygosity for the R gene linked markers and were
backcrossed using the female parent.
 The resulting BC1 F1 lines were first checked for presence of the Xa21 resistance allele.
 All plants carrying the resistant allele were checked for the presence of the xa5 allele in
heterozygous condition.
 Plants containing resistant alleles for both genes were further screened for the Xa4 gene
using Npb 181.
 Finally, the triple positives were screened for the presence of xa13 allele.

16. .
 Phenotyping of these target plants was done at the field level and only those
showing the maximum similarity to the recurrent parent and showing high
yield were selected.
 This was continued up to the BC3F1 generation. BC3F2 that were screened
using the R gene linked markers to identify plants that were homozygous for
different R genes or their combinations.
 Disease resistance The gene pyramids in the backgrounds of Mahsuri,
KMR3 and PRR78 showed a very high degree of resistance as compared to
their parents to all the Xoo isolates inoculated.
 There were varying degrees of resistance to each of the isolates, but no isolate
could break the resistance of any of the four-gene pyramids.

17.  The defining property of transposable elements (jumping genes) is their
mobility; i.e. they are genetic elements that can move from one position to
another in the genome.
 Transposon tagging is a gene cloning strategy that relies on the transposon to
provide a DNA “tag” with a known sequence .
 The transposon sequence is used to identify DNA sequences adjacent to the
transposable element.
 Some transposable elements move in a replicative manner, whereas others are
nonreplicative, i.e. they move without making a copy of themselves.
 Transposons describe the DNA which can be cut away from one site and paste
to other place within the genome (cut and paste mechanism).
Transposon Tagging

18. Retrotransposon make themselves a copy and then paste to other position
within the genome.
The moving of retrotransposons involves RNA but not in transposons.
 The maize transposable element Activator (Ac) first identified by McClintock
(1948) is a kind of transposon widely used for creating MGE (mobile genetic
element) insertions.
 Ac element can insert themselves into genes. The mutations caused are unstable
because the Ac element can be excised from the inserted gene by the transposase
which is coded by Ac element itself.
 Dissociation (Ds) element is usually stable because they are incapable of
excising itself from the inserted gene unless with the help of Ac element.
 Researchers combine these two mobile elements and named it as the Ac/Ds
system to generate mutant populations.
.
.

19.  TEs occur in families of
related sequences, defined by
their ability to interact
genetically. Within any one
family, individual elements
occur in two forms:
“Autonomous” element-
structurally conserved element
capable of promoting its own
excision.
“Non-autonomous”
elements- structurally
heterogeneous group of
elements unable to promote
their own excision.
 Non-autonomous elements
from one family can be trans-
activated only by the
autonomous member of the
same family.

20. Examples of such families of plant TEs include Activator-Dissociation
(Ac/Ds) from maize.
Other examples of Ac-Ds system includes Arabidopsis thalliana and carrot,
potato, tomato, petunia, soybean, etc.
 This strategy incorporates the transgene of interest into a Ds element, and
introduces the construct either into plants that already contain an Ac-
transposase gene, or co-transforms this construct with an Ac-
transposase gene into the plant species of interest.
The reddish streaks on these corn grains are caused by transposons

21.  The individual Ds parental lines and Ac
parental lines are created by
transformation of Ac element and Ds
element independently into the host
organism.
 Then the two parental lines are crossed
to induce the translocations of the Ds
element in the next generation.
 By crossing Ac parent line and Ds parent
line, Ds element is activated- Ds
element transfer from one position to
another position within the genome which
will create random disruption of gene
functions in the following generations.

22.  Some transposition events inactivate
genes, since the coding potential or
expression of a gene is disrupted by
insertion of the transposable element.
 A classic example is the r allele of the
gene encoding a starch branching
enzyme in peas is nonfunctional due to
the insertion of a transposable element.
 This allele causes the wrinkled pea
phenotype in homozygotes originally
studied by Mendel.
 In other cases, transposition can
activate nearby genes by bringing an
enhancer of transcription (within the
transposable element) close enough to a
gene to stimulate its expression.
 In other cases, no obvious phenotype
results from the transposition.Schematic of a transposon-tagged
mutation.

