SlideShare une entreprise Scribd logo
1  sur  39
CEUTEH‘16
Dr.Manish Jain
• Scientist,Department of Reproductive Biology
All India Institute of Medical Sciences
New Delhi
Publication:
• Research Papers (Indexed Journals): 15
• Chapters in Books : 2
• Poster Presentation in National & International
Conferences: 8
• Demostrator cum tutor in National Workshop on
Molecular
• Cytogenetic techniques: 7 times
Reduction of cost of Genetics
diagnosis test through FISH & PRINS
Dr. Manish Jain
Scientist
Department of Reproductive Biology
All India Institute of Medical Sciences
New Delhi
• A genetic disorder is a genetic problem caused by one or
more abnormalities in the genome, especially a condition that is
present by birth (congenital).
• Defects may occur during gamete formation or fetal
development due to endogenous or exogenous factors.
• These may cause birth defects like developmental delay,
behavioral problems and intellectual disability; abortions or
infertility compromising with reproductive health.
Genetics Disorders
GENETIC DEFECTS DURING GAMETE FORMATION
AND FETAL DEVELOPMENT
CHROMOSOMAL
DEFECTS
GENE
DEFECTS
Change in the
structure of
chromosome
Change in
number of
chromosomes
Addition or
deletion of a
nucleotide
Replacement of
one nucleotide
by another
SAMPLE COLLECTION
(BLOOD/ AMNIOTIC FLUID/ SOLID TISSUE/ BONE MARROW)
CYTOGENETIC TESTING
KARYOTYPE FISH PRINS aCGH
Methods of Investigations
Karyotype
• Advantages
– Whole genome scan
– Relative low cost
• Disadvantages
– Labor intensive
– Detection above 5 Mb
46, XY chromosome
Drawback of Karyotype
• The material doesn't contain metaphase chromosomes
– Unsuccessful cultivation
– It isn't possible to cultivate the tissue from patient
(preimplantation analysis, rapid prenatal examinations,
examinations of solid tumors or autopsy material)
• Analysis of complicated chromosomal rearrangements
• Identification of marker chromosomes
• Analysis of low-frequency mosaic
• Diagnosis of submicroscopic (cryptic) chromosomal
rearrangements
– Microdeletion syndromes
– Amplification of oncogenes and microdeletion of tumor-
suppressor genes in malignancies
• A technique that hybridizes a DNA nucleic acid probe to a target
DNA sequence contained within a cell nucleus.
FISH
FISH for Detection of Single to Multiple Genetic Events
Single Target
One color
Dual Targets
Two colors
Multiple
Targets
Multi- colors
Allows one to look at multiple genomic changes within a
single cell, without destruction of the cellular morphology.
A G G C
T
A
T
T C C G
A
T
A
COVALENT BOND
F
F
Specimen DNA
FISH Probe DNA
• Probe is a nucleic acid (DNA or RNA) that
o labeled with a marker which allows identification and
quantitation
o hybridize to another nucleic acid on the basis of base
complementarity
Probes
Types of probes
Centromeric (satellite)
probes
Locus specific probes
Whole chromosome painting probes
Company Probe Cost
• Vysis
• Kreatech
• Cytocell
Per slide cost : Rs.8000 – 12000
?
Human Probe Preparation
BAC/PAC/Plasmid DNA Probe
cloning
• Clones are shipped as bacterial LB
agar stab culture.
• DH5α E.coli host is harboring a
DNA insert that has been placed
into LB agar.
• Recommended to streak the culture
to single colonies on a LB agar plate
with a specific antibiotic and
prepare a glycerol stock of the
clones for long-term storage at -
80°C.
• Amplification of BAC/PAC/Plasmid
DNA for probe preparation
• Extraction of BAC/PAC/Plasmid
DNA for FISH Probe Preparation
1.a 1.b
1.c 1.d
1.e 1.f
Labeling of Probes
Nick translation labeling
• No need for linearization or denaturation of DNA.
• DNA is nicked by DNAse and DNA polymerase I replace excised
nucleotides by labeled/unlabeled nucleotides.
Protocol for Direct Nick Translation
• 1.5 ml microcentrifuge tube is placed on ice and to the tube, following ingredients added:
• Sterile distilled H2O Y µl
• 10X conc. nick translation buffer (NTB) 5µl
• [NTB-500 mM Tris-HCL (pH 7.8), 50mM Mg Cl2, 0.5 mg/ml BSA (nuclease-free)
• 100 mM Dithiothreitol 5 µl
• dNTP Nucleotide mixture 4µl
• [dNTP-0.5 mM each of d ATP, dGTP, and d CTP; 0.1 mM dTTP]
• 1 mM fluorochrome –labeled dUTP( DIG/Biotin) 0.5µl
• 1 µg template DNA X µl
• DNase I 5µl
• DNA polymerase I (2 units) 0.5 µl
The ingredients are mixed and tube is centrifuged briefly.
