SlideShare une entreprise Scribd logo
1  sur  13
Télécharger pour lire hors ligne
The Trans‐NIH RNAi Ini0a0ve 
        Informa(cs 
         Rajarshi Guha 
Mission 
To establish a state of the art RNAi screening facility to perform
genome-wide RNAi screens with investigators in the intramural
NIH community.



•    Gene func0on 
•    Pathway analysis 
•    Target ID 
•    Compound MoA 
•    Drug antagonist/
     agonist 
RNAi Informa0cs Infrastructure 
RNAi Analysis Workflow 
                                  Raw and              GO 
                                 Processed             annota0ons 
                                                       Pathways 
                                    Data               Interac0ons 




• Summary 
                     Normaliza0on 
                                          • Thresholding 
                                                                           Hit Triage 
  sta0s0cs       • Median                 • Hypothesis                • GO seman0c 
• Correc0ons     • Quar0le                  tes0ng                      similarity 
                 • Background             • Sum of ranks              • Pathways 
                                                                      • Interac0ons 
           QC                                  Hit Selec0on 




                                        Follow‐up                                 Hit List 
RNAi Informa0cs Toolset 

• Local databases (screen data, pathways, 
  interac0ons, etc). 
• Commercial pathway tools.  
• Custom soUware for loading, analysis and 
  visualiza0on. 
Back End Services
                                

•  Currently all computa0onal analysis performed 
   on the backend 
•  R & Bioconductor code 
•  Custom R package (ncgcrnai) to support NCGC 
   infrastructure 
   –  Partly derived from cellHTS2 
   –  Supports QC metrics, normaliza0on, adjustments, 
      selec0ons, triage, (sta0c) visualiza0on, reports 
•  Some Java tools for 
   –  Data loading 
   –  Library and plate registra0on 
User Accessible Tools 
User Accessible Tools 
Challenge – siRNA Design & 
                             Valida5on 
•  We mostly depend on quality controls 
   implemented by vendor 
  –  siRNA design algorithms not a high priority 
•  Always interested in extra filters that help us 
   get a reliable hit list 
•  Would like to have measures of  
  –  Off‐target effects 
  –  Protein half lives 
Challenge ‐ miRNA Target ID 

•  Screened a set of 885 human miRNA’s 
   for CPT sensi0za0on 
•  Iden0fied 23 sensi0zing miRNA’s 
•  But, we don’t have target informa0on 
   –  Predic0ons aren’t par0cularly helpful 
   –  Poor overlap with siRNA hits  
                                         miRAnda    TargetScan 
•  Link pathogenic 
   miRNA’s to human  
   targets 
Challenge ‐ RNAi & Small 
                                             Molecule Screens 
                                                       What targets mediate activity
                                                       of siRNA and compound


                                                       Given a set of siRNA hits and
                                                       their targets, is there a
 •  Reuse pre-existing MLI data                        compound showing similar
 •  Develop new annotated libraries                    inhibition

       CAGCATGAGTACTACAGGCCA 
       TACGGGAACTACCATAATTTA                           Target ID and validation


                                                       Link RNAi generated pathway
                                                       peturbations to small molecule
                                                       activities. Could provide insight
                                                       into polypharmacology



•  Run parallel RNAi screen




          Goal: Develop systems level view of small molecule activity
Challenge – RNAi Meta Analyses
                                    
•  Building up a collec0on of screens 
  –  Across cell lines, species, … 
  –  Not necessarily “designed” 
•  What do we do with this? 
  –  Iden0fy consistent markers  
  –  Characterize differences between 
     cell lines  
  –  Extrapolate from gene knockdown to pathway 
     and higher level differences 
  –  Merge with gene expression data 
The People 
•  Scoh Mar0n 
                       RNAi
•  Pinar Tuzmen 