23. Transposon tagging is of two types :
(a) directed tagging
(b) non-directed tagging
Directed Tagging :
 Directed transposon tagging recovers
mutations at a specific locus of interest.
 Directed tagging identifies transposon-
induced alleles by crossing transposon-
active plants with a reference allele of the
mutation.
 The mutable alleles are separated from the
reference allele by crossing the F1 to a
standard line (hybrid, inbred, or tester).
 To identify a co-segregating transposon,
the mutable allele is backcrossed into the
standard line, and the backcrossed
progeny are self-pollinated.

24. Non-directed Tagging :
 Directed tagging is limited to mutants
that are non-essential for a plant to
complete its life cycle. This approach
requires a homozygous mutant tester and
detects tagged alleles via a mutant
phenotype in the F1.
 If a mutant is lethal or infertile, a
heterozygous tester could be generated.
 Tagged-alleles would be recovered at half
the frequency due to the segregation of
the mutation in the tester.
 However, most mutants would be lost in
the first generation after the directed
tagging crosses.

25. .
 Many lethal or infertile mutants have been cloned by transposon tagging. The
tagged alleles of these mutants are identified from non-directed tagging.
 For non-directed tagging, transposon-active stocks are generally crossed to a
standard line and the resulting progeny are self-pollinated.
 The self-pollinated families are screened for recessive mutants and segregating
populations are generated by backcrossing into the standard line.
 Segregating populations of the mutable alleles are then screened by DNA gel
blot or with PCR methods to identify transposon insertions that co-segregate
with the mutable phenotype.
 Although both schematics show the transposon parent as a pollen parent,
transposon mutagenesis can be completed with either a male or a female
transposon parent.

26. T-DNA tagging
 T-DNA of Agrobacterium, generally used as a vector in genetic
transformation, could also be considered as a insertional mutagen (Koncz et
al., 1989) and with its sequence characterized T-DNA could also be used as a
tag (Koncz et al., 1990).
 Insertion of foreign DNA can alter the expression of neighbouring gene,
resulting in gain or loss of function which produces a screenable phenotype
the sequence of the tag provided a landmark allowing its isolation along with the
mutated gene
 Many integrate within transcriptional units so that promoters, enhancers,
exons and introns can be tagged.

27. The integrated T-DNA is genetically stable and however from time to time,
regions within the T-DNA can become methylated and the resultant
reduction in gene expression can result in phenotypic instability.
DNA transferred to the plant genome is precisely defined by the border
sequences. The genes encoded by the T-DNA can be replaced without
interfering with the transfer process.
Why T-DNA?
1. Active transposons do not exist in every species including Arabidopsis.
2. Agrobacterium-mediated transformation is simpler.
3. More likely to generate simpler full-length integration as compared to
other methods.
4. T-DNA insertion mainly occurs in transcriptionally active area of the
genome.
5. The mutated locus gets tagged.

28.  TYPES OF T-DNA TAGGING
(a) Promoter tagging
(b) Activation tagging
 Earlier , T-DNA used as a tag involved linking a promoter less
marker gene to the border of the T-DNA and selecting for
transgenics.
 A concern with this type tagging is that only gene fusions
expressed at the time of selection may be recovered and that T-
DNA insertions can occur at high copy (Koncz et al., 1989, 1992).
A. Promoter Tagging :

29.  Promoter tagging work has focused on preliminary selection for
transformants being based on constitutive expression of a marker gene
followed by screening for expression of a promoter-less marker gene to
identify events where a promoter has been tagged.
 Other promoter-less marker genes have been adopted that are easier
to screen for activity of tagged promoters such as β-glucuronidase
(GUS) and luciferase (LUX).
B. Activation Tagging :
Activation tagging is a gain-of-function method that generates transgenic
plants by T-DNA vectors with tetrameric cauliflower mosaic virus (CaMV) 35S
enhancers which can lead to an enhancement expression of adjacent genes.
Differently from the action of the complete CaMV 35S promoter, CaMV 35S
enhancers can activate both the upstream and downstream gene transcription.

