2. ORIGINAL ARTICLE: GENETICS
biopsy without the need for multiple unique technological
platforms.
Clinical studies within other settings have already been
conducted using NGS technology (3, 4), as well as high-throughput
studies used to target specific sequence variants
(5). Many sequencing platforms exist that are capable of
NGS with varying degrees of sequence depth, coverage, and
throughput (6). Despite the potential power to increase
throughput and evaluate multiple genetic loci in parallel, it
is also well known that NGS technology can introduce se-quencing
artifacts (technical errors) which may complicate
its application to PGD. For example, insufficient sequencing
depth may result in false positive or negative identification
of a mutation. Sequence depth refers to the number of re-peated
sequence reads at a given position in the genome, or
in other words, how many times a particular base was suc-cessfully
measured. Depth at a given position is often de-scribed
in terms such as 100 or 200, referring to having
repeatedly observed and assigned a base at a given position
100 or 200 times, respectively. As depth of sequence in-creases,
so does the accuracy in predicting the genotype of
the sample at the given position. Likewise, lower sequencing
depth may lead to decreased accuracy. For example, if 10
depth is achieved and two reads indicate an A and eight reads
a T then there is a lower likelihood of the A being true than if
the depth achieved was 100, and 20 reads indicated an A
and 80 reads a T. Therefore, sufficient sequence depth may
be a critical component to providing the necessary accuracy
when applying NGS to PGD. Furthermore, adaptation of
NGS to limited starting material, such as that obtained
from an embryo biopsy, will be critical to establish its utility
in PGD.
To investigate the applicability of NGS to PGD, the pres-ent
study developed a specific protocol that could evaluate
DNA from a trophectoderm biopsy with the use of semicon-ductor
technology–based NGS (7). This protocol was also de-signed
to provide what was hypothesized to be a more than
sufficient sequencing depth to achieve accurate sequence pre-dictions.
Furthermore, the NGS-based genotype predictions
developed in this study were directly compared with results
from the same embryos with the use of two independent
and more conventional methods of PGD.
MATERIALS AND METHODS
Experimental Design
Excess blinded DNA from embryos and/or lymphocytes de-rived
from IVF-PGD cycles of couples at risk of transmitting
cystic fibrosis (CF), Walker-Warburg syndrome (WWS), fa-milial
dysautonomia (FD), X-linked hypophosphatemic rick-ets
(XHR), or neurofibromatosis 1 (NF1) to their offspring
was evaluated by NGS with the use of the Ion Torrent Personal
Genome Machine (PGM) (Life Tech). Taqman allelic discrimi-nation
assays designed for each mutation (Table 1) were also
run on blinded excess DNA from the same samples. Finally,
results obtained from external PGD reference laboratories
(Genesis Genetics Institute [Detroit] and Reproductive Genet-ics
Institute [Chicago]) from the same embryos were un-blinded
and all three independent methods evaluated for
consistency. A flow chart of sample processing for lympho-cytes
and embryos is shown in Supplemental Figure 1 (avail-able
online at www.fertstert.org).
Lymphocyte DNA
Three cases where lymphocytes were available for analysis
were included. The first case involved two patients with
a risk of transmitting FD because both the female and male
partners were known to be carriers of the IVS20þ6TC mu-tation
in the IKBKAP gene. In the second case, the couple was
at risk of transmitting XHR because the male partner was
hemizygous for the G649D mutation in the PHEX gene. In
the third case, the couple was at risk of transmitting NF1 be-cause
the female partner carried the c.1318CT mutation in
the NF1 gene.
In each of the three cases, two 5-mL blood samples were
received per patient. DNA was purified from the first blood
sample with the use of the QIAamp DNA Blood Maxi Kit (Qia-gen)
and used to validate the Taqman allelic discrimination
assays. The sample concentrations were obtained via Nano-drop
(Thermo Fisher Scientific). Lymphocyte samples (five
lymphocytes per sample to model a trophectoderm biopsy)
were then obtained as previously described (8) from the sec-ond
blood sample. Four replicates of these five-lymphocyte
samples were lysed and preamplified with a primer pool con-sisting
of previously described assays to interrogate aneu-ploidy
(8) and the assay targeting the mutation for each
patient (Table 1). The preamplification samples were then
genotyped with the use of quantitative polymerase chain
reaction (qPCR) and Taqman allelic discrimination. The ex-cess
preamplification samples were then used to sequence
each patient on the PGM.