It is incubated at 15°C for 45 minutes.
After 45 mins, 5µl of Diluted DNase is added.
Further incubated at 15°C for 45 minutes.
Immediately after incubation, chilling of the reaction tube is done on ice.
To Stop reaction
• Add
• 0.5 M EDTA 2.5l
• Herring sperm DNA (blocks repetitive sequences) 2.5l
• 3 M sodium acetate (0.1vol) 3.0l
• Cold absolute alcohol 100% (2.5 vol) 500l
Microdeletion DNA Probe Clones (non commercial) in
our library
S.N Chromosome Probe Type Site Clone type
1 X Alphoid Centromere Plasmid
2 Y Alphoid, Heterochroma. Centromere, qh Plasmid
3 1 Hetrochroma. qh Plasmid
4 2 Alphoid Centromere Plasmid
5 3 Alphoid Centromere Plasmid
6 4 Alphoid Centromere Plasmid
7 6 Alphoid Centromere Plasmid
8 7 Alphoid Centromere Plasmid
9 8 Alphoid Centromere Plasmid
10 9 Hetrochroma. qh Plasmid
11 10 Alphoid Centromere Plasmid
12 11 Alphoid Centromere Plasmid
13 12 Alphoid Centromere Plasmid
14 13/21 Alphoid Centromere Plasmid
15 14/22 Alphoid Centromere Plasmid
16 15 Alphoid Centromere Plasmid
17 16 Alphoid Centromere Plasmid
18 17 Alphoid Centromere Plasmid
19 18 Alphoid Centromere Plasmid
20 20 Alphoid Centromere Plasmid
21 21 Alphoid Centromere Plasmid
22 22 Alphoid Centromere Plasmid
23 NOR Alphoid Satellite Plasmid
Alphoid DNA Probe Clones (non commercial) in our
library
Locus Specific DNA Probe Clones (non commercial)
in our library
S.N Chromosome Probe Type Clone type
1 1p36.33 Locus sp. BAC
2 2p24.3 Locus sp. BAC
3 3p25.1 Locus sp. BAC
4 3q29 Locus sp. BAC
5 7q31.1 Locus sp. BAC
6 8q22 Locus sp. BAC
7 8q24.21 Locus sp. BAC
8 8q24.23 Locus sp. BAC
9 9p21.1 Locus sp. BAC
10 9q34 ABL1 BAC
11 9q34.12 ABL1 BAC
12 9q34.3 ABL1 BAC
13 11q25 ABL1 BAC
14 12q24.33 ABL1 BAC
15 13q14.2 Locus sp. YAC, BAC
16 15q24.1 PML1 BAC
17 17q12 Locus sp. BAC
18 17q12 Locus sp. BAC
19 17q21.2 RARA BAC
20 20p12.2 Locus sp. BAC
21 21 Locus sp. YAC
22 21 Locus sp. BAC
23 21q22 AML1 BAC
24 Xp22.31 Locus sp. BAC
25 Xq28 Locus sp. BAC
26 Yp11.2 Locus sp. BAC
27 Yp11.2 Locus sp. BAC
28 Yp11.31 Locus sp. BAC
29 Yp11.221 Locus sp. BAC
30 Yq11.223 Locus sp. BAC
31 Yq11.23 AZFb/AZFc BAC
7q chromosome Normal in metaphase & interphase7q chromosome Mosaic in metaphase & interphase
William Syndrome (7q11.2)
22q chromosome Normal in metaphase & interphase 22q chromosome Mosaic in metaphase & interphase
22q chromosome Mosaic in metaphase & interphase
22q chromosome Deletion in metaphase & interphase
Digeorge Syndrome (22q11.2)
15q11-13 chromosome deletion in Buccal cell
15q11-13 chromosome Mosaic metaphase & interphase
15q11-13 chromosome deletion in Urine cell
15q11-13 chromosome deletion in metaphase & interphase cells
Praderwilli Syndrome (15q11-13)
XY SRY FISH
Y –ve/SRY +ve
SRY FISH
SRY on Xp
XY FISH
MKFS
XY FISH
KFS
XY FISH
N
Gonosomal (XY) FISH
Philadelphia chromosome t(9;22)(q34;q11)
Breast Cancer Tissue
(after digestion)
Breast Cancer Tissue
(after digestion)
Her2/Neu amplification
Br Ca
Cervical Cancer Tissue
(after digestion)
Cervical Cancer Tissue
(after digestion)
Cervical Carcinoma: C-MYC amplification
Embryo at different cell stage
Embryo
Embryo at different cell stage after XY FISH
Application of FISH
• Microdeletion syndrome
• Prenatal chromosome analysis
• Hematologic Malignancies (ie, bcr/abl, PML/RARA)
• Marker Chromosome Identification
• Sex chromosome chimerism
• Preimplantation chromosome analysis
• Solid tissue tumor
• Postnatal chromosome analysis
 Cryptic Chromosomal Rearrangements
• It is a method of target DNA sequence detection and localization
that combines features of FISH and polymerase chain reaction
• It is based on in situ annealing of a specific oligonucleotide primer
followed by primer elongation by Taq DNA polymerase in the
presence of labeled nucleotides.
• It is specific, simple, cost effective and rapid technique.
• It does not require a previously labeled probe.
Primer In Situ Labelling
• DNA is linearized and denatured (ssDNA),
• primer anneals and synthesis of new strand of DNA
(incorporating labeled nucleotides) by Taq DNA polymerase
(size should be 200-1000 bp)
PRINS (PRimed INSitu Labeling/Synthesis)
PRINS (PRimed INSitu Labeling/Synthesis)
Principle
Metaphase chromosome or Interphase Cell (DNA) onto microscope slide

