"O uso da plataforma HPC na descoberta de doenças genéticas" . David Santos Marco Antonio - IB/USP.

•

0 j'aime•494 vues

lccausp

"O uso da plataforma HPC na descoberta de doenças genéticas", presented on http://3whpc.lcca.usp.br

Santé & Médecine

O uso da plataforma HPC na
descoberta de doenças genéticas
David Santos Marco Antonio. PhD
Profa. Maria Rita Passos Bueno
Laboratório de Genética do Desenvolvimento Humano
Departamento de Genética e Biologia Evolutiva
Instituto de Biociências - USP
Finding the variability that could
explain genetic disorders.

DNA : Chromosome : Genes
DNA: A T C G
Chromosomes:
1 – 22
X and/or Y
Mitochondrial

http://en.wikipedia.org/wiki/Human_genome
DNA : Chromosome : Genes

Human genetic variation in populations
• Genes on the same order
• Mapped using reference genome: hg19, GRCh38.
• Variability among relatives/populations.
• Susceptibility to diseases.
• Improvements.
Falar sobre populações
1000Genomes

Human genetic variation in populations
Haplogroups YMitochondrial DNA

Disorder Mutation Chromosome
22q11.2 deletion syndrome D 22q
Angelman syndrome DCP 15
Canavan disease 17p
Charcot–Marie–Tooth disease
Color blindness P X
Cri du chat D 5
Cystic fibrosis P 7q
Down syndrome C 21
Duchenne muscular dystrophy D Xp
Haemochromatosis P 6
Haemophilia P X
Klinefelter syndrome C X
Neurofibromatosis 17q/22q/?
Phenylketonuria P 12q
Polycystic kidney disease P 16 (PKD1) or 4 (PKD2)
Prader–Willi syndrome DC 15
Sickle-cell disease P 11p
Tay–Sachs disease P 15
Turner syndrome C X
 P – Point mutation: InDel.
 D – Deletion of gene.
 C – Whole chromosome
extra/missing.
 T – Nucleotide repeat disorders.
Human Genetic Diseases

Genomic Sequencing
• Terabytes of data/sequencing.
• Storage.
• Processing.
• Lots of RAM.
Ben Moore

Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
Recalibration

Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
RecalibrationVariant Calling

Data Processing
STEPS
Variant Calling
dbSNP
SIFT
PolyPhen OMIM
exac03
6500
Exomes1000
Genomes
Clinical
Relevant Data

High Computational Cost
• Storage.
• RAM.
• CPU.
• Reprocessing.
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
Fastq format

Research
• Authism
• Cranio-fascial development
• Richieri-Costa
• Down
Diseases Models
• Human
• Zebra fish
• Drosophila
• Microbiome

Acknowledgements
• LCCA
• Guys in LCCA
• Guys in LCCA
• Profa. Maria Rita Passos Bueno
• Laboratório de Genética do Desenvolvimento Humano
• Instituto de Biociências.
• USP

Contenu connexe

Tendances

Htlv 1

parisa amirkalvanagh

Bio263 Who is our Closest Relative

Mark Pallen

Oncolytic herpes simplex virus (oHSV) is one of oncolytic viruses being studied in cancer therapeutic research and several oHSVs have been investigated in clinical trials. ith the increasing experience and knowledge of HSV system, Creative Biolabs commits to developing efficacious oncolytic herpes simplex virus and enabling wider applications in oncolytic virotherapy of cancers. https://www.creative-biolabs.com/oncolytic-virus/oncolytic-herpes-simplex-virus.htm

oncolytic herpes simplex virus

CandySwift_NY

Antiviral Hammerhead ribozymes are ef

Siddhesh Sapre

Repeated detection of frog virus 3 during aquaculture health surveys

mgray11

Doddinobelprizepresentation

sdoddi11

Artigo - Bárbara

Rodrigo Tinoco

Phytothreats: WP4 overview

Forest Research

Letermovir is an antiviral with a novel mechanism of action, recently received FDA approval for prophylactic treatment against CMV in GVHD patients. In the approved use, letermovir is administered through week 14 which is about 100 days post-transplant of the allograft. This slideset discusses the subsequent study in which letermovir is investigated for its efficacy when administered beyond weak 14 or 100 days, i.e., extended course letermovir prophylaxis.

Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...

Vijay Elipay

Carcinogenesis , invasion & metastasis

Charith Kumara

Oncolytic viruses (OVs) are therapeutically useful viruses which selectively infect and damage cancerous tissues without causing harm to normal tissues. Every virus has a specific cellular tropism that determines which tissues are preferentially infected, and what disease is caused. A number of naturally occurring viruses have a preferential, although non-exclusive, tropism for tumors and tumor cells. This probably has more to do with tumor biology than with virus biology as most tumors have evolved not only to avoid immune detection and destruction but also to resist apoptosis and translational suppression, which are the crucial responses used by normal cells to limit a virus infection. OVs can kill infected cancer cells in a number of different ways, ranging from direct virus-mediated cytotoxicity through various cytotoxic immune effector mechanisms.