•  Dac Trung Nguyen 
                          Small Molecules
•  Yuhong Wang 

Contenu connexe

Tendances

CRISPR presentation extended Mouse Modeling
CRISPR presentation extended Mouse ModelingCRISPR presentation extended Mouse Modeling
CRISPR presentation extended Mouse Modeling
Tristan Kempston
 
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Candy Smellie
 
CRISPR-Cas9 Review: A potential tool for genome editing
CRISPR-Cas9 Review: A potential tool for genome editingCRISPR-Cas9 Review: A potential tool for genome editing
CRISPR-Cas9 Review: A potential tool for genome editing
Davient Bala
 

Tendances (20)

CRISPR Screening: the What, Why and How
CRISPR Screening: the What, Why and HowCRISPR Screening: the What, Why and How
CRISPR Screening: the What, Why and How
 
CRISPR presentation extended Mouse Modeling
CRISPR presentation extended Mouse ModelingCRISPR presentation extended Mouse Modeling
CRISPR presentation extended Mouse Modeling
 
GENASSIST™ CRISPR & rAAV Genome Editing Tools
GENASSIST™ CRISPR & rAAV Genome Editing ToolsGENASSIST™ CRISPR & rAAV Genome Editing Tools
GENASSIST™ CRISPR & rAAV Genome Editing Tools
 
CRISPR - gene-editing for everyone
CRISPR - gene-editing for everyoneCRISPR - gene-editing for everyone
CRISPR - gene-editing for everyone
 
The relative ease of use and reproducibility of
The relative ease of use and reproducibility ofThe relative ease of use and reproducibility of
The relative ease of use and reproducibility of
 
CRISPR/Cas9 Platform
CRISPR/Cas9 PlatformCRISPR/Cas9 Platform
CRISPR/Cas9 Platform
 
Crispr/Cas 9
Crispr/Cas 9Crispr/Cas 9
Crispr/Cas 9
 
CRISPR: what it is, and why it is having a profound impact on human health
CRISPR: what it is, and why it is having a profound impact on human healthCRISPR: what it is, and why it is having a profound impact on human health
CRISPR: what it is, and why it is having a profound impact on human health
 
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breeding
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breedingRecent advances in CRISPR-CAS9 technology: an alternative to transgenic breeding
Recent advances in CRISPR-CAS9 technology: an alternative to transgenic breeding
 
Rewriting the Genome Using CRISPR and Synthetic Biology
Rewriting the Genome Using CRISPR and Synthetic Biology Rewriting the Genome Using CRISPR and Synthetic Biology
Rewriting the Genome Using CRISPR and Synthetic Biology
 
CRISPR-Cas systems and applications
CRISPR-Cas systems and applicationsCRISPR-Cas systems and applications
CRISPR-Cas systems and applications
 
Genome editing comes of age
Genome editing comes of ageGenome editing comes of age
Genome editing comes of age
 
CRISPR-Revolutionary Genome editing tools for Plants.....
CRISPR-Revolutionary Genome editing tools for Plants.....CRISPR-Revolutionary Genome editing tools for Plants.....
CRISPR-Revolutionary Genome editing tools for Plants.....
 
Crisper Cas system
Crisper Cas systemCrisper Cas system
Crisper Cas system
 
NCER Position on Crispr-Cas9
NCER Position on Crispr-Cas9NCER Position on Crispr-Cas9
NCER Position on Crispr-Cas9
 
CRISPR Cas System concept
CRISPR Cas System conceptCRISPR Cas System concept
CRISPR Cas System concept
 
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
 
CRISPR-Cas9 Review: A potential tool for genome editing
CRISPR-Cas9 Review: A potential tool for genome editingCRISPR-Cas9 Review: A potential tool for genome editing
CRISPR-Cas9 Review: A potential tool for genome editing
 
Translating Genomes | Personalizing Medicine
Translating Genomes | Personalizing MedicineTranslating Genomes | Personalizing Medicine
Translating Genomes | Personalizing Medicine
 