Blastocyst Trophectoderm DNA
Three cases where excess embryo biopsy DNA was available
for analysis were included. The first case involved a couple
at risk of transmitting CF because the female partner carried
the DF508 CFTR mutation and the male partner carried the
DI507 CFTR mutation. In the second case, the female partner
carried the W1282X CFTR mutation and the male partner car-ried
the D1152H CFTR mutation. In the third case, the couple
was at risk of having children affected with WWS because
both partners carried the c.1167insA mutation in the FKTN
gene.
In each of the three cases, two trophectoderm biopsies
were obtained from each blastocyst, one for SGD screening
at a PGD reference laboratory and one for comprehensive
chromosome screening (CCS) at RMA Genetics (Morristown,
NJ) as previously described (8). Additional primers/probes
for the mutations were included in the original CCS primer
pool such that the excess preamplified DNA produced as
part of the CCS process could be directly used to conduct Taq-man
allelic discrimination of the mutation loci. The assays
were first validated on purified DNA samples from known
carriers for each mutation. Additional excess embryonic
CCS-preamplified DNA was also used as template for PGM-based
NGS as described subsequently. The biopsy samples ob-tained
for the reference laboratory were sent for analysis only
1378 VOL. 99 NO. 5 / APRIL 2013
3. from the embryos identified as euploid by CCS for the DI507-
DF508 CFTR case to reduce costs to the patient. All of the bi-opsy
samples obtained for the reference laboratory were sent
for the second and third cases.
NGS Data Acquisition
Whole-blood purified DNA samples were normalized to 5
ng/mL and amplified for 14 cycles of PCR with the use of
the Taqman allelic discrimination primers targeting the mu-tations
(Table 1) and Preamp Master Mix as recommended
by the supplier (Life Technologies). The Ion Xpress Plus
gDNA and Amplicon Library Preparation protocol was
used for the nonbarcoded short amplicons procedure as rec-ommended
by the supplier (Life Technologies). The concen-trations
of the amplicon DNA samples were obtained with
the use of a Nanodrop-8000 spectrophotometer and normal-ized
to 100 ng in 79 mL for input into the library construc-tion.
The molar concentration of each amplicon was
obtained with the use of a Bioanalyzer on the Agilent
High-Sensitivity DNA microfluidic chip (Agilent Technolo-gies),
and the samples were then normalized to 26 pmol/L
for template preparation for the Ion Onetouch protocol
(Life Technologies). The Ion Onetouch Template Kit was
used for template preparation and the Ion Sequencing Kit
v2.0 for the Ion 314 Chip–based sequencing, as recommen-ded
(Life Technologies).
Fertility and Sterility®
The same methods as above for whole-blood purified
DNA samples were followed for the sequencing of the tro-phectoderm
and five-lymphocyte sample preamplification
products with several exceptions. The excess CCS preamplifi-cation
product (25 mL) was used in a second preamplification
reaction (100 mL) with only the SGD assay as the primer. The
barcoding protocol was followed at the ‘‘ligate adapters and
nick repair’’ step, and the samples were run on the Ion 316
Chip. For barcoding purposes, Ion Xpress Barcodes 1–16
were used, as well as the Ion P1 Adpater, as recommended
(Life Technologies). Eight samples were barcoded per 316
Chip.
NGS Data Analysis
Fastq files (9) for all of the barcoded samples were obtained
from the Ion Torrent Server. Each Fastq file was aligned
against the reference sequence composed of the nucleotides
in the amplicon generated by the Taqman genotyping assays
(Table 2), with the use of Bowtie 2 (10). Reference sequences
corresponding to the CFTR, FKTN, IKBKAP, PHEX, and NF1
genes were generated from NCBI accession numbers
NG_016465.1, NG_008754.1, NG_008788.1, NG_007563.1,
and NG_009018.1, respectively. Local alignment was done
with default parameters to output the alignment file in Se-quence
Alignment/Map (SAM) format. These files were then
subsequently converted to BAM (binary version of SAM)
TABLE 1
Taqman assay primer and probe sequences.