Oligonucleotide primer (specific for chromosomes) + nucleotides including labeled
+ Taq DNA polymerase + Buffer

Denatured together onto a glass microscopic slide (93C for 3 min)

Annealed at 60C for 10 min

Extension/elongation (with Taq polymerase) at 72C for 15 min

[One (simple) or many (cycling) cycles]

Stop reaction by dipping into EDTA solution (0.2 M) at 65C for 1 min

Washing of excess and unbound probes (room temperature few minutes)

Visualization under fluorescent microscope (for direct PRINS or application of
detection system for indirect PRINS)
One primer each specific for centromere/alphoid of chromosome X, Y, 13, 18 & 21 as follows:
Primer Sequence (5’-3’) Concentration (pM) Annealing Temp
X centromere GTTCAGCTCTGTGAGTGAAA 75 68ºC
Yqh TCCATTCGATTCCATTTTTTTCGAGAA 100 56ºC
13 centromere TGATGTGTGTACCCAGCT 100 60ºC
18 centromere ATGTGTGTCCTCAACTAAAG 100 65ºC
21 centromere TGATGTGTGTACCCAGCC 150 61ºC
Primers standardized in our lab
Primed in situ labeling/synthesis
images on metaphase as well as
interphase cells
Conclusion
• Lab made probes highly reduce the cost of FISH/PRINS test
making the techniques approachable for patients
• Alphoid, locus specific/Microdeletion syndromes &
Amplification of oncogenes and microdeletion of tumor-
suppressor genes in malignancies can be detected at a much
lower price by using lab made probes as compared to the
commercial probes.
ecTHANK YOU
Dr. Manish Jain
Scientist
Department of Reproductive Biology
All India Institute of Medical Sciences
New Delhi
Publication:
Research Papers (Indexed Journals): 15
Chapters in Books : 2
Poster Presentation in National & International Conferences: 8
Demostrator cum tutor in National Workshop on Molecular
Cytogenetic techniques: 7 times

Contenu connexe

Tendances

Explanation slides X Inactivation
Explanation slides X InactivationExplanation slides X Inactivation
Explanation slides X Inactivation
meducationdotnet
 

Tendances (20)

POST TRANSCRIPTIONAL MODIFICATIONS IN EUKARYOTES
POST TRANSCRIPTIONAL MODIFICATIONS IN EUKARYOTESPOST TRANSCRIPTIONAL MODIFICATIONS IN EUKARYOTES
POST TRANSCRIPTIONAL MODIFICATIONS IN EUKARYOTES
 
Prokaryotic genome organization
Prokaryotic genome organizationProkaryotic genome organization
Prokaryotic genome organization
 
DNA Supercoiling
DNA Supercoiling DNA Supercoiling
DNA Supercoiling
 
Pathway analysis 2012
Pathway analysis 2012Pathway analysis 2012
Pathway analysis 2012
 
Gene regulation
Gene regulationGene regulation
Gene regulation
 
Lac operon
Lac operonLac operon
Lac operon
 
miRNA
miRNAmiRNA
miRNA
 
Small nuclear rna
Small nuclear rnaSmall nuclear rna
Small nuclear rna
 
Explanation slides X Inactivation
Explanation slides X InactivationExplanation slides X Inactivation
Explanation slides X Inactivation
 
Ab Initio Protein Structure Prediction
Ab Initio Protein Structure PredictionAb Initio Protein Structure Prediction
Ab Initio Protein Structure Prediction
 
Types of PCR
Types of PCRTypes of PCR
Types of PCR
 
PCR Primer desining
PCR Primer desiningPCR Primer desining
PCR Primer desining
 
Gene regulation operon
Gene regulation operonGene regulation operon
Gene regulation operon
 
karyotyping and cell division.ppt..
karyotyping and cell division.ppt..karyotyping and cell division.ppt..
karyotyping and cell division.ppt..
 
Phylogenetic tree and its construction and phylogeny of
Phylogenetic tree and its construction and phylogeny ofPhylogenetic tree and its construction and phylogeny of
Phylogenetic tree and its construction and phylogeny of
 
Transcriptomics and metabolomics
Transcriptomics and metabolomicsTranscriptomics and metabolomics
Transcriptomics and metabolomics
 
GENOME ORGANISATION IN EUKARYOTES
GENOME ORGANISATION IN EUKARYOTESGENOME ORGANISATION IN EUKARYOTES
GENOME ORGANISATION IN EUKARYOTES
 
Exon shuffling
Exon shufflingExon shuffling
Exon shuffling
 
Significance of shine dalgarno sequence
Significance of shine dalgarno sequenceSignificance of shine dalgarno sequence
Significance of shine dalgarno sequence
 
X chromosome inactivation
X chromosome inactivationX chromosome inactivation
X chromosome inactivation
 

En vedette

Ponce De Leon Vocabulary
Ponce De Leon VocabularyPonce De Leon Vocabulary
Ponce De Leon Vocabulary
Shauna McCarthy
 
Refleksi etika professioanal
Refleksi etika professioanalRefleksi etika professioanal
Refleksi etika professioanal
yeesan
 
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gònchuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
sara869
 
chuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
chuyên dịch vụ giúp việc theo tháng cao cấp sài gònchuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
chuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
arnulfo238
 
chuyên dịch vụ giúp việc quận phú nhuận tại tphcm
chuyên dịch vụ giúp việc quận phú nhuận tại tphcmchuyên dịch vụ giúp việc quận phú nhuận tại tphcm
chuyên dịch vụ giúp việc quận phú nhuận tại tphcm
kristle864
 
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
Fotini Kyriakou
 
chuyên dịch vụ giúp việc bảo đảm tại hcm
chuyên dịch vụ giúp việc bảo đảm tại hcmchuyên dịch vụ giúp việc bảo đảm tại hcm
chuyên dịch vụ giúp việc bảo đảm tại hcm
shizuko401
 