Oncolytic Virotherapy

Stella Evelyn

Viruses and cancer

Robert J Miller MD

GKA deel 1 college 15

Biology, Utrecht University

My first proposal, Everyone knows a person that have or had Cancer. We know that Cancer dosen't have a cure an yet the therapies for it, sometimes, do more harm to the person because the therapy do not choose what kind of cell is going to destroy. But if we can develop a new kind of treatment, a less agresive and more effective one, we will increase the survival chances and minimizes the secondary efects.

Presentacio¦ün nicole 2

Nicole Rivera

The Origin of Ashkenazi Levites

Family Tree DNA

Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz

Pistoia Alliance

Retroviruses and HIV

Tấn Hào Lâm

Bio263 Lecture 2: Becoming human

Mark Pallen

NetBioSIG2014-Talk by Yu Xia

Alexander Pico

Hum evolgen2011 scatterlingsofafrica

Mark Pallen

Tendances (20)

Htlv 1

Bio263 Who is our Closest Relative

oncolytic herpes simplex virus

Antiviral Hammerhead ribozymes are ef

Repeated detection of frog virus 3 during aquaculture health surveys

Doddinobelprizepresentation

Artigo - Bárbara

Phytothreats: WP4 overview

Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...

Carcinogenesis , invasion & metastasis

Oncolytic Virotherapy

Viruses and cancer

GKA deel 1 college 15

Presentacio¦ün nicole 2

The Origin of Ashkenazi Levites

Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz

Retroviruses and HIV

Bio263 Lecture 2: Becoming human

NetBioSIG2014-Talk by Yu Xia

Hum evolgen2011 scatterlingsofafrica

En vedette

"The BG collaboration, Past, Present, Future. The new available resources". P...

lccausp

“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...

lccausp

“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...

lccausp

“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.

lccausp

"The topological instability model for metallic glass formation: MD assessmen...

lccausp

“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...

lccausp

"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...

lccausp

Ud.13. genética mendeliana nuevo

biologiahipatia

“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...

lccausp

En vedette (9)

"The BG collaboration, Past, Present, Future. The new available resources". P...

“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...

“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...

“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.

"The topological instability model for metallic glass formation: MD assessmen...

“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...

"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...

Ud.13. genética mendeliana nuevo

“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...

Similaire à "O uso da plataforma HPC na descoberta de doenças genéticas" . David Santos Marco Antonio - IB/USP.

Genetics

Nikita Dewangan

Abraham B. Korol, Lecture presentation

Moshe Kenigshtein

Human genome project 1

surendran aduthila

GA4GH Monarch Driver Project Introduction

mhaendel

Voskarides 2nd aging symposium-unic 240514

Biomol

Biomol

Biomol

Comparitive genomic hybridisation

namrathrs87

Computing on Phenotypes AMP 2015

Chris Mungall

Addressing standardization challenges through integrated approaches in biomed...

Lynn Schriml

Whole genome sequencing (WGS) has enabled us to quantify human genomic variation at whole genome scale. This has profound impact on improving our understanding of human diversity, health, and diseases. One promising application of WGS is to identify disease-causal genes that can be therapeutically targeted. However, majority of disease-associated variants are located in non-coding regions or so-called genetic deserts, thus the exact function and biological consequences of these variants are unknown. In addition, with numerous variants in linkage disequilibrium (LD), genetic sequence itself is insufficient to infer the likely causal variant(s) among many variants in a region of association. Studies have shown that majority of these variants reside in gene regulatory regions and preferentially in cell type-specific enhancers, providing insights into disease relevance. Novel cutting-edge sequencing technologies to configure 3D genomic structure and to build tissue-specific gene regulatory landscapes can link regulatory elements to their targeted genes. This allows us to associate disease-associated variants and their underlying genes targets. In this talk, we demonstrate a new approach to incorporate 3D genomic structure and chromatin states of gene regulatory landscapes in a deep learning framework to predict functions of disease-associated variants and their targeted genes. This approach can significantly improve our understanding of the functional importance of those otherwise unknown genetics variants. It allows us to evaluate and prioritize high-impact variants and their targeted genes for development of new drug intervention.

Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...

Databricks

Gabbay Award Lecture

ahandyside

Human genetic technologies

Aparna Chaudhary

Dan Geschwind, MD, PhD: Advances in Genetics 2016

Semel Admin

POSTGENETICS MEDICINE

inemet

DNA Methylation & C Value.pdf

soniaangeline

TLSC Biotech 101 Noc 2010 (Moore)