Mutation Sequence information
CFTR, DI507 Forward primer GGATTATGCCTGGCACCATTAAAGA
Reverse primer CATGCTTTGATGACGCTTCTGTATC
Probe 1: wild type (VIC) ACACCAAAGATGATATTT
Probe 2: mutant (FAM) AAACACCAAAGATATTT
CFTR, DF508 Forward primer GGATTATGCCTGGCACCATTAAAGA
Reverse primer CATGCTTTGATGACGCTTCTGTATC
Probe 1: wild type (VIC) AGGAAACACCAAAGATGATA
Probe 2: mutant (FAM) CATAGGAAACACCAATGATA
CFTR, D1152H Forward primer CATTGCAGTGGGCTGTAAACTC
Reverse primer TGAATTTTTTTCATAAAAGTTAAAAAGATGATAAGACTTACCA
Probe 1: wild type (VIC) AGCTATCCACATCTATGCTG
Probe 2: mutant (FAM) CTATCCACATGTATGCTG
CFTR, W1282X Forward primer ATGGTGTGTCTTGGGATTCAATAACT
Reverse primer TCTGGCTAAGTCCTTTTGCTCAC
Probe 1: wild type (VIC) CAACAGTGGAGGAAAG
Probe 2: mutant (FAM) CAACAGTGAAGGAAAG
FKTN, c.1167insA Forward primer GAATGGAGGCACTCAGGCC
Reverse primer TCTACCTCCTGAAATTATTTCTGTAGTACCTT
Probe 1: wild type (VIC) ATACTTGAATTTTTTTCCTGTTT
Probe 2: mutant (FAM) ATACTTGAATTTTTTTTCCTGTTT
IKBKAP, IVS20þ6TC Forward primer TGGTTTTAGCTCAGATTCGGAAGTG
Reverse primer ACATAAATCACAAGCTAACTAGTCGCAAA
Probe 1: wild type (VIC) TTGGACAAGTAAGTGCCATT
Probe 2: mutant (FAM) TGGACAAGTAAGCGCCATT
PHEX, G649D Forward primer GCTGAATGATAGTTGACCGTGAAAC
Reverse primer GCAGCGCATACCCTAAAAGC
Probe 1: wild type (VIC) CCGCAGGCCTCCAT
Probe 2: mutant (FAM) CCCGCAGGTCTCCAT
NF1, c.1318CT Forward primer TGGCCTAAGATTGATGCTGTGTATT
Reverse primer CAACCTTGCACTGCTTTATGAAGT
Probe 1: wild type (VIC) CAAACATATTTCGAAGTTC
Probe 2: mutant (FAM) CAAACATATTTCAAAGTTC
Treff. NGS-based PGD. Fertil Steril 2013.
VOL. 99 NO. 5 / APRIL 2013 1379
4. ORIGINAL ARTICLE: GENETICS
format using SAMtools (11). The BAM files were loaded into
the Integrative Genomic Viewer (IGV) from Broad Institute
(12, 13) so that the sequence alignment could be observed.
Aligned reads with the reference sequence were displayed in
the IGV interface. Relative amounts of each allele were
obtained through evaluation of read counts for each
genotype. For single-nucleotide mutations, the count of the
nucleotide that corresponded to the reference sequence for
each position, based on the total number of reads at that par-ticular
position, was obtained from IGV. For insertions and
deletions the number of reads were obtained for the positions
of interest and averaged to set this number as a reference
count. A percentage was then obtained by dividing the
aligned read depth count of the nucleotides at the positions
of interest by the average read depth count of the reference
nucleotides at the corresponding positions and multiplying
by 100.
Ethics
The material used in this study was obtained with patient con-sent
and Institutional Review Board approval.
RESULTS
Lymphocytes
FD cases. Taqman allelic discrimination demonstrated the
expected carrier genotypes from both the patient and her
partner (Supplemental Fig. 2, available online at www.
fertstert.org). The four biologic replicates from the five-lymphocyte
samples were then blinded, amplified, and
processed to perform NGS-based genotyping of the
IVS20þ6TC loci. Results were obtained from all four repli-cates
for both patients (example shown in Supplemental
Fig. 3, available online at www.fertstert.org). The sequence
depth of coverage (aligned reads) within the region of interest
ranged from 1,177 in replicate 4 to 3,810 in replicate 1 for the
female patient and from 882 in replicate 1 to 1,877 in replicate
3 for the male patient. The counts were 48% of the reference
count for the T base at position 39,513 in the IKBKAP gene
(Refseq ID NG_008788.1) for the female patient and 50%
for her male partner (Supplemental Table 1, available online
at www.fertstert.org). Thus, from the counts of particular ba-ses
compared with the reference counts, NGS genotypes of the
samples demonstrated 100% consistency with Taqman allelic
discrimination and prior genetic testing results.
XHR case. Taqman genotyping demonstrated the expected
affected genotypes from the patient (Supplemental Fig. 2).
