Expression and localization_of_gene_encoding_biomineralization_in magnetotactic_bacteria

Int. J. Life. Sci. Scienti. Res. January 2018
Copyright © 2015-2018| IJLSSR by Society for Scientific Research is under a CC BY-NC 4.0 International License Page 1567
Expression and Localization of Gene encoding
Biomineralization in Magnetotactic Bacteria
Renu Singh1*
, Tanzeel Ahmad2
1
PhD Scholar, School of Biotechnology, IFTM University, Moradabad, India
2
Head, School of Biotechnology, IFTM University, Moradabad, India
*
Address for Correspondence: Ms. Renu Singh, PhD Scholar, School of Biotechnology, IFTM University,
Moradabad, India
Received: 27 Oct 2017/Revised: 28 Nov 2017/Accepted: 30 Dec 2017
ABSTRACT- The magnetosome is organelles of prokaryotic bacteria having a magnetic property, they are
Magnetotactic Bacteria. MTB consisting of phospholipids bilayer bounded a magnetite crystal that contains the different
set of proteins and functionally different. The magnetosome particles are potentially useful in the number of
applications as a magnetic nanoparticle. In this work, we studied the localization and expression of proteins play an
essential role in magnetosome biomineralization process by fluorescence microscopy and biochemical analysis in
microaerophilic Magnetospirillum gryphiswaldense R3/S1. Although optimum conditions were mutually exclusive for
high fluorescence and magnetite synthesis through this study, oxygen-limited growth conditions were established, which
enhance magnetite biomineralization, growth, and formation of GFP fluorophore at reasonable rates. Through
fluorescence microscopy and immunoblotting technique, we were studied that the subcellular localization and
expression of magnetosome proteins i.e. GFP-tagged. Among MamC, MamF, and MamG magnetosome proteins fused
to GFP, the strongest expression, and fluorescence displayed by MamC-GFP. The magnetosome tagged to MamC-GFP
purified from cells shows strong fluorescence, shows stability towards wide temperature range and salt concentration
however sensitive towards detergent. Our research exhibited the utilization of MamC as an anchor for magnetosome-
specific display for fusions of the heterologous gene.
Key-words- Magnetotactic Bacteria, Gene cloning, Fluorescent Microscopy, Immunoblotting, Biomineralization
INTRODUCTION
The MTB’s magnetosomes are specific organelles for
magnetic orientation of magnetosomes that comprise of
magnetic iron mineral crystal enveloped within
membrane [1-2]
. Magnetosomes are synthesized by
magnetite (Fe3O4) precipitation inside particular vesicles
framed by the magnetosome membrane (MM) in strains
of Magnetospirillum, which inhaled from the cytoplasm
membrane and contains various particular proteins that
are involved in functional magnetosome particles
synthesis [3-6]
. Huge increment in interdisciplinary
research is aimed to understand the mechanism
magnetotactic bacteria through which they achieve their
exceptional control over the properties of the crystals of
magnetic minerals and association of highly ordered
chain-like structure [7-8]
. Magnetotactic bacteria have
emerged as effective models for the investigation and
study of cell biology and formation of organelle in
prokaryotes, as magnetosomes show numerous features
that are also shown in organelles of eukaryotes [8]
.
Access this article online
Quick Response Code Website:
www.ijlssr.com
DOI: 10.21276/ijlssr.2018.4.1.10
Furthermore, the uniform sizes of magnetosome, their
crystal habits and magnetic property made them
interesting for utilizing them as magnetic nanoparticles
with extremely extraordinary properties [9-10]
, and various
potential applications i.e. magnetic separation, analyses
detection use in MRI as contrast agent, & use as magnetic
nanoparticles in magnetic hyperthermia treatment [11-14]
.
Most of these applications require functional
magnetosome particles, e.g. by the magnetosome-specific
display of the functional moieties, for example, antibody
binding protein, enzyme, oligonucleotides as protein tags
[14]
. Mostly, this has been achieved by coupling specific
ligands chemically to lipids or proteins of MM [15-18]
. On
the other hand, the integral magnetosome membrane
proteins (MMPs) utilized as an anchor for magnetosome
specific display of fused heterologous proteins [10,19-20]
.
For instance, luciferase was utilized as a reporter for
expression of genetic fusion of Mms 13 protein of M.
magneticum that is magnetosome directed [21]
. Green
fluorescent protein (GFP) is another protein that is useful
as a reporter for expression and intracellular localization
of magnetosome proteins. To subcellular organization and
membrane targeting in bacteria, for example, Escherichia
coli, Bacillus subtilis and Caulobacter crescentus, has
been revolutionized by using GFP [22-23]
. Various studies
have already been conducting however still the
subcellular localization of several magnetosome proteins
is under research. The GFP-assisted fluorescent
microscopy was already used to study the magnetosome
RESEARCH ARTICLE