jmoore89

Describe in your own words the benefits, but also the problems of having the human genome deciphered. Write several paragraphs. Solution The history of the human race has been filled with curiosity and discovery about our abilities and limitations. As an egotistical creature with a seemingly unstoppable desire for new accomplishments, we attempt feats with emotion and tenacity. People worldwide raced to be the first to discover the secrets and the ability of flight. Enormous amounts of monies were spent on sending people into space and the race to land on the moon. With the rapid growth of scientific knowledge and experimental methods, humans have begun to unravel and challenge another mystery, the discovery of the entire genetic make-up of the human body. This endeavor, the Human Genome Project (HGP), has created hopes and expectations about better health care. It has also brought forth serious social issues. To understand the potential positive and negative issues, we must first understand the history and technical aspects of the HGP. History of the Human Genome Project The HGP has an ultimate goal of identifying and locating the positions of all genes in the human body. A researcher named Renato Dulbecco first suggested the idea of such a project while the U.S. Department of Energy (DOE) was also considering the same project because issues related to radiation and chemical exposure were being raised. Military and civilian populations were being exposed to radiation and possible carcinogenic chemicals through atomic testing, the use of Agent Orange in Vietnam, and possible nuclear power facility accidents. Genetic knowledge was needed to determine the resiliency of the human genome. Worldwide discussion about a HGP began in 1985. In 1986, the DOE announced its\' Human Genome Initiative which emphasized the development of resources and technologies for genome mapping, sequencing, computation, and infrastructure support that would lead to the entire human genome map. United States involvement began in October 1990 and was coordinated by the DOE and the National Institute of Health (NIH). With an estimated cost of 3 billion dollars, sources of funding also include the National Science Foundation (NSF) and the Howard Hughes Medical Institute (HHMI). Because of the involvement of the NIH, DOE, and NSF who receive U.S. Congressional funding, the HGP is partly funded through federal tax dollars. Expected to last 15 years, technological advancements have accelerated the expected date of completion to the year 2003. This completion date would coincide with the 50th anniversary of Watson and Crick\'s description of the structure of DNA molecule. Human Genome Project Goals The specific goals of the HGP are to:: Technical Aspects of the HGP Mapping Strategies To sequence the human genome, maps are needed. Physical maps are a series of overlapping pieces of DNA isolated in bacteria. Physical maps are used to describe the DNA\'s chemical characteristics..

Describe in your own words the benefits, but also the problems of ha.pdf

arenamobiles123

Genes

MTD_2020

Similaire à "O uso da plataforma HPC na descoberta de doenças genéticas" . David Santos Marco Antonio - IB/USP. (20)

Genetics

Abraham B. Korol, Lecture presentation

Human genome project 1

GA4GH Monarch Driver Project Introduction

Voskarides 2nd aging symposium-unic 240514

Biomol

Comparitive genomic hybridisation

Computing on Phenotypes AMP 2015

Addressing standardization challenges through integrated approaches in biomed...

Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...

Gabbay Award Lecture

Human genetic technologies

Dan Geschwind, MD, PhD: Advances in Genetics 2016

POSTGENETICS MEDICINE

DNA Methylation & C Value.pdf

TLSC Biotech 101 Noc 2010 (Moore)

Describe in your own words the benefits, but also the problems of ha.pdf

Genes

Dernier

Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available WhatsApp Chat : +91-8854095900 Get More Information About Mussoorie Escorts Service Mussoorie Escorts offer their services to their clients at any time of day or night - including sex, travel and tours. Contact them via telephone or the internet. Hire an escort as your movie partner, date or party companion - they're sure to exceed all your expectations. Girls available 24/7 make for great companions who offer sensual body massages and drinks/food service during your time together. Find one who fits with your personality or budget - these girls have you covered.