The four biologic replicates from the five-lymphocyte samples
were then blinded, amplified, and processed to perform NGS
based genotyping of the G649D loci. Results were obtained
from all four replicates (example shown in Supplemental
Fig. 3). The sequence depth of coverage within the region of
interest ranged from 6,552 in replicate 2 to 26,148 in replicate
4. The counts were 1% to the reference count for the G base
at position 193,686 (Refseq ID NG_007563.1) in the PHEX
gene (Supplemental Table 1). Thus, from the counts of partic-ular
bases compared with the reference counts, NGS geno-types
of the replicates demonstrated 100% consistency with
Taqman allelic discrimination and prior genetic testing
results.
NF1 case. Taqman genotyping demonstrated the expected
carrier genotypes from the patient (Supplemental Fig. 2).
The four biologic replicates from the five-lymphocyte samples
were then blinded, amplified, and processed to perform NGS
based genotyping of the c.1318CT loci. Results were ob-tained
from all four replicates (example shown in
Supplemental Fig. 3). The sequence depth of coverage within
TABLE 2
Summary of genetic data from blastocysts.
Case Embryo CCS Reference lab SGD Taqman SGD NGS SGD
DI507-DF508 1 46,XX No Result Normal Normal
2 46,XX Normal Normal Normal
3 47,XY,þ16 Not Tested DF508 Carrier DF508 Carrier
4 46,XX Normal Normal Normal
5 46,XX Affected Affected Affected
6 47,XX,þ8 Not Tested DI507 Carrier DI507 Carrier
7 47,XX,þ2 Not Tested Normal Normal
8 46,XY Normal Normal Normal
D1152H-W1282X 1 46,XY D1152H Carrier D1152H Carrier D1152H Carrier
2 46,XX Affected Affected Affected
3 46,XY D1152H Carrier D1152H Carrier D1152H Carrier
4 46,XY Normal Normal Normal
c.1167insA 1 46,XX No Result Carrier Carrier
2 46,XY Carrier Carrier Carrier
3 46,XX Carrier Carrier Carrier
4 46,XY Carrier Carrier Carrier
5 47,XY,þ9 Normal Normal Normal
6 46,XX Affected Affected Affected
7 46,XX Affected Affected Affected
8 46,XY Affected Affected Affected
9 46,XY Normal Normal Normal
Note: CCS ¼ comprehensive chromosome screening; NGS ¼ next-generation sequencing; SGD ¼ single-gene disorder.
Treff. NGS-based PGD. Fertil Steril 2013.
1380 VOL. 99 NO. 5 / APRIL 2013
5. the region of interest ranged from 4,182 in replicate 3 to 6,860
in replicate 1. The counts were 55% to the reference count
for the C base at position 111,371 (Refseq ID NG_009018.1)
in the NF1 gene (Supplemental Table 1). Thus, from the counts
of particular bases compared with the reference counts, NGS
genotypes of the replicates demonstrated 100% consistency
with Taqman allelic discrimination and prior genetic testing
results.
Embryos
CF case 1. CCS results were obtained for all eight embryos
and demonstrated that three were aneuploid (Supplemental
Fig. 4, available online at www.fertstert.org). Taqman
genotyping of CFTR DI507 and DF508 demonstrated the
expected carrier genotypes from the patient and her partner
(Supplemental Fig. 2). In addition, all eight embryos were di-agnosed
with Taqman genotyping, with five identified as nor-mal,
one as a DI507 carrier, one as a DF508 carrier, and one as
affected (Supplemental Fig. 2). The second of the two biopsies
(from only the five euploid embryos) was sent to a reference
laboratory for CFTR DI507 and DF508 PGD. Results were ob-tained
from four of the five embryos tested, because one failed
to amplify. The four embryos that were given a diagnosis were
genotyped consistently with the Taqman allelic discrimina-tion–
based predictions (Table 2).