protein’s subcellular localization in M. magneticum. The
protein which was investigated includes MamA Protein,
which is probably required in magnetosome activation
where as the intracellular assembly of magnetosome
chain controlled by acidic MamJ protein and the
actin-like MamK protein. In spite of the fact that these
examples previously verified its principal utility in MTB,
the GFP expression can be problematic if used as an
intracellular marker of magnetosome localization. The
formation of magnetite crystal with in microaerophilic
organisms required very low oxygen concentration that is
underneath 10 mbar (×100 pas) [24]
, subsequently
maturation of proteins needs molecular oxygen during
last step of fluorophore maturation, thus the use of GFP at
micro-or anaerobic is limited [25-26]
. Likewise, it has been
seen that intensity of fluorescence and fluorescent cell
proportion were rather low and different under microoxic
growth condition [26]
.
This research paper was intended to explore the
expression of GFP fused protein in the microaerophilic
M. gryphiswaldense R3/S1 at different oxygen levels by
using fluorescence microscopy. Optimum cultivation
condition was estimated regarding growth, magnetite
crystal biomineralization and maximum expression of
GFP fused proteins and fluorophore formation. We were
additionally analyzed the subcellular localization of
magnetosome proteins i.e GFP-tagged are MamC, MamF,
and MamG, by fluorescence microscopy and
immunoblotting. These proteins were also involved in
controlling the size of growing magnetite crystal [27]
. The
GFP modified fluorescent magnetic nanoparticles were
isolated and purified from bacterial cells and studied in
vitro condition for identifying the stability of expression
and fluorescence of MamC-GFP labeled magnetosomes.
MATERIALS AND METHODS
A prospective experimental study was designed and
performed in department of Biotechnology, IFTM
University, Moradabad, Uttar Pradesh, India in the year
2013 to 2017. For cloning E. coli strain DH5α and Top 10
strain, DH5 were used as a host (Top 10 Chemically
Competent Cells) and for conjugation Experiments E. coli
strain S17-1 was used [28]
. These strains were grown on
medium Luria-Bertani (LB) which was supplemented
with 50ul/ml of kanamycin and ampicilline, and incubate
at 37°C for 24 hrs. “M. gryphiswaldense R3/S1” the
mutant of “M. gryphiswaldense MSR-1” were used in this
study. The “M. gryphiswaldense R3/S1”was resistant to
rifampicin and streptomycin. The strain was grown in
modified FSM medium microaerobically at 28°C under
moderate shaking at 100rpm by using carbon source “27
mM pyruvate” [28]
. R3/S1 was cultured in FSM (Flask
standard medium) [24]
. It contains KH2PO4, 0.15g
MgSO4.7H2O, 2.38g Hepes, 0.34g NaNO3, 0.1g yeast
extract, 3g soybean peptone, and 1 ml EDTA chelated
trace element mixture [24]
for carbon source 27 mM
potassium L-lactate was added to the medium as an iron
source, just before autoclave firstly pH was adjusted to
7.0 with NaOH [24]
. All chemical was purchased from
SIGMA-ALDRIC. Cultivation of R3/S1 was carried out
in 1 liter flask under aerobic and microaerobic condition.
The cell was incubated in free gas exchange with air for
aerobic cultivation and for microaerobic cultivation,
flasks was sealed with butyl rubber stopper before
autoclaving under microaerobic gas mixture containing
1% O2 in 99% N2
[24]
. The inoculation of microaerobic
culture was done by injection through rubber stopper.
During cultivation, the temperature was mentioned at
28°C and pH 7. All culture grown in incubator shaker for
24-48h and agitated at 100 rpm. For isolation of the gene
of interest, standard DNA procedure was employed [29]
.
The primers sequences of gene cloning and fusion
constructs were purchased from GENETIC. The primer
sequences are analyzed previously [28]
. Primer sequences
are listed in Table 1.
Table 1: Primers used in this research [28]
*Restriction sites are indicated into the primers indicated in bold,
Glycine-linker encoding sequence is in italic front
The GFP-fusion proteins were constructed by using
variant of GFPmut1 or termed EGFP (enhancer GFP) was
used [30]
. By using CL1 forward primar, egfp gene was
PCR amplified from plasmid pEGFPN-1 (BD Biotech)
.CL1 forward primer adds to 10 glycine linker and NdeI
restriction site to 5’end of CL2 reverse primer and egfp
gene. To yield pCL1, the PCR product was cloned into
pGEMT-Easy. The amplification of mamC, mamF and
mamG genes was carried out with pairs of corresponding
primers and thus M. gryphiswaldense R3/S1 genomic
cDNA taken as template. The pCL2-4 was generated by
cloning PCR product into pGEMT-Easy and then
transformed into DH5α. The subcloning of egfp gene was
done from pCL1 to pBBRMCS-2 plasmid at EcoRI site to
yield pCL5 plasmid [31-32]
. The screening of plasmid
containing egfp in similar orientation as promoter Plac was
done by colony PCR technique. For generating the
plasmids pL2, pL3 and pL4, translational fusion of
mamC, mamF, and mamG were constructed with egfp
Primer
Name
Target
gene
Sequence*
L1 egfp catatgggaggcggaggcggtggcggaggtggcg
gagtgagcaagggcgaggag
CL2 egfp gtggatccttacttgtacagctcgtc
CL3 mamF ctcgagagggcaaagcaatggccgagac
CL4 mamF catatggatcagggcgactacatggctg
CL5 mamC ctcgagaggacaacagcgatgagctttc
CL6 mamC catatgggccaattcttccctcag
CL7 mamG ctcgagggagatcagatgatcaagggcatc
CL8 mamG catatgagcaggctcggcggaggc