Crispr cas
Crispr casCrispr cas
Crispr cas
 

En vedette (6)

R & CDK: A Sturdy Platform in the Oceans of Chemical Data}
R & CDK: A Sturdy Platform in the Oceans of Chemical Data}R & CDK: A Sturdy Platform in the Oceans of Chemical Data}
R & CDK: A Sturdy Platform in the Oceans of Chemical Data}
 
Characterization and visualization of compound combination responses in a hig...
Characterization and visualization of compound combination responses in a hig...Characterization and visualization of compound combination responses in a hig...
Characterization and visualization of compound combination responses in a hig...
 
The BioAssay Research Database
The BioAssay Research DatabaseThe BioAssay Research Database
The BioAssay Research Database
 
Robots, Small Molecules & R
Robots, Small Molecules & RRobots, Small Molecules & R
Robots, Small Molecules & R
 
The smaller sukhavati vyuha
The smaller sukhavati vyuhaThe smaller sukhavati vyuha
The smaller sukhavati vyuha
 
Crunching Molecules and Numbers in R
Crunching Molecules and Numbers in RCrunching Molecules and Numbers in R
Crunching Molecules and Numbers in R
 

Similaire à The Trans-NIH RNAi Initiative : Informatics

NetBioSIG2012 anyatsalenko-en-viz
NetBioSIG2012 anyatsalenko-en-vizNetBioSIG2012 anyatsalenko-en-viz
NetBioSIG2012 anyatsalenko-en-viz
Alexander Pico
 
Preclinical Scale Bioprocessing, Nov. 2, 2009
Preclinical Scale Bioprocessing, Nov. 2, 2009Preclinical Scale Bioprocessing, Nov. 2, 2009
Preclinical Scale Bioprocessing, Nov. 2, 2009
David Bienvenue
 
Dmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– PresentationDmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– Presentation
Wolfgang G. Hoeck
 

Similaire à The Trans-NIH RNAi Initiative : Informatics (20)

Biological networks
Biological networksBiological networks
Biological networks
 
NetBioSIG2012 anyatsalenko-en-viz
NetBioSIG2012 anyatsalenko-en-vizNetBioSIG2012 anyatsalenko-en-viz
NetBioSIG2012 anyatsalenko-en-viz
 
Friend DREAM 2012-11-14
Friend DREAM 2012-11-14Friend DREAM 2012-11-14
Friend DREAM 2012-11-14
 
Final Acb All Hands 26 11 07.Key
Final Acb All Hands 26 11 07.KeyFinal Acb All Hands 26 11 07.Key
Final Acb All Hands 26 11 07.Key
 
Protein-protein interaction networks
Protein-protein interaction networksProtein-protein interaction networks
Protein-protein interaction networks
 
Open Source Networking Solving Molecular Analysis of Cancer
Open Source Networking Solving Molecular Analysis of CancerOpen Source Networking Solving Molecular Analysis of Cancer
Open Source Networking Solving Molecular Analysis of Cancer
 
Functional genomics
Functional genomicsFunctional genomics
Functional genomics
 
Stephen Friend CRUK-MD Anderson Cancer Workshop 2012-02-28
Stephen Friend CRUK-MD Anderson Cancer Workshop 2012-02-28Stephen Friend CRUK-MD Anderson Cancer Workshop 2012-02-28
Stephen Friend CRUK-MD Anderson Cancer Workshop 2012-02-28
 
HTS data analysis
HTS data analysisHTS data analysis
HTS data analysis
 
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
 
Qi liu 08.08.2014
Qi liu 08.08.2014Qi liu 08.08.2014
Qi liu 08.08.2014
 
Pathway analysis 2012
Pathway analysis 2012Pathway analysis 2012
Pathway analysis 2012
 