Excess DNA from the CCS protocol was then blinded, am-plified,
and processed to perform NGS-based genotyping of
the CFTR DI507 and DF508 loci. Results were obtained from
all eight embryos (example shown in Fig. 1A). The sequence
depth of coverage (aligned reads) within the region of interest
ranged from 799 in sample 5 to 20,664 in sample 8. For sam-ples
predicted as wild type (samples 1, 2, 4, 7, and 8), the read
counts for all positions of interest (Supplemental Table 2,
available online at www.fertstert.org) were within 2% of
the reference read count. For the sample predicted as
a DF508 carrier (sample 3), the counts were 64% of the ref-erence
count for the CTT bases at positions 79,498–79,500
(Refseq ID NG_016465.1) in the CFTR gene. Similarly, for
the sample predicted as a DI507 carrier (sample 6), the counts
for the CAT bases at positions 79,495–79,497 were 57% of
the reference. The percentage of mutation alleles detected
for both carrier samples was slightly lower than the range
of 45%–61% seen in the heterozygous lymphocyte samples,
but this may reflect the difference in detecting a three-nucleotide
base-pair deletion and a single-point mutation.
In the sample predicted as a compound heterozygote (sample
5), nucleotides at position 79,495–79,500 showed on average
50% of read counts compared with the reference, with a dele-tion
detected between the six bases 100% of the time. Thus,
from the counts of particular bases compared with the refer-ence
counts, NGS genotypes of the samples demonstrated
100% consistency with both Taqman allelic discrimination
and the reference laboratory genotypes (Table 2).
CF case 2. CCS results were obtained for all four embryos and
demonstrated that they were all euploid (Supplemental Fig. 4).
All four embryos were diagnosed with Taqman allelic dis-crimination,
with one identified as normal, two as D1152H
carriers, and one as being a compound carrier for both the
Fertility and Sterility®
D1152H and the W1282X mutations (Supplemental Fig. 2).
The second of the two biopsies from each embryo was sent
to a reference laboratory for CFTR D1152H and W1282X
PGD. Results were obtained from all four of the embryos
tested, and the diagnoses were consistent with the Taqman al-lelic
discrimination based predictions (Table 2).
Excess DNA from the CCS protocol was then blinded, am-plified,
and processed to perform NGS-based genotyping of
the CFTR D1152H and W1282X loci. Results were obtained
from all four embryos (example shown in Fig. 1B). The se-quence
depth of coverage at the point of interest ranged
from 100 in sample 3 to 235 in sample 1 for the D1152H mu-tation
and from 109 in sample 4 to 193 in sample 1 for the
W1282X mutation. For the samples predicted as wild type
for one or both of the mutations, the read counts at the points
of interest (Supplemental Table 2) were 100% concordant to
the reference read count. For the samples predicted as
D1152H carriers (samples 1, 2, and 3), the counts were
62% of the reference count for G at position 134,737. Sim-ilarly,
for the sample predicted as a W1282X carrier (sample
2), the count for the G nucleotide at position 162,604 (Refseq
ID NG_016465.1) was 53% of the reference. The percentage
of mutation alleles detected for the carrier samples fell both
within and below the 45%–61% range seen in the heterozy-gous
lymphocyte samples. Thus, from the counts of particular
bases compared with the reference counts, NGS genotypes of
the samples demonstrated 100% consistency with both Taq-man
allelic discrimination and the reference laboratory diag-noses
(Table 2).
WWS case. CCS results were obtained for all nine embryos
and demonstrated that one was aneuploid (trisomy 9) and
eight were euploid (Supplemental Fig. 4). All nine embryos
were diagnosed with Taqman allelic discrimination, with
two identified as normal, four as carriers for the c.1167insA
mutation in the FKTN gene, and three as affected
(Supplemental Fig. 2). The second of the two biopsies was
sent to a reference laboratory for c.1167insA PGD. Results
were obtained from eight of the nine embryos tested, because
one failed to amplify. The eight embryos that were given a di-agnosis
were consistent with the Taqman-based predictions
(Table 2).
Excess DNA from the CCS protocol was then blinded, am-plified,
and processed to perform NGS-based genotyping of
the c.1167insA loci. Results were obtained from all nine em-bryos
(examples shown in Fig. 1C). The sequence depth of
coverage within the region of interest ranged from 255 in
sample 2 to 180,361 in sample 8. Samples 1 and 2 were run
on a separate chip from samples 3–9. For the samples pre-dicted
as wild type (samples 5 and 9), the read counts for all
positions of interest (Supplemental Table 2) were within
0.42% of the reference read count. The error rate for the in-sertion
of an A in these two samples was 5.25%. For the sam-ples
predicted as carriers (samples 1, 2, 3, and 4), the averaged
counts were 23%–36% of the reference count for the A inser-tion.