connected via 10 glycine linker by ligating the mam gene
from pL6, pL7, and pL8 into NdeI and XhoI sites of the
pL5 Vector [10,28]
. List of the plasmids used in this study
were listed in the Table 2 [28]
. The transformation of
plasmid from E. coli S17-1, harboring mam-egfp fusions
were performed by conjugation to M. gryphiswaldense
R3/S1.
Table 2: Plasmids used in cloning and expression of
genes [28]
The transformed M. gryphiswaldense R3/S1 strain
bearing plasmid pCL5-pCL8 was growing in 15 ml tube
of polypropylene, which is sealed with a screw cap. The
tube consists of the culture of about 11ml Ref. [28]
. At
final Concentration of 1-5uM, the membranes stain
FM4-64 were used to stain cell membrane and then
immobilized on agarose pads to get imaged with an
Olympus BX61 microscope equipped with a 100X
UPLSAP0100X0 Objective [18,28]
. Images were captured
and analyzed using software Image 1.36b and Olympus
cellM [28]
. The microscopy of fluorescent magnetosomes
was done by spooling the suspension of approximately 15
µl of magnetosomes with magnetosomes concentration
corresponding to an iron concentration of 10mM [4]
. The
bar magnet was placed next to the microscopic slide were
image using Zeiss LSM510 Microscope equipped with
l0x objective and a photometric Coolsnap HQ Camera [28]
.
The best method was employed to analysis the
localization of MamC, MamF, and MamG-GFF through
immunoblotting. It was performed by applying SDS
PAGE and western blot analysis. For PAGE, the
protocols described by ‘Laemmli’ were followed [32-33]
.
Here the protein samples obtained from various Cellular
fractions were allowed to mix in electrophoresis sample
buffer. The buffer was prepared from 0.1M DTT,
62.5mM Tris-HCl, 1.6% SDS, 0.0002% bromophenol
blue and 5% glycerol. The sample with buffer was then
allowed to denature at 100°C for 5mim [28,33]
. The gels
were loaded with 15 microgram protein for analyses of
MM protein fraction through SDS PAGE [28]
. The
separated of MMP were performed on 15% (wt/vol) gels
and visualization of protein was done by staining it with
coomassie brilliant blue. Western blot analyses were done
by using 10% (wt/vol) gels. The blotting technique was
performed to transfer electrophoresis protein onto
nitrocellulose membranes [8]
. The membranes were
blocked at room temperature for 2hr [34]
. The blocking
solution along with an Anti-GFP antibody (1:1000
dilutions) or an Anti-MamC (1:500 dilution) antibody
was allowed to incubate at room temperature for 1h. The
washed of membrane was done with Tween Tris-buffered
saline and Tris-buffered saline (TBS) for several times
and then alkaline phosphates labeled goat anti-rabbit IgG
antibody was added to TBA (1:1000 dilution) [4]
. The
membrane was washed with TBS and BCIP (5-brono-4-
chloro-3-indolyl phosphate or nitroblue tetrazolium) after
incubation at room temperature for 45min, detection was
done using detection reagent [35]
.
RESULTS AND DISCUSSION
Here, we studied the expression and subcellular
localization of protein tagged to GFP, are MamC, MamF,
and MamG as they play an essential role in MM
formation. Fluorescence microscopy was done while
magnetosome is synthesizing, to analyze the expression
and subcellular localization of GFP-tagged Mam-C,
MamF, and MamG protein. The typical linear signal of
fluorescence was observed at midline along cell axis
where usually the magnetosome chain located (Fig. 1).
The signal was appeared either as 0.5 to 2µm straight, as
punctuated lines or less frequent predominantly with the
fusions. The concave side of the cells either reflexes the
linear signal or either observed at the shortest connection
from one turn to the next. The signal was consistent with
localization along axis twist of helical cell. The single
bright fluorescent spot was occasionally observed at mid-
cell in MamC-GFP expressing cells. The cytoplasm of
cell expressing MamF-GFP and MamG-GFP detected
with some fluorescence, that is, approximately 100% and
50% above medium background fluorescence, whereas
almost negligible fluorescence display from cytoplasm of
the cell expressing MamC-GFP fusions, that is less than
10% above background. The even distribution of
fluorescence was observed over the cytoplasm from
‘control cell’ expressing unfused GFP (Fig. 1).
Plasmid name Description Source or
References
pEGFPN-1 GFP expression vector,
Ap
BD Biotech
pGEMT-Easy Cloning vector, Ap Promega
pCL1 pGEMT-Easy +
10 glycine linker + egfp
Lang and
Schuler [28]
pCL2 pGEMT-Easy + mamC Lang and
Schuler [28]
pCL3 pBBR1-MCS2
+ 10Gegfp from pCL1
Lang and
Schuler [28]
pCL4 pCL5 + mamC from pCL1 Lang and
Schuler [28]
pBBR1-MCS2 mobilizable broad
host range vector, Km
Lang and
Schuler [28]
pCL5 pCL5 + mamF from pCL1 Lang and
Schuler [28]