Si rna 2013
Si rna 2013Si rna 2013
Si rna 2013
 
Preclinical Scale Bioprocessing, Nov. 2, 2009
Preclinical Scale Bioprocessing, Nov. 2, 2009Preclinical Scale Bioprocessing, Nov. 2, 2009
Preclinical Scale Bioprocessing, Nov. 2, 2009
 
Microarray @ujjwal sirohi
Microarray @ujjwal sirohiMicroarray @ujjwal sirohi
Microarray @ujjwal sirohi
 
Efficient and accurate analysis of non-coding RNAs with InSyBio ncRNASeq
Efficient and accurate analysis of non-coding RNAs with InSyBio ncRNASeqEfficient and accurate analysis of non-coding RNAs with InSyBio ncRNASeq
Efficient and accurate analysis of non-coding RNAs with InSyBio ncRNASeq
 
MATLAB Bioinformatics tool box
MATLAB Bioinformatics tool boxMATLAB Bioinformatics tool box
MATLAB Bioinformatics tool box
 
Analyzing Fusion Genes Using Next-Generation Sequencing
Analyzing Fusion Genes Using Next-Generation SequencingAnalyzing Fusion Genes Using Next-Generation Sequencing
Analyzing Fusion Genes Using Next-Generation Sequencing
 
Dmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– PresentationDmla0910 – Hoeck– Presentation
Dmla0910 – Hoeck– Presentation
 
Slas2012 Whoeck
Slas2012 WhoeckSlas2012 Whoeck
Slas2012 Whoeck
 

Plus de Rajarshi Guha

Pharos: A Torch to Use in Your Journey in the Dark Genome
Pharos: A Torch to Use in Your Journey in the Dark GenomePharos: A Torch to Use in Your Journey in the Dark Genome
Pharos: A Torch to Use in Your Journey in the Dark Genome
Rajarshi Guha
 
Pharos: Putting targets in context
Pharos: Putting targets in contextPharos: Putting targets in context
Pharos: Putting targets in context
Rajarshi Guha
 
Pharos – A Torch to Use in Your Journey In the Dark Genome
Pharos – A Torch to Use in Your Journey In the Dark GenomePharos – A Torch to Use in Your Journey In the Dark Genome
Pharos – A Torch to Use in Your Journey In the Dark Genome
Rajarshi Guha
 
Pharos - Face of the KMC
Pharos - Face of the KMCPharos - Face of the KMC
Pharos - Face of the KMC
Rajarshi Guha
 
Enhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
Enhancing Prioritization & Discovery of Novel Combinations using an HTS PlatformEnhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
Enhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
Rajarshi Guha
 
What can your library do for you?
What can your library do for you?What can your library do for you?
What can your library do for you?
Rajarshi Guha
 
So I have an SD File … What do I do next?
So I have an SD File … What do I do next?So I have an SD File … What do I do next?
So I have an SD File … What do I do next?
Rajarshi Guha
 
Characterization of Chemical Libraries Using Scaffolds and Network Models
Characterization of Chemical Libraries Using Scaffolds and Network ModelsCharacterization of Chemical Libraries Using Scaffolds and Network Models
Characterization of Chemical Libraries Using Scaffolds and Network Models
Rajarshi Guha
 
From Data to Action : Bridging Chemistry and Biology with Informatics at NCATS
From Data to Action: Bridging Chemistry and Biology with Informatics at NCATSFrom Data to Action: Bridging Chemistry and Biology with Informatics at NCATS
From Data to Action : Bridging Chemistry and Biology with Informatics at NCATS
Rajarshi Guha
 
Fingerprinting Chemical Structures
Fingerprinting Chemical StructuresFingerprinting Chemical Structures
Fingerprinting Chemical Structures
Rajarshi Guha
 
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
Rajarshi Guha
 
When the whole is better than the parts
When the whole is better than the partsWhen the whole is better than the parts
When the whole is better than the parts
Rajarshi Guha
 