Call Girls Mussoorie Just Call 8854095900 Top Class Call Girl Service Available

Janvi Singh

Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 6378878445 Call Girls VIP Call Girl Bangalore As Enjoy Never Ending Bangalore VIP Call Girls is highly qualified professionals. #S10 They will offer only top quality services and never try to scam or drain you of money; in fact, they strive to give complete satisfaction so that each cent spent was worth its worth. Furthermore, these professionals pride themselves in keeping customer details confidential; any information gleaned will never be shared with any third party. Two shots with one girl: ₹4500/in-call, ₹7500/out-call Body to body massage with : ₹5500/in-call Full night for one person: ₹7000/in-call, ₹12000/out-call •𝐂𝐨𝐥𝐥𝐞𝐠𝐞 𝐆𝐢𝐫𝐥𝐬 •𝐇𝐨𝐮𝐬𝐞𝐰𝐢𝐯𝐞𝐬 •𝐇𝐢𝐠𝐡 𝐏𝐫𝐨𝐟𝐢𝐥𝐞 𝐆𝐢𝐫𝐥𝐬 •𝐑𝐚𝐦𝐩 𝐌𝐨𝐝𝐞𝐥𝐬 •𝐅𝐨𝐫𝐞𝐢𝐠𝐧𝐞𝐫 𝐆𝐢𝐫𝐥𝐬 𝐎𝐮𝐫 𝐞𝐬𝐜𝐨𝐫𝐭 𝐬𝐞𝐫𝐯𝐢𝐜𝐞𝐬 •𝐇𝐉 (𝐇𝐚𝐧𝐝 𝐉𝐨𝐛) •𝐁𝐉 (𝐁𝐥𝐨𝐰𝐣𝐨𝐛) # Completion # (Oral To Completion) # Special Massage # O-Level (Oral ) # Oral With A Noncondom) # COB (Come On Body) # Extraball (Have Many Times) # All Meetings 100%Safe 𝐭𝐡𝐞 𝐝𝐮𝐫𝐚𝐭𝐢𝐨𝐧 𝐨𝐟𝐟𝐞𝐫𝐞𝐝 𝐦𝐚𝐲 𝐞𝐱𝐭𝐞𝐧𝐭 15 𝐦𝐢𝐧𝐮𝐭𝐞𝐬 𝐚𝐜𝐜𝐨𝐫𝐝𝐢𝐧𝐠 𝐭𝐨 𝐲𝐨𝐮𝐫 𝐧𝐞𝐞𝐝 𝐰𝐡𝐞𝐫𝐞 𝐲𝐨𝐮 𝐰𝐢𝐥𝐥 𝐧𝐨𝐭 𝐛𝐞 𝐜𝐡𝐚𝐫𝐠𝐞𝐝 𝐟𝐨𝐫 𝐭𝐡𝐚𝐭 𝐝𝐮𝐫𝐚𝐭𝐢𝐨𝐧 . ✓𝐢𝐟 𝐲𝐨𝐮 𝐰𝐚𝐧𝐭 𝐭𝐨 𝐬𝐩𝐞𝐧𝐝 𝐬𝐨𝐦𝐞 𝐦𝐨𝐫𝐞 𝐭𝐢𝐦𝐞 𝐭𝐡𝐞𝐧 𝐲𝐨𝐮 𝐰𝐢𝐥𝐥 𝐛𝐞 𝐜𝐡𝐚𝐫𝐠𝐞𝐝 𝐞𝐱𝐭𝐫𝐚 𝐚𝐦𝐨𝐮𝐧𝐭 𝐰𝐡𝐢𝐜𝐡 𝐲𝐨𝐮 𝐡𝐚𝐯𝐞 𝐭𝐨 𝐩𝐚𝐲 𝐚𝐭 𝐭𝐡𝐞 𝐬𝐚𝐦𝐞 𝐭𝐢𝐦𝐞 . ✓𝐞𝐯𝐞𝐫𝐲 𝐭𝐡𝐢𝐧𝐤 𝐢𝐬 𝐚𝐥𝐥𝐨𝐰𝐞𝐝 𝐞𝐱𝐜𝐞𝐩𝐭 𝐚𝐧𝐚𝐥 𝐚𝐧𝐝 𝐬𝐞𝐫𝐯𝐢𝐜𝐞 𝐰𝐢𝐭𝐡𝐨𝐮𝐭 𝐩𝐫𝐨𝐭𝐞𝐜𝐭𝐢𝐨𝐧 . ✨✨𝐚𝐯𝐚𝐢𝐥𝐚𝐛𝐢𝐥𝐢𝐭𝐲 ✨✨ ✨✨𝐭𝐡𝐚𝐧𝐤𝐬 𝐲𝐨𝐮 ✨✨ 𝐒𝐚𝐭𝐢𝐬𝐟𝐲 𝐚𝐥𝐥 𝐲𝐨𝐮𝐫 𝐬𝐞𝐱𝐮𝐚𝐥 𝐜𝐫𝐚𝐯𝐢𝐧𝐠𝐬 100% 𝐩𝐫𝐞𝐦𝐢𝐮𝐦 𝐬𝐞𝐫𝐯𝐢𝐜𝐞 𝐆𝐢𝐫𝐥𝐬 𝐝𝐢𝐫𝐞𝐜𝐭𝐥𝐲 𝐭𝐨 𝐲𝐨𝐮𝐫 𝐥𝐨𝐜𝐚𝐭𝐢𝐨𝐧 𝐆𝐞𝐧𝐮𝐢𝐧𝐞 𝐚𝐧𝐝 𝐕𝐈𝐏 𝐦𝐨𝐝𝐞𝐥𝐬 𝐃𝐚𝐢𝐥𝐲 𝐮𝐩𝐝𝐚𝐭𝐞 𝐨𝐧 𝐧𝐞𝐰 𝐮𝐩𝐜𝐨𝐦𝐢𝐧𝐠 𝐦𝐨𝐝𝐞𝐥𝐬 𝐆𝐞𝐭 15% 𝐝𝐢𝐬𝐜𝐨𝐮𝐧𝐭 𝐨𝐧 𝐧𝐞𝐰𝐥𝐲 𝐚𝐫𝐫𝐢𝐯𝐞𝐝 𝐦𝐨𝐝𝐞𝐥𝐬 Call fast 👙👙💋 welcome guys 💋💋📞 6378878445

Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...

dishamehta3332

Cara Menggugurkan Kandungan Dengan Cepat Selesai Dalam 24 Jam Secara Alami Bu...

Cara Menggugurkan Kandungan 087776558899

❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amritsar Call Girls Service ☎️ Call Girls In Amritsar ❤️Amritsar Escort Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amritsar Call Girls Service ☎️ Call Girls In Amritsar BEST Call Girls in Amritsar Escort Service provide Cute Nice sweet and Sexy Models in beautiful Amritsar city cash in hand to hand call girl in Amritsar and Amritsar escorts. HOT & SEXY MODELS // COLLEGE GIRLS IN Amritsar AVAILABLE FOR COMPLETE ENJOYMENT WITH HIGH PROFILE INDIAN MODEL AVAILABLE HOTEL & HOME ★ SAFE AND SECURE HIGH CLASS SERVICE AFFORDABLE RATE ★ 100% SATISFACTION,UNLIMITED ENJOYMENT. ★ All Meetings are confidential and no information is provided to any one at any cost. ★ EXCLUSIVE Profiles Are Safe and Consensual with Most Limits Respected ★ Service Available In: - HOME & 24x7 :: 3 * 5 *7 *Star Hotel Service .In Call & Out call Services : ★ A-Level (5 star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob)Receive advanced sexual techniques in different mode make their life more pleasurable. ★ Spending time in hotel rooms ★ BJ (Blowjob Without a Condom) ★ Completion (Oral to completion) ★ Covered (Covered blowjob Without a Condom)Amritsar Call Girls

❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...