Fig. 1: Fluorescence micrograph of M. gryphiswaldense R3/s1 strain expressing MamC-GFP (pCL4),
MamF-GFP (pCL5), MamG-GFP (pCL6) or (pCL3)
*Scale bars= 3µm [28]
Subcellular localization of magnetosome proteins in
microaerophilic magnetotactic bacteria has been possible
by tagging GFP [5,35-37]
. From all the fusion tested, only
MamC-GFP fusion perform the highest fluorescence in
vivo and on isolated magnetosomes and made consistent
with the highest abundance of fusion and the unfused
MamC protein, which showed the similar level of
expression. By using Coomassie, MamF-GFP and
MamG-GFP fusions were detected below in MM
preparation. The proteolysis degradation product of
MamF-and MamG-GFP fusions indicates the less
stability of proteins by immuno-detection. The unfused
counter parts of MamF and MamG have expressed
strongly then GFP fusions. This could be specified either
by an inclination in targeting to the MM, or by a
generally low expression from the lac promoter which
presents on the backbone of vector and thus making
highly desirable study in future on expression of native
and inducible promoters. The cell fractions which
prepared from magnetic cell and fluorescent were studied
by SDS-PAGE and immunodetected. The cell expressing
MamC-GFP, an additional protein band of MamC-GFP
fusion, of 40 Kda was detected in magnetosome by
coomassie stain (Fig. 2A). The coomassie were noticeable
by further band stain also detects bands of corresponding
fusion proteins, that is, MamF-GFP of about 40.1KDa
and MamG-GFP of about 35.5 kDa. However, they
recognize alone with an anti-GFP antibody (Fig. 2B).
Other then the above identified band an additional band
was immunodetected, of 20 kDa from all GFP fractions.
The product of proteolytic cleavage was noticeable by
further bands; indicate the partial degradation of fusions
in a cell which were visible in MM from MamF-GFP and
MamG-GFP (Fig. 2B).
A: Detection of GFP combination proteins on
separated magnetosomes. SDS-PAGE of MMPs
purified from the M. gryphiswaldense R3/S1 strain,
and subordinates harboring the plasmids pCL5
(GFP), pCL6 (MamC-GFP), pCL7 (MamF-GFP) and
pCL8 (MamG-GFP). The MamC-GFP signal is shown
by an arrow sign
B: Immunoblotting of a similar gel as appeared in the
upper panal treated with an anti-GFP antibody. Other
than the MamC-GFP signal (←), signals for MamF-
GFP (■) and MamG-GFP (□) are seen. Moreover a
putatively non-specific signal (*) is identified at a size
of 20 kDa in the fraction of magnetosome division of
MamC-GFP, MamF-GFP and MamG-GFP expressing
cells