En vedette (20)

Property Times eMagazine March 2014
Property Times  eMagazine March  2014Property Times  eMagazine March  2014
Property Times eMagazine March 2014
 
Nuclear medicine opd
Nuclear medicine opdNuclear medicine opd
Nuclear medicine opd
 
Debate
DebateDebate
Debate
 
Ponce De Leon Vocabulary
Ponce De Leon VocabularyPonce De Leon Vocabulary
Ponce De Leon Vocabulary
 
Refleksi etika professioanal
Refleksi etika professioanalRefleksi etika professioanal
Refleksi etika professioanal
 
Bab11 t jaringan_telekomu
Bab11 t jaringan_telekomuBab11 t jaringan_telekomu
Bab11 t jaringan_telekomu
 
Gastro intestinal surgery opd
Gastro intestinal surgery opdGastro intestinal surgery opd
Gastro intestinal surgery opd
 
Os final project
Os final projectOs final project
Os final project
 
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gònchuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
chuyên dịch vụ giúp việc gia đình chuyên nghiệp sài gòn
 
E learning
E learningE learning
E learning
 
chuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
chuyên dịch vụ giúp việc theo tháng cao cấp sài gònchuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
chuyên dịch vụ giúp việc theo tháng cao cấp sài gòn
 
chuyên dịch vụ giúp việc quận phú nhuận tại tphcm
chuyên dịch vụ giúp việc quận phú nhuận tại tphcmchuyên dịch vụ giúp việc quận phú nhuận tại tphcm
chuyên dịch vụ giúp việc quận phú nhuận tại tphcm
 
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
ΓΡΑΦΗΜΑ ΙΤΑΛΙΑΣ
 
chuyên dịch vụ giúp việc bảo đảm tại hcm
chuyên dịch vụ giúp việc bảo đảm tại hcmchuyên dịch vụ giúp việc bảo đảm tại hcm
chuyên dịch vụ giúp việc bảo đảm tại hcm
 
12JA-ISPE
12JA-ISPE12JA-ISPE
12JA-ISPE
 
Gastroenterology opd
Gastroenterology opdGastroenterology opd
Gastroenterology opd
 
Bab8 brainware
Bab8 brainwareBab8 brainware
Bab8 brainware
 
850 Anh van thong dung
850 Anh van thong dung850 Anh van thong dung
850 Anh van thong dung
 
Faith needs for detainees in police stations
Faith needs for detainees in police stationsFaith needs for detainees in police stations
Faith needs for detainees in police stations
 
Property Times October 2014
Property Times October 2014Property Times October 2014
Property Times October 2014
 

Similaire à Reduction of cost of Genetics diagnosis test through FISH & PRINS

Similaire à Reduction of cost of Genetics diagnosis test through FISH & PRINS (20)

Rflp marker
Rflp markerRflp marker
Rflp marker
 
Molecular techniques
Molecular techniquesMolecular techniques
Molecular techniques
 
Insuite hybridization
Insuite hybridizationInsuite hybridization
Insuite hybridization
 
Kenyatta university. dna extration docx
Kenyatta university. dna extration docxKenyatta university. dna extration docx
Kenyatta university. dna extration docx
 
Overcoming challenges of host cell DNA removal in vaccine manufacturing
Overcoming challenges of host cell DNA removal in vaccine manufacturingOvercoming challenges of host cell DNA removal in vaccine manufacturing
Overcoming challenges of host cell DNA removal in vaccine manufacturing
 
Gene Cloning
Gene CloningGene Cloning
Gene Cloning
 
485 lec5 exploring_the_genome
485 lec5 exploring_the_genome485 lec5 exploring_the_genome
485 lec5 exploring_the_genome
 
Barcode Data Standards
Barcode Data Standards Barcode Data Standards
Barcode Data Standards
 
recombinant DNA with subtopics
recombinant DNA with subtopicsrecombinant DNA with subtopics
recombinant DNA with subtopics
 
Molecular Biological Techniques in Zoology
Molecular Biological Techniques in ZoologyMolecular Biological Techniques in Zoology
Molecular Biological Techniques in Zoology
 
Hoofdstuk 20 2008 deel 2
Hoofdstuk 20 2008 deel 2Hoofdstuk 20 2008 deel 2
Hoofdstuk 20 2008 deel 2
 
Characteristics of transgenic Fish
Characteristics of transgenic FishCharacteristics of transgenic Fish
Characteristics of transgenic Fish
 
Dna Based Molecular Diagnosis(CMH)Final (1).pptx
Dna Based Molecular Diagnosis(CMH)Final (1).pptxDna Based Molecular Diagnosis(CMH)Final (1).pptx
Dna Based Molecular Diagnosis(CMH)Final (1).pptx
 
Cloning dna f inal
Cloning dna f inalCloning dna f inal
Cloning dna f inal
 
DETECTION OF HELMINTHS BY USING RADIOACTIVE.
DETECTION OF HELMINTHS BY USING RADIOACTIVE.DETECTION OF HELMINTHS BY USING RADIOACTIVE.
DETECTION OF HELMINTHS BY USING RADIOACTIVE.
 