Sheetaleventcompany

Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Service Available Call Mrs Leela Ji +91-8005736733 We offer all types of girls of your choice with space. Our escorts are fully cooperative and understand your needs. All types of call girls like Housewives, College girls,#J11 Russian girls, Muslim girls, Afghani girls, Bengali girls, Working girls, south Indian girls, Punjabi girls, etc. In-Call: — You Can Reach At Our Place in Kolkata Our place Which Is Very Clean Hygienic 100% safe Accommodation. Out-Call: — Service for Out Call You have To Come Pick The Girl From My Place We Also Provide Door-Step Services Hygienic: — Full Ac Neat And Clean Rooms Available In Hotel 24 * 7 Hrs In Kolkata C010524HD Our Services and Rates: – One Shot — 2500/in call (time ½ hour), 5000/out call Two shot with one girl — 5000/in call (time 1 hour), 6000/out call Body to body massage with sex- 3000/in call (time 1 hour) full night for one person– 8000/in call, 10000/out call (shot limit 4 shot) We are available 24*7 all days of the year Call us — 8005736733 !! Thank you for Visiting.

Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...

Namrata Singh

Call Girls Shahdol Just Call 8250077686 Top Class Call Girl Service Available Easy & Fast Booking Procedure Of Shahdol Escorts Call girls are ready and waiting to provide the quality essentialness that will help ease away life's tensions Shahdol Escorts are regular companions of elite gentlemen and can take them places they could only dream of visiting. These ladies take great care in maintaining themselves to look appealing; visiting salons and spas regularly keeps them looking their best; their portfolios can be found online via an escort’s agency website. EXCITING OPTIONS AVAILABLE AT OUR INDEPENDENT ESCORTS Candlelight dinner Evening date Night clubs or parties Hotels or your flats Business trip Business party Stripping party Shahdol Escort Service are adept at performing wild anal sex, deep throat sex and cum eating - perfect for satisfying all your sexual needs and playing any game imaginable. Affordable professional assistants are readily available and ready to assist with any situation - be it romantic date or solo night. Their beautiful appearances and striking personalities will leave you speechless, while they can accompany you to restaurants or bars where their presence will surely leave an impression.

Call Girls Shahdol Just Call 8250077686 Top Class Call Girl Service Available

Dipal Arora

Call Girl Service In Jaipur 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰Advance Cash On Delivery Service Call Girl Near Me Booking Details Are here: just visit website: https://hotbabe24.com #Call Girl In Jaipur, #Jaipurcallgirls #CallgirlserviceJaipur, #CallgirlsinJaipur Website on rent : mailto:indiancallgirl4rent@gmail.com "Call Girls Jaipur VIP Call Girls Service Jaipur.. Booking Open Now We Are Providing Safe & Secure High Class girl women sucking men Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/ women seeking men in royal call girl High class luxury and premium call girl agency. ✔️High class luxury and premium escorts agency We Provide Well Educated, Royal Class Female, High-class Escorts agency offering a top high class escort service in the royal Escorts ✔️ Get High Profile queens , Well Educated , Good Looking , Full Cooperative Model Services. you can see me at my comfortable Hotels or I can visit you in hotel Our Service Available IN All Services 3/5/7 Star Hotels, In call /Out call Service 24/7.. ✔️ All Meetings We Provide Hottest Female With Me Are Safe And Consensual With Most Limits Respected Complete Satisfaction Guaranteed...Service Available In:- 24/7 3 * 5 *7 *Star Hotel Service In. In Call Out call service Avilable also. ✔️ I guarantee you to have an unforgettable experience with me A curvy body, long hair and silky smooth skin. She is an independent royal Escorts/Women Seeking Men model will give you more pleasure & Full satisfaction. ✔️ I am very sensual and flirtatious with charming personality! I love to laugh and my bright smile is ever Present. ,Hotel & Home Services CALL PLZZ ✔️Available Near All 3* 4* 5* 7* Hotels Of I Want Only Hotel Name , Guest Name , Room No. Only For Confirmation.✔️ Nandani... agency...⭐⭐⭐⭐⭐ VIP...Service ✣ ✤ ✥ ✦ TIME WASTERS AND BARGAINERS ARE PLEASE EXCUSE, WE RESPECT YOUR SAFETY AND PRIVACY AND EXPECT TH WHATSAPP: 9xx000xx09 CALL ME" 9xx000xx09

Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...