C: Immundetection of MamC (•) and MamC-GFP
(←) in various cell fraction of R3/S1 (pCL6) (MamC-
GFP) and in the magnetosome layer parts of R3/S1
(pCL5) (GFP) and R3/S1 with an anti-MamC
antibody
D: Immunodetection of GFP (○) in various cell
fraction of R3/S1 (pCL5) (GFP) with an anti-GFP
antibody. Secluded magnetosomes communicating
GFP combinations to MamC, MamF and MamG show
stable fluorescence in vitro condition
Fig. 2: Detection of GFP combination proteins in
separated magnetosomes and other cell parts
The strongest signal in MMP fraction was reveled from
immune-detection of MamC-GFP fusion protein by
utilizing Antibody “Anti-Mam-C”. The weak band of the
same size was observed in the CL, the NF, and the MP
but probably not in the SP (Fig 2C). Anti-MamC antibody
recognizes the band of unfused MamC which was of 12.5
KDa. It shows a subcellular distribution similar or
identical to MamC-GFP. The magnetosome Membrane
probably causes the low level of MamC and MamC-GFP
in NF and MP; thus eventually the separation procedure
depends on magnetism such as immature Magnetite
crystal containing vesicles empty magnetosome vesicles
and MMs and thus disconnected during purification. The
MamC-GFP band has approximately 80% intensity than
that of the MamC band, showing that native protein and
fusion both are expressed in comparable quantity.
Exclusively weak bands of MamF-GFP and MamG-GFP
were detected only in MMP fraction, however in other
subcellular fractions were below detection including
entire CL, which indicates the presence of MamF-GEP
and MamG-GFP in small amount, either due to poor
expression or strong degradation. Anti-GFP antibody was
employed to recognized unfused GFP at the expected size
of about 27 KDa in the CL, the NF, and the SP, but not in
MP and MMP (Fig 2D).
The MamC-GFP, MamF-GFP, and MamG-GFP perform
similar localization pattern and length and position of
magnetosome chain correlating the linear fluorescence
signal [4]
. The outcomes of localization studies are
agreement with Mam12 immunogold labeling studies that
is ortholog to MamC in M. magnetotacticum [4]
. But the
experiment was not reaching any conclusion regarding
Mam12 intracellular localization due to weak
immunogold signal [38]
. In contrast, the bright dot at mid-
cell observed during MamC-GFP localization shows the
variable intracellular localization of MamC protein along
the chain and may differ over the cell cycle. The presence
of weak fluorescence and immunosignals obtained from
immunodetection of different compartments of cells,
which expressing GFP fusions to either MamC, MamF or
MamG, shows the exclusive targeting of these
hydrophobic proteins to the MM. in contrast to other
magnetosome protein, they are hydrophilic and showed
some different and variable subcellular localization. For
instance, MamA-GFP fusion in M. magneticum, which
was supposed to play role in activation of Magnetic
precipitation and Magnetosome chain length regulation,
shows the localization pattern that is depends on growth
stage. During exponential phase of growth, a filamentous
structure was observed, which come from pole to pole
and more punctuated signs were displayed at midcell
stationary cells [35]
. GFP fused to MamK, is an actin-like
protein which forms cytoskeletal magnetosome filament
and localization as straight lines that spread out through
the most cell [5]
. MamJ protein fused to M.
gryphiswaldense just Like MamK and MamA and
predicted to attach magnetosome filament and
magnetosome vesicles together and localized from pole to
pole as long filaments [36]
. While the length of
magnetosome chains extended by the position of a chain
of magnetite crystals seems too confined by the linear
fluorescent signal which is corresponding to fusion
MamGFC-GFP. Cytoplasmic membranes (CM) were not
remarkably associated to MamGFC-GFP proteins
although hydrophobic proteins were represented by
MamGFP with localization in the CM. Hence, our data
show the inclusion of highly specific mechanism for
targeting MamC, MamF, and MamG to the MM and thus
seems different from MMPs involves, MamA, MamJ and
MamK. It might be possible that the localization pattern
of MamC, MamF and MamG is different from MamA,
MamJ and MamK because they are attached with
magnetosome filaments but MamC, MamF and MamG
are associated predominantly with mature magnetosomes.
CONCLUSIONS
The results agreement, the GFP-MamC shows stable and
strong fluorescence in-vivo condition. MamC represents
the universal anchor for magnetosome display of other
protein because MamC tightly attached to Magnetite
crystal surface due to which resistant is created to
proteolysis and chemical stress. It is expressed as highly
and most abundant protein of Magnetosome. MamC does
not have functional interference with additional moiety
because of small size and hydrophilic C-terminal, which
is accessible for fusion protein expression. Conversely, it
is unexpected that MamC fusions with heterologous
protein interfere formation of magnetosome, as it has