30. Activation tagging technique was firstly developed by Walden and colleagues .
Since then, several large scale activation tagging mutant resources have been
generated and activation tagging method was widely used to isolate new
genes.
As an early example, the activation-tagging technique was used in tissue
culture to identify cytokinin-independent mutants in Arabidopsis and CKI1
gene whose overexpression can bypass the requirement for cytokinin in the
regeneration of shoots was identified.
Activation tagging has identified a number of genes fundamental to plant
development, metabolism and disease resistance in Arabidopsis.
A further limitation to the present generation of T-DNA activation tagging
vectors is the tissue specificity of the CaMV 35S enhancer sequence
(Benfey and Chua 1989). For example, while this enhancer is active in leaves
it has poor activity in roots.

31. Utilization of T-DNA Tagging Lines in Rice
Jakyung Yi and Gynheung An
J. Plant Biol. (2013) 56:85-90
Rice is a good model plant for cereal research because of its small genome size and
well established procedures for stable transformation (An et al.,1988).
The insertion mutants generated by T-DNA has been the most commonly used.
By sequencing PCR-amplified fragments near the inserted elements, researchers have
been able to construct various flanking sequence databases
(http://signal.salk.edu/cgi-bin/RiceGE).
Five binary vectors (pGA2144, pGA2707, pGA2715, pGA2717, and pGA2772) were
used for insertion mutagenesis.

32. All contain the hygromycin-resistance gene hph,
which was constructed using the α-tubulin
promoter with its first intron, the coding region
of hph, and the terminator from T7 or α-tubulin.
These vectors also carry the promoterless β-
glucuronidase (gus) with a synthetic intron.
This feature allows for a high frequency translational fusion between the tagged gene and gus
when the reporter gene is inserted within a gene in the same direction.
When a translation fusion occurs, expression patterns for the tagged gene can be easily
analyzed at the cellular level through simple GUS analysis.
In pGA2715 and pGA2772, multimerized transcriptional enhancers from the cauliflower
mosaic virus 35S promoter were placed next to the left border.
The enhancer can increase expression of nearby genes at the T-DNA insertion site. These
activation tagging vectors produce gain-of-function mutants that have several advantages over
knockout mutants.

33. Epitope tagging
 An epitope (also called an antigenic determinant) is any
structure or sequence that is recognized by an antibody. A
single large molecule such as a protein may have many
epitopes.

34. Epitope Tagging:
DNA: AAAGATGAATCAG ... ACATCGTGACCTA...
Protein: N-Met-Asn-Gln-…-Thr-Ser-C
epitope:
DNA: TATCCCTACGACGTTCCGGATTATGCC
Protein: N-Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-C
Fusion Gene:
AAAGATGTATCCCTACGACGTTCCGGATTATGCC AATCAG...
Fusion Protein:
N-Met-Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-Asn-Gln-…-Thr-Ser-C

35.  Epitope tagging offers several advantages over other methods of analyzing and
purifying proteins:
 Epitope tagging is much faster than the traditional method of producing a new
antibody to every protein studied. The same tag-specific antibody will recognize
the epitope tag in many different proteins.
 Epitope tagging is much less costly and labor intensive than setting up and
maintaining antibody-producing facilities.
 Adding a small (3–14 amino acid) epitope tag generally does not affect the
function of the tagged protein, allowing the study of the tagged protein’s role in
the cell.
 Epitope tagging makes it possible to gather information about proteins that
would otherwise be too difficult to purify or too similar to other proteins to be
distinguished in vivo.

36. pLMI carries a fusion gene consisting of the c-
myc epitop tag and the DNA binding domain
(GC) of the wheat EmBP-1 gene (Guiltinan et
al., 1990).
Guiltinan MJ and McHenry L, Methods in cell biology, vol. 49

37. THANK YOU !!!!