Sheetaleventcompany

Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun WhatsApp Chat: ☎️ +91-8854095900 Call Girls Dehradun offer you everything from intimate moments to wild nights - be it intimate or wild. Their girls are always prepared to meet all your needs and desires so you're assured a memorable experience with them. Beautiful Babes are sure to turn heads wherever they go, captivating men with their seductive personalities and captivating looks - not to mention their sensually alluring bodies that are sure to satisfy all your naughty fantasies, from blowjobs to anal massages; not forgetting BDSM and orgies as well. Show them some appreciation when the time is right. Call Girl Dehradun that their clients can be very demanding. To maintain their reputation and gain more clients, these sexy call girls always work tirelessly to provide exceptional service that ensures each customer's happiness - so much so that many men seek them out to have an unforgettable experience with Passionate about providing erotic pleasure for their clients - fulfilling all sexy fantasies while offering role play services such as BDSM. ★OUR BEST SERVICES: - FOR BOOKING ★ A-Level (5-star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob) ★ Spending time in my rooms ★ BJ (Blowjob Without a Condom) ★. Extra ball (Have ride many times) ☛ ☛ ☛ ✔✔ secure✔✔ 100% safe WHATSAPP CALL ME💥✨✨⭐⭐⚡💦💦💨🔥💫💫 Their services range from erotic encounters and movie dates to in-call and out-call services, making this option available 24/7. Available for services including NSA, threesomes and foursomes sessions as well as massage services and casual foreplay - they even provide real girlfriend experience. Find one online or visit local women's clubs, hotels or restaurants. Hiring a Dehradun call girl for an evening or day out can be the perfect addition to your social gathering or office event, or you could arrange for her to visit your home or hotel room. Not only are these women gorgeous, they're intelligent as well, with great senses of humor - sure to please and leave you wanting more. If you want a cheap escort in Dehradun, look for someone who is either a student or works part time so that she will always be available when you need her. In addition to this, look for housewives as this ensures they have stable lives that can keep you satisfied for extended periods. These beautiful ladies will capture your attention at first sight with stunning eyes and full, seductive lips; not to mention a seductive personality that makes you want to spend more time with them; moreover they are discreet enough to meet up anywhere nearby! Hiring a call girl in Dehradun can be done through either the internet or calling her directly, with services like massage or sex sessions offered to request from specific agencies within a few hours of making contact. Furthermore, text the girl directly for price quotes!

Dehradun Call Girl Service ❤️🍑 8854095900 👄🫦Independent Escort Service Dehradun

Sheetaleventcompany

Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advance Cash On Delivery Service. Call Girl Service In Goa 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advance Cash On Delivery Service Call Girl Near Me Booking Details Are here: just visit website: https://hotbabe24.com #Call Girl In Goa, #Goacallgirls #CallgirlserviceGoa, #CallgirlsinGoa Website on rent : mailto:indiancallgirl4rent@gmail.com "Call Girls Goa VIP Call Girls Service Goa.. Booking Open Now We Are Providing Safe & Secure High Class girl women sucking men Services Affordable Rate 100% Satisfaction, Unlimited Enjoyment. Any Time for Model/ women seeking men in royal call girl High class luxury and premium call girl agency. ✔️High class luxury and premium escorts agency We Provide Well Educated, Royal Class Female, High-class Escorts agency offering a top high class escort service in the royal Escorts ✔️ Get High Profile queens , Well Educated , Good Looking , Full Cooperative Model Services. you can see me at my comfortable Hotels or I can visit you in hotel Our Service Available IN All Services 3/5/7 Star Hotels, In call /Out call Service 24/7.. ✔️ All Meetings We Provide Hottest Female With Me Are Safe And Consensual With Most Limits Respected Complete Satisfaction Guaranteed...Service Available In:- 24/7 3 * 5 *7 *Star Hotel Service In. In Call Out call service Avilable also. ✔️ I guarantee you to have an unforgettable experience with me A curvy body, long hair and silky smooth skin. She is an independent royal Escorts/Women Seeking Men model will give you more pleasure & Full satisfaction. ✔️ I am very sensual and flirtatious with charming personality! I love to laugh and my bright smile is ever Present. ,Hotel & Home Services CALL PLZZ ✔️Available Near All 3* 4* 5* 7* Hotels Of I Want Only Hotel Name , Guest Name , Room No. Only For Confirmation.✔️ Nandani... agency...⭐⭐⭐⭐⭐ VIP...Service ✣ ✤ ✥ ✦ TIME WASTERS AND BARGAINERS ARE PLEASE EXCUSE, WE RESPECT YOUR SAFETY AND PRIVACY AND EXPECT TH WHATSAPP: 9xx000xx09 CALL ME" 9xx000xx09

Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...