been observed that, due to the deletion of Mam only
minute or minor effect was displayed while synthesis of
magnetosome.
ACKNOWLEDGMENT
The present manuscript is piece of Ph.D. work. The
Author is grateful to Prof. Dr. A. Tanzeel and Dr. N.
Prakesh for generous help and time-to-time inspiration
during preparation of the present manuscript.
REFERENCES
[1] Bazylinski DA, and Frankel RB. Magnetosome formation
in prokaryotes. Nat. Rev. Microbiol, 2004; 2:217-230.
[2] Schuler D. Molecular analysis of a subcellular
compartment: The magnetosome membrane in
Magnetospirillum gryphiswaldense. Arch. Microbiol,
2004; 181:1-7.
[3] Gorby YA, Beveridge TJ, and Blakemore R.
Characterization of the bacterial magnetosome membrane.
J. Bacteriol, 1988; 170:834-841.
[4] Grunberg K, Muller EC, Otto A, Reszka R, Linder D,
Kube M, Reinhardt R, and Schuler D. Biochemical and
proteomic analysis of the magnetosome membrane in
Magnetospirillum gryphiswaldense. Appl. Environ.
Microbiol, 2004; 70:1040-1050.
[5] Komeili A, Li Z, Newman DK, and Jensen GJ.
Magnetosomes are cell membrane invaginations organized
by the actin-like protein MamK. Science, 2006; 311:
242-245.
[6] Tanaka M, Okamura Y, Arakaki A, Tanaka T, Takeyama
H, and Matsunaga T. Origin of magnetosome membrane:
proteomic analysis of magnetosome membrane and
comparison with cytoplasmic membrane. Proteomics,
2006; 6:5234-5247.
[7] Bazylinski DA, and Schubbe S. Controlled
biomineralization by and applications of magnetotactic
bacteria. Adv. Appl. Microbiol, 2007; 62:21-62.
[8] Komeili A. Molecular mechanisms of magnetosome
formation. Annu. Rev. Biochem, 2007; 76:351-366.
[9] Lang C, and Schüler D. Biogenic nanoparticles:
production, characterization and application of bacterial
magnetosome. J. Phys. Condens. Matter, 2006; 18:
S2815-S2828.
[10]Lang C, Schuler D, and Faivre D. Synthesis of magnetite
nanoparticles for bio- and nanotechnology: Genetic
engineering and biomimetics of bacterial magnetosomes.
Macromol. Biosci, 2007; 7:144-151.
[11]Hergt R, Hiergeist R, Zeisberger M, Schuler D, Heyen U,
Hilger I, and Kaiser WA. Magnetic properties of bacterial
magnetosomes as diagnostic and therapeutic tools. J.
Magn. Magn. Mat, 2005; 293:80-86.
[12]Lisy MR, Hartung A, Lang C, Schuler D, Richter W,
Reichenbach JR, Kaiser WA, and Hilger I. Fluorescent
bacterial magnetic nanoparticles as bimodal contrast
agents. Invest. Radiol, 2007; 42:235-241.
[13]Yoshino T, Kato F, Takeyama T, Nakai K, Yakabe Y, and
Matsunaga T. Development of a novel method for
screening of estrogenic compounds using nano-sized
bacterial magnetic particles displaying estrogen receptor.
Analyt. Chim. Acta, 2005; 532:105-111.
[14]Yoza B, Arakaki A, and Matsunaga T. DNA extraction
using bacterial magnetic particles modified with
hyperbranched polyamidoamine dendrimer. J. Biotechnol,
2003; 101:219-228.
[15]Ceyhan B, Alhorn P, Lang C, Schuler D, and Niemeyer
CM. Semisynthetic biogenic magnetosome nanoparticles
for the detection of proteins and nucleic acids. Small,
2006; 2:1251.