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
Rajarshi Guha
 
Pushing Chemical Biology Through the Pipes
Pushing Chemical Biology Through the PipesPushing Chemical Biology Through the Pipes
Pushing Chemical Biology Through the Pipes
Rajarshi Guha
 
Cloudy with a Touch of Cheminformatics
Cloudy with a Touch of CheminformaticsCloudy with a Touch of Cheminformatics
Cloudy with a Touch of Cheminformatics
Rajarshi Guha
 
Chemical Data Mining: Open Source & Reproducible
Chemical Data Mining: Open Source & ReproducibleChemical Data Mining: Open Source & Reproducible
Chemical Data Mining: Open Source & Reproducible
Rajarshi Guha
 
Chemogenomics in the cloud: Is the sky the limit?
Chemogenomics in the cloud: Is the sky the limit?Chemogenomics in the cloud: Is the sky the limit?
Chemogenomics in the cloud: Is the sky the limit?
Rajarshi Guha
 
Quantifying Text Sentiment in R
Quantifying Text Sentiment in RQuantifying Text Sentiment in R
Quantifying Text Sentiment in R
Rajarshi Guha
 
PMML for QSAR Model Exchange
PMML for QSAR Model Exchange PMML for QSAR Model Exchange
PMML for QSAR Model Exchange
Rajarshi Guha
 

Plus de Rajarshi Guha (20)

Pharos: A Torch to Use in Your Journey in the Dark Genome
Pharos: A Torch to Use in Your Journey in the Dark GenomePharos: A Torch to Use in Your Journey in the Dark Genome
Pharos: A Torch to Use in Your Journey in the Dark Genome
 
Pharos: Putting targets in context
Pharos: Putting targets in contextPharos: Putting targets in context
Pharos: Putting targets in context
 
Pharos – A Torch to Use in Your Journey In the Dark Genome
Pharos – A Torch to Use in Your Journey In the Dark GenomePharos – A Torch to Use in Your Journey In the Dark Genome
Pharos – A Torch to Use in Your Journey In the Dark Genome
 
Pharos - Face of the KMC
Pharos - Face of the KMCPharos - Face of the KMC
Pharos - Face of the KMC
 
Enhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
Enhancing Prioritization & Discovery of Novel Combinations using an HTS PlatformEnhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
Enhancing Prioritization & Discovery of Novel Combinations using an HTS Platform
 
What can your library do for you?
What can your library do for you?What can your library do for you?
What can your library do for you?
 
So I have an SD File … What do I do next?
So I have an SD File … What do I do next?So I have an SD File … What do I do next?
So I have an SD File … What do I do next?
 
Characterization of Chemical Libraries Using Scaffolds and Network Models
Characterization of Chemical Libraries Using Scaffolds and Network ModelsCharacterization of Chemical Libraries Using Scaffolds and Network Models
Characterization of Chemical Libraries Using Scaffolds and Network Models
 
From Data to Action : Bridging Chemistry and Biology with Informatics at NCATS
From Data to Action: Bridging Chemistry and Biology with Informatics at NCATSFrom Data to Action: Bridging Chemistry and Biology with Informatics at NCATS
From Data to Action : Bridging Chemistry and Biology with Informatics at NCATS
 
Fingerprinting Chemical Structures
Fingerprinting Chemical StructuresFingerprinting Chemical Structures
Fingerprinting Chemical Structures
 
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D...
 
When the whole is better than the parts
When the whole is better than the partsWhen the whole is better than the parts
When the whole is better than the parts
 
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
Exploring Compound Combinations in High Throughput Settings: Going Beyond 1D ...
 