Sheetaleventcompany

Shazia Iqbal 2024 - Bioorganic Chemistry.pdf

Trustlife

Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery ★ CALL US High Class Luxury and Premium Escorts ServiCe We Provide Well Educated, Royal Class Female, High-Class Escorts Offering a Top High-Class Escorts Service In the & Several Nearby All Places Of . ★ Get The High Profile, Bollywood Queens , Well Educated , Good Looking , Full Cooperative Model Services. You Can See Me at My Comfortable Hotels or I Can Visit You In hotel Our Service Available IN All SERVICE, 3/4/5 STAR HOTEL , In Call /Out Call Services.24 hrs ,$P13 ★ To Enjoy With Hot and Sexy Girls . ★ We Are Providing :- • Models • Vip Models • Russian Models • Foreigner Models • TV Actress and Celebrities • Receptionist • Air Hostess • Call Center Working Girls/Women • Hi-Tech Co. Girls/Women • Housewife • Collage Going Girls. • Travelling Escorts. • Ramp-Models • Foreigner And Many More.. Incall & Outcall Available… • INDEPENDENT GIRLS / HOUSE WIFES ★ I Guarantee You To Have An Unforgettable Experience With Me.A Curvy Body, long Hair and Silky Smooth Skin. She Is an Independent Escorts Model Will Give You More Pleasure & Full Satisfaction. Call Now Seema:- 8250092165

Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery

Jyoti singh

tongue disease lecture Dr Assadawy legacy

DrMohamed Assadawy

VIP Hyderabad Call Girls KPHB 7877925207 ₹5000 To 25K With AC Room 💚😋

mahima pandey

Step into the captivating realm of cardiovascular physiology as Dr. Faiza, an esteemed Assistant Professor of Physiology, unravels the intricacies of recording an electrocardiogram (ECG). In this illuminating lecture, students are guided through the fundamental principles of ECG interpretation, from lead systems and electrode placement to the analysis of waves, segments, and intervals. Beginning with an exploration of the twelve-lead system, Dr. Faiza elucidates the significance of bipolar limb leads (I, II, III), unipolar limb leads (aVR, aVL, aVF), and unipolar chest leads (V1-V6). Through mnemonic aids and clinical anecdotes, students gain a comprehensive understanding of lead placement techniques, enabling them to navigate the complexities of ECG recording with confidence and precision. As the lecture unfolds, Dr. Faiza delves into the nuances of ECG interpretation, empowering students to correlate ECG findings with electrophysiological events in the cardiac cycle. With a focus on waveform morphology and rhythm analysis, students learn to determine heart rate, rhythm, and axis deviation, deciphering the electrocardiographic manifestations of various cardiac pathologies and physiological states. Moreover, the lecture explores the normal waves, segments, and intervals of an ECG, providing students with a detailed roadmap for interpreting these essential components. From the P wave to the T wave, students gain insight into the voltage, duration, and clinical significance of each waveform, equipping them with the skills to identify aberrations and anomalies in ECG tracings. Enriched with clinical pearls and practical tips, this lecture serves as a cornerstone for students embarking on their journey into cardiovascular medicine. By demystifying the art of ECG interpretation, Dr. Faiza empowers students to harness the power of this diagnostic tool in clinical practice, fostering a deeper appreciation for the intricate interplay between electrical activity and cardiac function.

Electrocardiogram (ECG) physiological basis .pdf

MedicoseAcademics

Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Service Available Call Mrs Leela Ji +91-8005736733 We offer all types of girls of your choice with space. Our escorts are fully cooperative and understand your needs. All types of call girls like Housewives, College girls,#J11 Russian girls, Muslim girls, Afghani girls, Bengali girls, Working girls, south Indian girls, Punjabi girls, etc. In-Call: — You Can Reach At Our Place in Kolkata Our place Which Is Very Clean Hygienic 100% safe Accommodation. Out-Call: — Service for Out Call You have To Come Pick The Girl From My Place We Also Provide Door-Step Services Hygienic: — Full Ac Neat And Clean Rooms Available In Hotel 24 * 7 Hrs In Kolkata C010524HD Our Services and Rates: – One Shot — 2500/in call (time ½ hour), 5000/out call Two shot with one girl — 5000/in call (time 1 hour), 6000/out call Body to body massage with sex- 3000/in call (time 1 hour) full night for one person– 8000/in call, 10000/out call (shot limit 4 shot) We are available 24*7 all days of the year Call us — 8005736733 !! Thank you for Visiting.

Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...

Namrata Singh

In this captivating lecture, Dr. Faiza, an esteemed Assistant Professor of Physiology, embarks on a comprehensive journey into the multifaceted realm of local blood flow regulation. With meticulous detail and clarity, she unravels the intricate mechanisms that govern the dynamic balance between tissue perfusion and vascular resistance, shedding light on both acute and chronic aspects of blood flow control. Beginning with an exploration of acute influences, Dr. Faiza elucidates how physiological factors such as metabolic demand, myogenic responses, and autoregulatory mechanisms orchestrate rapid adjustments in local blood flow. Students gain insight into the vasodilator theory, which elucidates the role of metabolic byproducts and vasoactive metabolites in promoting vasodilation, alongside the oxygen demand theory, which underscores the interplay between tissue oxygenation and nutrient demand. Delving deeper, the lecture delves into the fascinating realm of humoral control, where hormones and vasoactive substances wield significant influence over vascular tone. Dr. Faiza navigates through the intricacies of endothelial-derived factors like nitric oxide (NO) and histamine, alongside hormonal regulators such as angiotensin II and vasopressin. Through vivid explanations and illustrative examples, she unveils the intricate dance of vasodilation and vasoconstriction orchestrated by these biochemical messengers. Moreover, the lecture extends its gaze to the extrinsic control of blood flow, where sympathetic innervation exerts a profound impact on vascular dynamics. Dr. Faiza elucidates the role of sympathetic tone in modulating vascular resistance, highlighting its implications in diverse physiological and pathological scenarios. From skin perfusion to coronary circulation, students gain a nuanced understanding of how neural inputs shape local blood flow patterns. Enriched with clinical insights and contemporary research findings, this lecture equips students with a holistic understanding of blood flow regulation. By exploring concepts like active and reactive hyperemia, vascular remodeling, and collateral circulation, Dr. Faiza fosters a deeper appreciation for the adaptive responses of the cardiovascular system to changing physiological demands and pathological insults.