[16]Matsunaga T, Nakayama H, Okochi M, and Takeyama H.
Fluorescent detection of cyanobacterial DNA using
bacterial magnetic particles on a MAG-micro
array. Biotechnol Bioeng, 2001; 73(5):400-405.
[17]Tanaka T, Yamasaki H, Tsujimura N, Nakamura N, and
Matsunaga T. Magnetic control of bacterial
magnetite-myosin conjugate movement on actin cables.
Mater. Sci. Eng.C, 1997; 5:121-124.
[18]Wacker R, Ceyhan B, Alhorn P, Schüler D, Lang C, and
Niemeyer CM. Magneto-Immuno PCR: A homogeneous
immunoassay based on biogenic magnetosome
nanoparticles. Biochem. Biophys. Res. Commun, 2007;
357: 391-396.
[19]Yoshino T, and Matsunaga T. Efficient and stable display
of functional proteins on bacterial magnetic particles using
Mms13 as a novel anchor molecule. Appl. Environ.
Microbiol, 2006; 72:465-471.
[20]Yoshino T, Takahashi M, Takeyama H, Okamura Y, Kato
F, and Matsunaga T. Assembly of G protein-coupled
receptors onto nanosized bacterial magnetic particles using
Mms16 as an anchor molecule. Appl. Environ. Microbiol,
2004; 70:2880-2885.
[21]Matsunaga T, Suzuki T, Tanaka M, and Arakaki A.
Molecular analysis of magnetotactic bacteria and
development of functional bacterial magnetic particles for
nano-biotechnology. Trends Biotechnol, 2004; 25:182-188.
[22]Margolin W. FtsZ and the division of prokaryotic cells
and organelles. Nat. Rev. Mol. Cell Biol, 2005; 6:862-871.
[23]Southward CM, and Surette MG. The dynamic microbe:
green fluorescent protein brings bacteria to light. Mol.
Microbiol, 2002; 45:1191-1196.
[24]Heyen U, and Schuler D. Growth and magnetosome
formation by microaerophilic Magnetospirillum strains in
an oxygen-controlled fermentor. Appl. Microbiol.
Biotechnol, 2003; 61:536-544.
[25]Heim R, Prasher DC, and Tsien RY. Wavelength
mutations and posttranslational autooxidation of green
fluorescent protein. Proc. Natl. Acad. Sci. USA, 1994;
91:12501-12504.
[26]Reid BG, and Flynn GF. Chromophore formation in green
fluorescent protein. Biochemistry, 1997; 36:6786-6791.
[27]Scheffel A, Gardes A, Grünberg K, Wanner G, and Schuler
D. The major magnetosome proteins MamGFDC are not
essential for magnetite biomineralization in
Magnetospirillum gryphiswaldense, but regulate the size of
magnetosome crystals. J. Bacteriol, 2007; 190:377-386.
[28]Lang C and Schuler D. Expression of green fluorescent
protein fused to magnetosome proteins in microaerophilic
magnetotactic bacteria. Applied and Environmental
Microbiology, 2008; 74: 4944-4953.
[29]Sambrook J, and Russel WD. Molecular cloning: A
laboratory manual (3rd
edn.). Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY. 2001.
[30]Larrainzar E, O'Gara F, and Morrissey JP. Applications of
autofluorescent proteins for in situ studies in microbial
ecology. Annu. Rev. Microbiol, 2005; 59:257-277.
[31]Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA,
Roop RM 2nd
, and Peterson KM. Four new derivatives of
the broad-host-range cloning vector pBBR1MCS, carrying
different antibiotic-resistance cassettes. Gene, 1995;
166:175-176.