Pushing Chemical Biology Through the Pipes
Pushing Chemical Biology Through the PipesPushing Chemical Biology Through the Pipes
Pushing Chemical Biology Through the Pipes
 
Cloudy with a Touch of Cheminformatics
Cloudy with a Touch of CheminformaticsCloudy with a Touch of Cheminformatics
Cloudy with a Touch of Cheminformatics
 
Chemical Data Mining: Open Source & Reproducible
Chemical Data Mining: Open Source & ReproducibleChemical Data Mining: Open Source & Reproducible
Chemical Data Mining: Open Source & Reproducible
 
Chemogenomics in the cloud: Is the sky the limit?
Chemogenomics in the cloud: Is the sky the limit?Chemogenomics in the cloud: Is the sky the limit?
Chemogenomics in the cloud: Is the sky the limit?
 
Quantifying Text Sentiment in R
Quantifying Text Sentiment in RQuantifying Text Sentiment in R
Quantifying Text Sentiment in R
 
PMML for QSAR Model Exchange
PMML for QSAR Model Exchange PMML for QSAR Model Exchange
PMML for QSAR Model Exchange
 
Smashing Molecules
Smashing MoleculesSmashing Molecules
Smashing Molecules
 

Dernier

Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
Joaquim Jorge
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
vu2urc
 

Dernier (20)

The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Evaluating the top large language models.pdf
Evaluating the top large language models.pdfEvaluating the top large language models.pdf
Evaluating the top large language models.pdf
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdf
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 

The Trans-NIH RNAi Initiative : Informatics

  • 1. The Trans‐NIH RNAi Ini0a0ve  Informa(cs  Rajarshi Guha 
  • 2. Mission  To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community. •  Gene func0on  •  Pathway analysis  •  Target ID  •  Compound MoA  •  Drug antagonist/ agonist 
  • 4. RNAi Analysis Workflow  Raw and  GO  Processed  annota0ons  Pathways  Data  Interac0ons  • Summary  Normaliza0on  • Thresholding  Hit Triage  sta0s0cs  • Median  • Hypothesis  • GO seman0c  • Correc0ons  • Quar0le  tes0ng  similarity  • Background  • Sum of ranks  • Pathways  • Interac0ons  QC  Hit Selec0on  Follow‐up  Hit List 
  • 6. Back End Services   •  Currently all computa0onal analysis performed  on the backend  •  R & Bioconductor code  •  Custom R package (ncgcrnai) to support NCGC  infrastructure  –  Partly derived from cellHTS2  –  Supports QC metrics, normaliza0on, adjustments,  selec0ons, triage, (sta0c) visualiza0on, reports  •  Some Java tools for  –  Data loading  –  Library and plate registra0on 
  • 9. Challenge – siRNA Design &  Valida5on  •  We mostly depend on quality controls  implemented by vendor  –  siRNA design algorithms not a high priority  •  Always interested in extra filters that help us  get a reliable hit list  •  Would like to have measures of   –  Off‐target effects  –  Protein half lives 
  • 10. Challenge ‐ miRNA Target ID  •  Screened a set of 885 human miRNA’s  for CPT sensi0za0on  •  Iden0fied 23 sensi0zing miRNA’s  •  But, we don’t have target informa0on  –  Predic0ons aren’t par0cularly helpful  –  Poor overlap with siRNA hits   miRAnda  TargetScan  •  Link pathogenic  miRNA’s to human   targets 
  • 11. Challenge ‐ RNAi & Small  Molecule Screens  What targets mediate activity of siRNA and compound Given a set of siRNA hits and their targets, is there a •  Reuse pre-existing MLI data compound showing similar •  Develop new annotated libraries inhibition CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and validation Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology •  Run parallel RNAi screen Goal: Develop systems level view of small molecule activity
  • 12. Challenge – RNAi Meta Analyses   •  Building up a collec0on of screens  –  Across cell lines, species, …  –  Not necessarily “designed”  •  What do we do with this?  –  Iden0fy consistent markers   –  Characterize differences between  cell lines   –  Extrapolate from gene knockdown to pathway  and higher level differences  –  Merge with gene expression data 
  • 13. The People  •  Scoh Mar0n  RNAi •  Pinar Tuzmen  •  Dac Trung Nguyen  Small Molecules •  Yuhong Wang