Control of Local Blood Flow: acute and chronic

MedicoseAcademics

❤️Chandigarh Escorts Service☎️9809698092☎️ Call Girl service in Chandigarh☎️ Chandigarh Call Girls Service ☎️ Call Girls In Chandigarh BEST Call Girls in CHANDIGARH Escort Service provide Cute Nice sweet and Sexy Models in beautiful CHANDIGARH city cash in hand to hand call girl in CHANDIGARH and CHANDIGARH escorts. HOT & SEXY MODELS // COLLEGE GIRLS IN CHANDIGARH AVAILABLE FOR COMPLETE ENJOYMENT WITH HIGH PROFILE INDIAN MODEL AVAILABLE HOTEL & HOME ★ SAFE AND SECURE HIGH CLASS SERVICE AFFORDABLE RATE ★ 100% SATISFACTION,UNLIMITED ENJOYMENT. ★ All Meetings are confidential and no information is provided to any one at any cost. ★ EXCLUSIVE Profiles Are Safe and Consensual with Most Limits Respected ★ Service Available In: - HOME & 24x7 :: 3 * 5 *7 *Star Hotel Service .In Call & Out call Services : ★ A-Level (5 star escort) ★ Strip-tease ★ BBBJ (Bareback Blowjob)Receive advanced sexual techniques in different mode make their life more pleasurable. ★ Spending time in hotel rooms ★ BJ (Blowjob Without a Condom) ★ Completion (Oral to completion) ★ Covered (Covered blowjob Without a Condom)Chandigarh Call Girls

Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...

Sheetaleventcompany

Intramuscular & Intravenous Injection.pptx

saranpratha12

💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance Cash On Delivery Service Chandigarh Call Girls Service punjab ❤️🍑 📲Lucky 8868886958📲 💚👄🫦 Independent Escort Service Chandigarh Call Now :- 8868886958 Lucky Call Girl In Chandigarh | Chandigarh Call Girl | Call girl service in Chandigarh | Call Girls In Chandigarh | Chandigarh Call Girls Their services range from erotic encounters and movie dates to in-call and out-call services, making this option available 24/7. Available for services including NSA, threesomes and foursomes sessions as well as massage services and casual foreplay - they even provide real girlfriend experience. Find one online or visit local women's clubs, hotels or restaurants. Hiring a Chandigarh call girl for an evening or day out can be the perfect addition to your social gathering or office event, or you could arrange for her to visit your home or hotel room. Not only are these women gorgeous, they're intelligent as well, with great senses of humor - sure to please and leave you wanting more. If you want a cheap escort in Chandigarh, look for someone who is either a student or works part time so that she will always be available when you need her. In addition to this, look for housewives as this ensures they have stable lives that can keep you satisfied for extended periods. These beautiful ladies will capture your attention at first sight with stunning eyes and full, seductive lips; not to mention a seductive personality that makes you want to spend more time with them; moreover they are discreet enough to meet up anywhere nearby! Hiring a call girl in Chandigarh can be done through either the internet or calling her directly, with services like massage or sex sessions offered to request from specific agencies within a few hours of making contact. Furthermore, text the girl directly for price quotes!

💚Chandigarh Call Girls 💯Riya 📲🔝8868886958🔝Call Girls In Chandigarh No💰Advance...

Sheetaleventcompany

Race Course Road } Book Call Girls in Bangalore | Whatsapp No 6378878445 VIP Escorts Service Available 24*7 Book Call Mrs Janvi Ji +91-6378878445 We offer all types of girls of your choice with space. Our escorts are fully cooperative and understand your needs. All types of call girls like Housewives, College girls,#J11 Russian girls, Muslim girls, Afghani girls, Bengali girls, Working girls, south Indian girls, Punjabi girls, etc. In-Call: — You Can Reach At Our Place in Bangalore Our place Which Is Very Clean Hygienic 100% safe Accommodation. Out-Call: — Service for Out Call You have To Come Pick The Girl From My Place We Also Provide Door-Step Services Hygienic: — Full Ac Neat And Clean Rooms Available In Hotel 24 * 7 Hrs In Bangalore Our Services and Rates: – One Shot — 2500/in call (time ½ hour), 5000/out call Two shot with one girl — 5000/in call (time 1 hour), 6000/out call Body to body massage with sex- 3000/in call (time 1 hour) full night for one person– 8000/in call, 10000/out call (shot limit 4 shot) We are available 24*7 all days of the year Call us — 6378878445 !! Thank you for Visiting.

Race Course Road } Book Call Girls in Bangalore | Whatsapp No 6378878445 VIP ...

dishamehta3332

Dernier (20)