222396 lecture 14 15
222396 lecture 14 15222396 lecture 14 15
222396 lecture 14 15
 
Report on molecular biology techniques
Report on molecular biology techniquesReport on molecular biology techniques
Report on molecular biology techniques
 
basic molecular biology techniques.ppt
basic molecular biology techniques.pptbasic molecular biology techniques.ppt
basic molecular biology techniques.ppt
 
basic molecular biology techniques.ppt
basic molecular biology techniques.pptbasic molecular biology techniques.ppt
basic molecular biology techniques.ppt
 
Class9 DNA technology in secondary school
Class9 DNA technology in secondary schoolClass9 DNA technology in secondary school
Class9 DNA technology in secondary school
 

Plus de nisaiims

Plus de nisaiims (20)

Paediatricsurgeryopd 150406061247-conversion-gate01
Paediatricsurgeryopd 150406061247-conversion-gate01Paediatricsurgeryopd 150406061247-conversion-gate01
Paediatricsurgeryopd 150406061247-conversion-gate01
 
Patient guide for AIIMS video consults
Patient guide for AIIMS video consultsPatient guide for AIIMS video consults
Patient guide for AIIMS video consults
 
Medical Documentation in Emergency Department: Issues and Hurdles
Medical Documentation in Emergency Department:Issues and HurdlesMedical Documentation in Emergency Department:Issues and Hurdles
Medical Documentation in Emergency Department: Issues and Hurdles
 
E-Learning in Newborn Health A paradigm shift in continuing professional deve...
E-Learning in Newborn HealthA paradigm shift in continuing professional deve...E-Learning in Newborn HealthA paradigm shift in continuing professional deve...
E-Learning in Newborn Health A paradigm shift in continuing professional deve...
 
Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...
 
PNEUMATIC TUBE SYSTEM
PNEUMATIC TUBE SYSTEMPNEUMATIC TUBE SYSTEM
PNEUMATIC TUBE SYSTEM
 
Automated phlebotomy tube labeller
Automatedphlebotomy tube labellerAutomatedphlebotomy tube labeller
Automated phlebotomy tube labeller
 
BENEFITS OF LIS IN BIOCHEMISTRY LAB
BENEFITS OF LIS IN BIOCHEMISTRY LABBENEFITS OF LIS IN BIOCHEMISTRY LAB
BENEFITS OF LIS IN BIOCHEMISTRY LAB
 
Cost Effective Technology of Medical Health Care in Medical Institutions
Cost Effective Technology of Medical Health Care in Medical InstitutionsCost Effective Technology of Medical Health Care in Medical Institutions
Cost Effective Technology of Medical Health Care in Medical Institutions
 
Emergency Nurse Coordinator (ENC)- Building Block of Critical Communication
Emergency Nurse Coordinator (ENC)- Building Block of Critical CommunicationEmergency Nurse Coordinator (ENC)- Building Block of Critical Communication
Emergency Nurse Coordinator (ENC)- Building Block of Critical Communication
 
Nursing Informatics Specialists (NIS) –A story of shift
Nursing Informatics Specialists (NIS) –A story of shiftNursing Informatics Specialists (NIS) –A story of shift
Nursing Informatics Specialists (NIS) –A story of shift
 
Communication Skills in High-Stake Environment
Communication Skills in High-Stake EnvironmentCommunication Skills in High-Stake Environment
Communication Skills in High-Stake Environment
 
PATIENT DISPLAY SYSTEM
PATIENT  DISPLAY SYSTEMPATIENT  DISPLAY SYSTEM
PATIENT DISPLAY SYSTEM
 
Disposable Ventilator-A dream or reality 
Disposable Ventilator-A dream or reality Disposable Ventilator-A dream or reality 
Disposable Ventilator-A dream or reality 
 
Etco2 in non-intubated patient: a must in ed
Etco2 in  non-intubated patient: a must in edEtco2 in  non-intubated patient: a must in ed
Etco2 in non-intubated patient: a must in ed
 
CREATING AN ULTRASOUND TEAM
CREATING AN ULTRASOUND TEAMCREATING AN ULTRASOUND TEAM
CREATING AN ULTRASOUND TEAM
 
Emergency sonography. Empowering resuscitation
Emergency sonography. Empowering resuscitation   Emergency sonography. Empowering resuscitation
Emergency sonography. Empowering resuscitation
 
REAP
REAPREAP
REAP
 
Paediatric medicine opdworkflow
Paediatric medicine opdworkflowPaediatric medicine opdworkflow
Paediatric medicine opdworkflow
 
Improving Emergency Care Of Neurosurgery Patients By ENCs In AIIMS
Improving Emergency Care Of Neurosurgery Patients By ENCs In AIIMSImproving Emergency Care Of Neurosurgery Patients By ENCs In AIIMS
Improving Emergency Care Of Neurosurgery Patients By ENCs In AIIMS
 

Dernier

VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
adityaroy0215
 
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
Sheetaleventcompany
 
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Sheetaleventcompany
 
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near MeRussian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
mriyagarg453
 
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetSambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetMuzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetraisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in ChandigarhChandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Sheetaleventcompany
 
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In FaridabadCall Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
gragmanisha42
 
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetHubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetOzhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Call Girls Service
 
VIP Call Girl Sector 32 Noida Just Book Me 9711199171
VIP Call Girl Sector 32 Noida Just Book Me 9711199171VIP Call Girl Sector 32 Noida Just Book Me 9711199171
VIP Call Girl Sector 32 Noida Just Book Me 9711199171
Call Girls Service Gurgaon
 
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real MeetCall Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
priyashah722354
 

Dernier (20)

VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
VIP Call Girl Sector 88 Gurgaon Delhi Just Call Me 9899900591
 
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
Call Girl In Zirakpur ❤️♀️@ 9988299661 Zirakpur Call Girls Near Me ❤️♀️@ Sexy...
 