The count consisted of any A insertions throughout the
seven-nucleotide stretch of As at positions 61,920–61,927
(Refseq ID NG_008754.1) in the FKTN gene divided by the av-erage
depth of coverage for those seven nucleotides. The
VOL. 99 NO. 5 / APRIL 2013 1381
6. ORIGINAL ARTICLE: GENETICS
percentage of mutation alleles detected for the carrier samples
fell below the range of 45%–61% seen in the heterozygous
lymphocyte samples, but this may reflect the difference in
detecting an insertion in a homopolymer stretch. For the sam-ples
predicted as affected (samples 6, 7, and 8), the averaged
counts for the A insertion were 64% of the reference.
Thus, from the counts of particular bases compared with the
reference counts, NGS genotypes of the samples demon-strated
100% consistency with both Taqman allelic discrimi-nation
and the reference laboratory diagnoses (Table 2).
DISCUSSION
This study developed an NGS-based PGD methodology that
was perfectly consistent with two independent conventional
methodologies of PGD and with 100% reliability. The com-parison
with two independent methods may represent a useful
strategy in further establishing the general applicability of
NGS to a variety of other SGDs and is an area of active inves-tigation.
In the present study, it was also possible to obtain
24-chromosome aneuploidy screening results from qPCR (8)
from the same biopsy in which NGS-based PGD of the SGD
was obtained. Given the high-throughput nature of NGS tech-nology,
it is possible to investigate the ability of NGS to pre-dict
chromosome copy number for the direct diagnosis of
aneuploidy and assess its consistency with an established
methodology.
Interestingly, the ability to evaluate eight embryo biop-sies
on the same chip through DNA barcoding (2) provided
an opportunity to model the possible NGS throughput capac-ity
of a single instrument and chip. Because the lowest depth
of coverage of eight evaluated samples was 100 on a 316
Chip with seven other samples, and because many genotyping
applications of NGS require far less depth (14), it is theoreti-cally
possible to evaluate 100 embryo samples on a single
318 Chip. In addition, higher-capacity NGS platforms could
further increase throughput. Together, these capabilities
may provide a unique opportunity to significantly reduce
the costs associated with PGD for nearly every indication.
Furthermore, this procedure can be completed in less than
FIGURE 1
Next-generation sequencing Integrative Genomics Viewer plots of data obtained from three preimplantation genetic diagnosis cases, representing
a variety of genotypes found among the tested embryos. Each plot includes a vertical bar graph (columns on top) indicating the depth at each base.
Letter codes for each position are indicated at the bottom and represent a normal human genome reference sequence. Each plot also contains
multiple horizontal bars each representing an individual sequence read, with a purple symbol indicating an insertion, a black dashed line
indicating a deletion, and a letter indicating a variant relative to the reference sequence. (A) CFTR DI507-DF508 case; (B) CFTR D1152H-W1282X
case; and (C) FKTN c.1167insA case. CF ¼ cystic fibrosis; WWS ¼ Walker-Warburg syndrome.
Treff. NGS-based PGD. Fertil Steril 2013.
1382 VOL. 99 NO. 5 / APRIL 2013
7. 24 hours, with a preamplification step of 2 hours, a library
preparation of 8 hours, a template preparation of 6 hours,
and sequencing for 3 hours. However, the protocol estab-lished
here has not been applied to single cells and therefore
may only be applicable to blastocyst biopsy, where a much
more rapid method may be necessary to avoid cryopreserva-tion
and frozen embryo transfer. Still, the observed success of
combining blastocyst biopsy, PGD, and vitrification (15) may
provide a realistic opportunity for NGS to soon find a place in
routine clinical application. Moreover, a recent cost analysis
of a variety of benchtop sequencing instruments estimated
that a 318 Chip would cost US$625 to run (16). Given that
eight samples could be run on one 316 Chip in the present
study and that the 318 Chip gives 10 times the sequence,
as many as 80 embryos could be run for $625, making the ex-isting
costs of NGS comparable with current methodologies.
The importance of screening for both aneuploidy and
SGDs was also demonstrated in this study. Patients do not
always choose to test for both when doing PGD, but it is
recommended because a normal genotyping result does not
necessarily guarantee that the embryo is also euploid. For
instance, embryo 5 in theWWScase was trisomic for chromo-some
9 but genotyped as normal for the c.1167insA mutation
in the FKTN gene, which is located on chromosome 9q31-q33.
There are numerous ways in which an embryo could be gen-otyped
as normal for a mutation that occurs on the same
chromosome responsible for causing aneuploidy. Examples
include an error in meiosis II where nondisjunction occurred
for the sister chromatids, and an error in meiosis I where there
was nondisjunction after a crossover event between the ho-mologs.