[32]Grunberg K. Biochemical and molecular-biological
examination of the magnetosome membrane of
Magnetospirillum gryphiswaldense. Doctoral thesis.
University, Bremen, 2005.
[33]Laemmli UK. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature, 1970;
227:680-685.
[34]Grunberg K, Müller EC, Otto A, Reszka R, Linder D,
Kube M, Reinhardt R and Schüler D. Biochemical and
proteomic analysis of the magnetosome membrane in
Magnetospirillum gryphiswaldense. Appl. Environ.
Microbiol, 2004; 70:1040–1050.
[35]Komeili A, Vali H, Beveridge TJ, and Newman D.
Magnetosome vesicles are present prior to magnetite
formation and MamA is required for their activation. Proc.
Natl. Acad. Sci. U.S.A, 2004; 101:3839-3844.
[36]Scheffel A, Gruska M, Faivre D, Linaroudis A, Plitzko JM,
and Schuler D. An acidic protein aligns magnetosomes
along a filamentous structure in magnetotactic bacteria.
Nature, 2006; 440:110–114.
[37]Schultheiss D, Handrick R, Jendrossek D, Hanzlik M, and
Schuler D. The presumptive magnetosome protein Mms 16
is a PHB-granule bounded protein (phasin) in
Magnetospirilum gryphiswaldense. J. Bacteriol, 2005;
187:2416-2425.
[38]Taoka A, Asada R, Sasaki H, Anzawa K, Wu LF, and
Fukumori Y. Spatial localizations of Mam22 and Mam12
in the magnetosomes of Magnetospirillum
magnetotacticum. J. Bacteriol, 2006; 188:3805-3812.
International Journal of Life Sciences Scientific Research (IJLSSR)
Open Access Policy
Authors/Contributors are responsible for originality, contents, correct
references, and ethical issues.
IJLSSR publishes all articles under Creative Commons
Attribution- Non-Commercial 4.0 International License (CC BY-NC).
https://creativecommons.org/licenses/by-nc/4.0/legalcode
How to cite this article:
Singh R, Ahmad T. Expression and Localization of Gene encoding Biomineralization in Magnetotactic Bacteria. Int. J.
Life. Sci. Scienti. Res., 2018; 4(1):1567-1573. DOI:10.21276/ijlssr.2018.4.1.10
Source of Financial Support: Nil, Conflict of interest: Nil

Expression and localization_of_gene_encoding_biomineralization_in magnetotactic_bacteria

Recommandé

Recommandé

Contenu connexe

Tendances

Tendances (20)

Similaire à Expression and localization_of_gene_encoding_biomineralization_in magnetotactic_bacteria

Similaire à Expression and localization_of_gene_encoding_biomineralization_in magnetotactic_bacteria (20)

Plus de SSR Institute of International Journal of Life Sciences

Plus de SSR Institute of International Journal of Life Sciences (20)

Dernier

Dernier (20)

Expression and localization_of_gene_encoding_biomineralization_in magnetotactic_bacteria