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
Punjab❤️Call girls in Mohali ☎️7435815124☎️ Call Girl service in Mohali☎️ Moh...
 
(Ajay) Call Girls in Dehradun- 8854095900 Escorts Service 50% Off with Cash O...
(Ajay) Call Girls in Dehradun- 8854095900 Escorts Service 50% Off with Cash O...(Ajay) Call Girls in Dehradun- 8854095900 Escorts Service 50% Off with Cash O...
(Ajay) Call Girls in Dehradun- 8854095900 Escorts Service 50% Off with Cash O...
 
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near MeRussian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
Russian Call Girls in Noida Pallavi 9711199171 High Class Call Girl Near Me
 
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetSambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Sambalpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
❤️♀️@ Jaipur Call Girls ❤️♀️@ Jaispreet Call Girl Services in Jaipur QRYPCF ...
❤️♀️@ Jaipur Call Girls ❤️♀️@ Jaispreet Call Girl Services in Jaipur QRYPCF  ...❤️♀️@ Jaipur Call Girls ❤️♀️@ Jaispreet Call Girl Services in Jaipur QRYPCF  ...
❤️♀️@ Jaipur Call Girls ❤️♀️@ Jaispreet Call Girl Services in Jaipur QRYPCF ...
 
Call Girls Thane Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Thane Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Thane Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Thane Just Call 9907093804 Top Class Call Girl Service Available
 
Call Now ☎ 9999965857 !! Call Girls in Hauz Khas Escort Service Delhi N.C.R.
Call Now ☎ 9999965857 !! Call Girls in Hauz Khas Escort Service Delhi N.C.R.Call Now ☎ 9999965857 !! Call Girls in Hauz Khas Escort Service Delhi N.C.R.
Call Now ☎ 9999965857 !! Call Girls in Hauz Khas Escort Service Delhi N.C.R.
 
Enjoyment ★ 8854095900 Indian Call Girls In Dehradun 🍆🍌 By Dehradun Call Girl ★
Enjoyment ★ 8854095900 Indian Call Girls In Dehradun 🍆🍌 By Dehradun Call Girl ★Enjoyment ★ 8854095900 Indian Call Girls In Dehradun 🍆🍌 By Dehradun Call Girl ★
Enjoyment ★ 8854095900 Indian Call Girls In Dehradun 🍆🍌 By Dehradun Call Girl ★
 
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
ooty Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetMuzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Muzaffarpur Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meetraisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
raisen Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in ChandigarhChandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
Chandigarh Escorts, 😋9988299661 😋50% off at Escort Service in Chandigarh
 
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In FaridabadCall Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
Call Girls Service Faridabad 📲 9999965857 ヅ10k NiGhT Call Girls In Faridabad
 
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetHubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Hubli Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real MeetOzhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
Ozhukarai Call Girls 👙 6297143586 👙 Genuine WhatsApp Number for Real Meet
 
VIP Call Girl Sector 32 Noida Just Book Me 9711199171
VIP Call Girl Sector 32 Noida Just Book Me 9711199171VIP Call Girl Sector 32 Noida Just Book Me 9711199171
VIP Call Girl Sector 32 Noida Just Book Me 9711199171
 
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real MeetCall Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
Call Girls Chandigarh 👙 7001035870 👙 Genuine WhatsApp Number for Real Meet
 
❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
❤️♀️@ Jaipur Call Girl Agency ❤️♀️@ Manjeet Russian Call Girls Service in Jai...
 