Regardless of the cause, if the embryo had been tested
only for the SGD, the normal genotyping result would have
indicated that it was a suitable for transfer when in fact it
was not, thus illustrating the importance of screening for
both aneuploidy and SGDs in parallel.
The fact that the Ion Torrent PGM could accurately detect
the three different genotypes in the samples tested for WWS
also shows that it is capable of detecting mutations in homo-polymer
stretches. Although it has been reported that
stretches of the same nucleotide (i.e., homopolymers) can
cause sequencing problems for the PGM (16, 17), we were
able to avoid this by examining the entire homopolymer
stretch for the insertion mutation. The genotypes of the
samples were visually very evident because the affected
samples had an adenine insertion between one of the seven
adenines in the reference sequence at almost every read,
whereas the insertions in the heterozygous samples were far
less frequent but still distinguishable from normal samples.
Although insertion of one adenine was most common,
3.34% of the time there was an insertion of two or more
adenines in the heterozygous or homozygous affected
samples. Additionally, 2.23% of the time an insertion other
than an A was observed at the mutation site, indicating that
some sequencing errors were made. These errors were
minor, however, and did not affect the overall diagnostic
accuracy. This point is also applicable to the additional PGD
cases evaluated, because sequencing errors could be
observed in each case (Fig. 1). Because of the sequencing
depth across the region of interest with the use of NGS, and
Fertility and Sterility®
because the consensus of all reads is used to determine the
final genotype, these sequencing errors did not affect the
diagnostic accuracy of NGS-based PGD in any of the cases.
Furthermore, the valid concern over incidental findings
from comprehensive genetic analysis of human embryos
(18) may be reduced by the targeted approach used here, be-cause
additional information from nontargeted regions of
the genome is avoided.
Although this study has shown that NGS of blastocyst
biopsies is a reliable method for genotyping PGD cases
when obtaining a very large depth of coverage, further studies
defining thresholds for homozygous and heterozygous geno-typing
calls, the limits of sequence depth necessary to main-tain
accuracy, and the causes of variation in sequencing depth
across different genomic loci remain critical to further evalu-ate
this methodology before its clinical application. Further-more,
each methodology involving other NGS technologies
(i.e., different platforms, or different sequencing depths)
should also involve similar experimental evaluation before
routine clinical use.
Acknowledgments: The authors thank Chaim Jalas from
Bonei Olam for providing materials used in this study.
REFERENCES
1. Handyside AH, Kontogianni EH, Hardy K, Winston RM. Pregnancies from
biopsied human preimplantation embryos sexed by Y-specific DNA amplifi-cation.
Nature 1990;344:768–70.
2. Knapp M, Stiller M, Meyer M. Generating barcoded libraries for multiplex
high-throughput sequencing. Methods Mol Biol 2012;840:155–70.
3. Mestan KK, Ilkhanoff L,Mouli S, Lin S. Genomic sequencing in clinical trials. J
Transl Med 2011;9:222.
4. Corrales I, Catarino S, Ayats J, Arteta D, Altisent C, Parra R, et al.
High-throughput molecular diagnosis of von Willebrand disease by next
generation sequencing methods. Haematologica 2012;97:1003–7.
5. Wei X, Ju X, Yi X, Zhu Q, Qu N, Liu T, et al. Identification of sequence variants
in genetic disease-causing genes using targeted next-generation sequenc-ing.
PloS One 2011;6:e29500.
6. Glenn TC. Field guide to next-generation DNA sequencers. Mol Ecol Resour
2011;11:759–69.
7. Rothberg JM, Hinz W, Rearick TM, Schultz J, Mileski W, Davey M, et al. An
integrated semiconductor device enabling nonoptical genome sequencing.
Nature 2011;475:348–52.
8. Treff NR, Tao X, Ferry KM, Su J, Taylor D, Scott RT Jr. Development and val-idation
of an accurate quantitative real-time polymerase chain reaction-based
assay for human blastocyst comprehensive chromosomal aneuploidy
screening. Fertil Steril 2012;97:819–24.e2.
9. Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger Fastq file format
for sequences with quality scores, and the Solexa/Illumina Fastq variants.
Nucleic Acids Res 2010;38:1767–71.
10. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat
Methods 2012;9:357–9.
11. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The
Sequence Alignment/Map format and SAMtools. Bioinformatics 2009;25:
2078–9.
12. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G,
et al. Integrative genomics viewer. Nat Biotechnol 2011;29:24–6.
13. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer
(IGV): high-performance genomics data visualization and exploration. Brief
Bioinform 2012 Apr 19. [Epub ahead of print.]
14. Davey JW, Hohenlohe PA, Etter PD, Boone JQ, Catchen JM, Blaxter ML.
Genome-wide genetic marker discovery and genotyping using next-generation
sequencing. Nat Rev 2011;12:499–510.
VOL. 99 NO. 5 / APRIL 2013 1383
8. ORIGINAL ARTICLE: GENETICS
15. Schoolcraft WB, Treff NR, Stevens JM, Ferry K, Katz-Jaffe M, Scott RT Jr. Live
birth outcome with trophectoderm biopsy, blastocyst vitrification, and
single-nucleotide polymorphism microarray-based comprehensive chromo-some
screening in infertile patients. Fertil Steril 2011;96:638–40.
16. Loman NJ, Misra RV, Dallman TJ, Constantinidou C, Gharbia SE, Wain J,
et al. Performance comparison of benchtop high-throughput sequencing
platforms. Nat Biotechnol 2012;30:434–9.
17. Elliott AM, Radecki J, Moghis B, Li X, Kammesheidt A. Rapid detection of
the ACMG/ACOG-recommended 23 CFTR disease-causing mutations
using ion torrent semiconductor sequencing. J Biomol Tech 2012;23:
24–30.
18. Hens K, Dondorp W, Geraedts J, de Wert G. Comprehensive pre-implantation
genetic screening: ethical reflection urgently needed. Nat
Rev 2012;13:676–7.
1384 VOL. 99 NO. 5 / APRIL 2013
9. SUPPLEMENTAL FIGURE 1
Fertility and Sterility®
Flow chart of sample DNA processing for (A) lymphocytes and (B) embryo trophectoderm biopsies. CCS ¼ comprehensive chromosome screening;
NGS ¼ next-generation sequencing; PCR ¼ polymerase chain reaction; qPCR ¼ quantitative polymerase chain reaction; SGD ¼ single-gene
disorder.
Treff. NGS-based PGD. Fertil Steril 2013.
VOL. 99 NO. 5 / APRIL 2013 1384.e1
10. ORIGINAL ARTICLE: GENETICS
SUPPLEMENTAL FIGURE 2
Taqman allelic discrimination results from (A) purified DNA and five-lymphocyte samples from carriers of the IVS20þ6TC mutation in the IKBKAP
gene, a G649D mutation in the PHEX gene, and a carrier of the c.1318CT in the NF1 gene; and from parental DNA and trophectoderm biopsies
from (B) CFTR DI507 and DF508 mutations (cystic fibrosis [CF] case 1), (C) CFTR D1152H W1282X mutations (CF case 2), and (D) FKTN c.1167insA
mutation (Walker-Warburg syndrome [WWS] case).
Treff. NGS-based PGD. Fertil Steril 2013.
1384.e2 VOL. 99 NO. 5 / APRIL 2013
11. SUPPLEMENTAL FIGURE 3
Fertility and Sterility®
Examples of next-generation sequencing Integrative Genomics Viewer plots of data obtained on five-lymphocyte samples from two carriers of the
IVS20þ6TC mutation in the IKBKAP gene, a G649D mutation in the PHEX gene, and a carrier of the c.1318CT in the NF1 gene. Each plot
includes a vertical bar graph (columns on top) indicating the depth at each base. Letter codes for each position are indicated at the bottom and
represent a normal human genome reference sequence. Each plot also contains multiple horizontal bars each representing an individual
sequence read, with a purple symbol indicating an insertion, a black dashed line indicating a deletion, and a letter indicating a variant relative
to the reference sequence.
Treff. NGS-based PGD. Fertil Steril 2013.
VOL. 99 NO. 5 / APRIL 2013 1384.e3
12. ORIGINAL ARTICLE: GENETICS
SUPPLEMENTAL FIGURE 4
qPCR-based trophectoderm biopsy CCS (24-chromosome copy number) plots from carriers of the (A) CFTR DI507 and DF508 mutations (CF case 1),
(B) CFTR D1152H W1282X mutations (CF case 2), and (C) FKTN c.1167insA mutation(WWS case). Abbreviations as in Supplemental Figures 1 and 2.
Treff. NGS-based PGD. Fertil Steril 2013.
1384.e4 VOL. 99 NO. 5 / APRIL 2013