Reduction of cost of Genetics diagnosis test through FISH & PRINS

  • 1. CEUTEH‘16 Dr.Manish Jain • Scientist,Department of Reproductive Biology All India Institute of Medical Sciences New Delhi Publication: • Research Papers (Indexed Journals): 15 • Chapters in Books : 2 • Poster Presentation in National & International Conferences: 8 • Demostrator cum tutor in National Workshop on Molecular • Cytogenetic techniques: 7 times
  • 2. Reduction of cost of Genetics diagnosis test through FISH & PRINS Dr. Manish Jain Scientist Department of Reproductive Biology All India Institute of Medical Sciences New Delhi
  • 3. • A genetic disorder is a genetic problem caused by one or more abnormalities in the genome, especially a condition that is present by birth (congenital). • Defects may occur during gamete formation or fetal development due to endogenous or exogenous factors. • These may cause birth defects like developmental delay, behavioral problems and intellectual disability; abortions or infertility compromising with reproductive health. Genetics Disorders
  • 4. GENETIC DEFECTS DURING GAMETE FORMATION AND FETAL DEVELOPMENT CHROMOSOMAL DEFECTS GENE DEFECTS Change in the structure of chromosome Change in number of chromosomes Addition or deletion of a nucleotide Replacement of one nucleotide by another
  • 5. SAMPLE COLLECTION (BLOOD/ AMNIOTIC FLUID/ SOLID TISSUE/ BONE MARROW) CYTOGENETIC TESTING KARYOTYPE FISH PRINS aCGH Methods of Investigations
  • 6. Karyotype • Advantages – Whole genome scan – Relative low cost • Disadvantages – Labor intensive – Detection above 5 Mb 46, XY chromosome
  • 7. Drawback of Karyotype • The material doesn't contain metaphase chromosomes – Unsuccessful cultivation – It isn't possible to cultivate the tissue from patient (preimplantation analysis, rapid prenatal examinations, examinations of solid tumors or autopsy material) • Analysis of complicated chromosomal rearrangements • Identification of marker chromosomes • Analysis of low-frequency mosaic • Diagnosis of submicroscopic (cryptic) chromosomal rearrangements – Microdeletion syndromes – Amplification of oncogenes and microdeletion of tumor- suppressor genes in malignancies
  • 8. • A technique that hybridizes a DNA nucleic acid probe to a target DNA sequence contained within a cell nucleus. FISH
  • 9. FISH for Detection of Single to Multiple Genetic Events Single Target One color Dual Targets Two colors Multiple Targets Multi- colors Allows one to look at multiple genomic changes within a single cell, without destruction of the cellular morphology.
  • 10. A G G C T A T T C C G A T A COVALENT BOND F F Specimen DNA FISH Probe DNA • Probe is a nucleic acid (DNA or RNA) that o labeled with a marker which allows identification and quantitation o hybridize to another nucleic acid on the basis of base complementarity Probes
  • 11. Types of probes Centromeric (satellite) probes Locus specific probes Whole chromosome painting probes
  • 12. Company Probe Cost • Vysis • Kreatech • Cytocell Per slide cost : Rs.8000 – 12000 ?
  • 13. Human Probe Preparation BAC/PAC/Plasmid DNA Probe cloning • Clones are shipped as bacterial LB agar stab culture. • DH5α E.coli host is harboring a DNA insert that has been placed into LB agar. • Recommended to streak the culture to single colonies on a LB agar plate with a specific antibiotic and prepare a glycerol stock of the clones for long-term storage at - 80°C. • Amplification of BAC/PAC/Plasmid DNA for probe preparation • Extraction of BAC/PAC/Plasmid DNA for FISH Probe Preparation 1.a 1.b 1.c 1.d 1.e 1.f
  • 14. Labeling of Probes Nick translation labeling • No need for linearization or denaturation of DNA. • DNA is nicked by DNAse and DNA polymerase I replace excised nucleotides by labeled/unlabeled nucleotides.
  • 15. Protocol for Direct Nick Translation • 1.5 ml microcentrifuge tube is placed on ice and to the tube, following ingredients added: • Sterile distilled H2O Y µl • 10X conc. nick translation buffer (NTB) 5µl • [NTB-500 mM Tris-HCL (pH 7.8), 50mM Mg Cl2, 0.5 mg/ml BSA (nuclease-free) • 100 mM Dithiothreitol 5 µl • dNTP Nucleotide mixture 4µl • [dNTP-0.5 mM each of d ATP, dGTP, and d CTP; 0.1 mM dTTP] • 1 mM fluorochrome –labeled dUTP( DIG/Biotin) 0.5µl • 1 µg template DNA X µl • DNase I 5µl • DNA polymerase I (2 units) 0.5 µl The ingredients are mixed and tube is centrifuged briefly. It is incubated at 15°C for 45 minutes. After 45 mins, 5µl of Diluted DNase is added. Further incubated at 15°C for 45 minutes. Immediately after incubation, chilling of the reaction tube is done on ice. To Stop reaction • Add • 0.5 M EDTA 2.5l • Herring sperm DNA (blocks repetitive sequences) 2.5l • 3 M sodium acetate (0.1vol) 3.0l • Cold absolute alcohol 100% (2.5 vol) 500l
  • 16. Microdeletion DNA Probe Clones (non commercial) in our library
  • 17. S.N Chromosome Probe Type Site Clone type 1 X Alphoid Centromere Plasmid 2 Y Alphoid, Heterochroma. Centromere, qh Plasmid 3 1 Hetrochroma. qh Plasmid 4 2 Alphoid Centromere Plasmid 5 3 Alphoid Centromere Plasmid 6 4 Alphoid Centromere Plasmid 7 6 Alphoid Centromere Plasmid 8 7 Alphoid Centromere Plasmid 9 8 Alphoid Centromere Plasmid 10 9 Hetrochroma. qh Plasmid 11 10 Alphoid Centromere Plasmid 12 11 Alphoid Centromere Plasmid 13 12 Alphoid Centromere Plasmid 14 13/21 Alphoid Centromere Plasmid 15 14/22 Alphoid Centromere Plasmid 16 15 Alphoid Centromere Plasmid 17 16 Alphoid Centromere Plasmid 18 17 Alphoid Centromere Plasmid 19 18 Alphoid Centromere Plasmid 20 20 Alphoid Centromere Plasmid 21 21 Alphoid Centromere Plasmid 22 22 Alphoid Centromere Plasmid 23 NOR Alphoid Satellite Plasmid Alphoid DNA Probe Clones (non commercial) in our library
  • 18. Locus Specific DNA Probe Clones (non commercial) in our library S.N Chromosome Probe Type Clone type 1 1p36.33 Locus sp. BAC 2 2p24.3 Locus sp. BAC 3 3p25.1 Locus sp. BAC 4 3q29 Locus sp. BAC 5 7q31.1 Locus sp. BAC 6 8q22 Locus sp. BAC 7 8q24.21 Locus sp. BAC 8 8q24.23 Locus sp. BAC 9 9p21.1 Locus sp. BAC 10 9q34 ABL1 BAC 11 9q34.12 ABL1 BAC 12 9q34.3 ABL1 BAC 13 11q25 ABL1 BAC 14 12q24.33 ABL1 BAC 15 13q14.2 Locus sp. YAC, BAC 16 15q24.1 PML1 BAC 17 17q12 Locus sp. BAC 18 17q12 Locus sp. BAC 19 17q21.2 RARA BAC 20 20p12.2 Locus sp. BAC 21 21 Locus sp. YAC 22 21 Locus sp. BAC 23 21q22 AML1 BAC 24 Xp22.31 Locus sp. BAC 25 Xq28 Locus sp. BAC 26 Yp11.2 Locus sp. BAC 27 Yp11.2 Locus sp. BAC 28 Yp11.31 Locus sp. BAC 29 Yp11.221 Locus sp. BAC 30 Yq11.223 Locus sp. BAC 31 Yq11.23 AZFb/AZFc BAC
  • 19. 7q chromosome Normal in metaphase & interphase7q chromosome Mosaic in metaphase & interphase William Syndrome (7q11.2)
  • 20. 22q chromosome Normal in metaphase & interphase 22q chromosome Mosaic in metaphase & interphase 22q chromosome Mosaic in metaphase & interphase 22q chromosome Deletion in metaphase & interphase Digeorge Syndrome (22q11.2)
  • 21. 15q11-13 chromosome deletion in Buccal cell 15q11-13 chromosome Mosaic metaphase & interphase 15q11-13 chromosome deletion in Urine cell 15q11-13 chromosome deletion in metaphase & interphase cells Praderwilli Syndrome (15q11-13)
  • 22. XY SRY FISH Y –ve/SRY +ve SRY FISH SRY on Xp XY FISH MKFS XY FISH KFS XY FISH N Gonosomal (XY) FISH
  • 24.
  • 30. Cervical Carcinoma: C-MYC amplification
  • 31. Embryo at different cell stage Embryo
  • 32. Embryo at different cell stage after XY FISH
  • 33. Application of FISH • Microdeletion syndrome • Prenatal chromosome analysis • Hematologic Malignancies (ie, bcr/abl, PML/RARA) • Marker Chromosome Identification • Sex chromosome chimerism • Preimplantation chromosome analysis • Solid tissue tumor • Postnatal chromosome analysis  Cryptic Chromosomal Rearrangements
  • 34. • It is a method of target DNA sequence detection and localization that combines features of FISH and polymerase chain reaction • It is based on in situ annealing of a specific oligonucleotide primer followed by primer elongation by Taq DNA polymerase in the presence of labeled nucleotides. • It is specific, simple, cost effective and rapid technique. • It does not require a previously labeled probe. Primer In Situ Labelling • DNA is linearized and denatured (ssDNA), • primer anneals and synthesis of new strand of DNA (incorporating labeled nucleotides) by Taq DNA polymerase (size should be 200-1000 bp) PRINS (PRimed INSitu Labeling/Synthesis)
  • 35. PRINS (PRimed INSitu Labeling/Synthesis) Principle Metaphase chromosome or Interphase Cell (DNA) onto microscope slide  Oligonucleotide primer (specific for chromosomes) + nucleotides including labeled + Taq DNA polymerase + Buffer  Denatured together onto a glass microscopic slide (93C for 3 min)  Annealed at 60C for 10 min  Extension/elongation (with Taq polymerase) at 72C for 15 min  [One (simple) or many (cycling) cycles]  Stop reaction by dipping into EDTA solution (0.2 M) at 65C for 1 min  Washing of excess and unbound probes (room temperature few minutes)  Visualization under fluorescent microscope (for direct PRINS or application of detection system for indirect PRINS)
  • 36. One primer each specific for centromere/alphoid of chromosome X, Y, 13, 18 & 21 as follows: Primer Sequence (5’-3’) Concentration (pM) Annealing Temp X centromere GTTCAGCTCTGTGAGTGAAA 75 68ºC Yqh TCCATTCGATTCCATTTTTTTCGAGAA 100 56ºC 13 centromere TGATGTGTGTACCCAGCT 100 60ºC 18 centromere ATGTGTGTCCTCAACTAAAG 100 65ºC 21 centromere TGATGTGTGTACCCAGCC 150 61ºC Primers standardized in our lab Primed in situ labeling/synthesis images on metaphase as well as interphase cells
  • 37. Conclusion • Lab made probes highly reduce the cost of FISH/PRINS test making the techniques approachable for patients • Alphoid, locus specific/Microdeletion syndromes & Amplification of oncogenes and microdeletion of tumor- suppressor genes in malignancies can be detected at a much lower price by using lab made probes as compared to the commercial probes.
  • 39. Dr. Manish Jain Scientist Department of Reproductive Biology All India Institute of Medical Sciences New Delhi Publication: Research Papers (Indexed Journals): 15 Chapters in Books : 2 Poster Presentation in National & International Conferences: 8 Demostrator cum tutor in National Workshop on Molecular Cytogenetic techniques: 7 times

Notes de l'éditeur

  1. It affects the functioning of the male and female during all stages of life. The birth of a healthy baby is the result of fertilization of good quality gametes and development of resulting zygote in mother’s womb. Genetic investigation includes the analysis of chromosomes, DNA, RNA, genes, and/or gene products to determine whether an alteration is present that is causing or is likely to cause a specific disease or condition. Genetic defects occur at the level of genes point mutations, deletion, microdeletion duplication chromosomes – change in number or structure of chromosomes.
  2. Libraries may have little contamination hence it would be wise, before initiating any experiments, to check 3-5 colonies on LB agar plates. This to make sure that the clone stock is pure.