Using liquid biopsies to study cancer dynamics and drug resistance
•
2 j'aime•605 vues
Liquid biopsies, which analyze cell-free DNA in blood, can be used to study cancer evolution and drug resistance over time. By tracking genetic mutations in plasma samples taken at different time points, researchers can create a temporal map of how a tumor changes with and without treatment. This approach has identified biomarkers of drug resistance and shown that tumors with higher levels of circulating tumor DNA have worse outcomes and are less responsive to some therapies. While liquid biopsies hold promise for early cancer detection and precision medicine, more large clinical studies are still needed to validate their clinical utility.
Recommandé
Recommandé
Contenu connexe
Tendances
Tendances (20)
Similaire à Using liquid biopsies to study cancer dynamics and drug resistance
Similaire à Using liquid biopsies to study cancer dynamics and drug resistance (20)
Plus de Speck&Tech
Plus de Speck&Tech (20)
Dernier
Dernier (20)
Using liquid biopsies to study cancer dynamics and drug resistance
- 1. Using liquid biopsies to study cancer dynamics and drug resistance Alessandro Romanel, PhD Laboratory of Bioinformatics and Computational Genomics Centre for Integrative Biology (CIBIO), University of Trento Speck&Tech, 27 February 2018
- 2. What is the human genome? Complete set of nucleic acid sequences for humans Encoded as DNA
- 3. What is DNA?
- 5. DNA in numbers 3.2 billion base pairs <2% protein coding DNA Remaining is non-coding RNA, regulatory sequences, introns, …
- 6. What is NGS?
- 7. What is NGS? Reference genome
- 8. What is a DNA variation? Less than 1% of the human genome Single Nucleotide Variations (SNVs) Copy Number Variations (CNVs) Germline variations Polymorphism when fraction >1% Mutation when <1% Somatic variations Bob: ACGTGGCATACCAATACCTGGTGTAAGTTTA Alice: ACGTGGCATACCGATACCTGGTGTAAGTTTA Bob: Alice:
- 9. What is cancer? Disease where abnormal cells divide without control Most cancers start due to somatic variations Gene functions are altered (e.g. oncogenes) Primary carcinoma lymphoma leukemia sarcoma Metastatis spread
- 10. Cancer is heterogeneus Patient 1 Patient 2 Patient 3 Primary Metastasis BMetastasis A Mutation 2 Mutation 1 Mutation 4 Mutation 3 Intra-patientInter-patient
- 11. Clonality of mutations Clonal mutation Mutation 2 Mutation 1 Mutation 4 Mutation 3 Primary or metastasis Subclonal mutation
- 12. Cancer evolution and drug resistance Prostate cancer (PCa) >1M cases worldwide, strongly heritable (57%) respond to castration (ADT) metastatic PCa Tumorvolumeandactivity CRPC
- 13. How to study cancer evolution and resistance? Collect and evaluate sequential samples over disease Collection of repeated tumor tissue biopsies is challenging and may not reflect real heterogeneity
- 14. Liquid biopsy
- 15. Liquid biopsy (cfDNA) Schweizer MT and Antonarakis ES, Sci Transl Med. 2015
- 16. Liquid biopsy Bioanalyzer of cell free DNA from a WCM patient (Jenny Xiang) 2 ml of blood → 1 ml of plasma → 5-300ng of DNA
- 17. NGS-based minimally invasive plasma DNA test Design a targeted panel Analyze the data Perform the sequencing
- 18. Targeted sequencing panel Select genomic regions of interest Genes involved in the disease Exonic/Coding regions Informative SNPs Other non-coding regions Include genes that are frequently aberrant in the disease
- 19. Targeted sequencing panel exons DNA Standard textual formats (BED files) to store this information ACGGGTCGGAAATGTGCGATGTCCGATGTCGATGTGGCCCCGATGTCCGATGTCGATGTCCGATGTCGATGTG Panel design
- 20. Targeted sequencing panel Illumina SureDesign
- 21. Generate/preprocess data FASTQ files Quality Control Alignment to human reference genome Removal of duplicates INDEL realignment Recalibration QC and data cleaning BAM files Library preparation
- 23. What is tumor DNA fraction? Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Normal DNA Tumor DNA
- 24. Learning from control samples 99.63% 99.63% 0.020.0150.01 Noise estimated from control samples Somatic SNVs detection Somatic CNVs detection The local total coverage is >= 100 The alternative base is supported by at least 5 reads The allelic fraction (AF) is > 0.02 (estimated from control samples) Exclusion of all genomic positions close to amplicon edges Exclusion of all positions not satisfying strand bias criteria The allelic fraction of the position for the control samples is <0.01
- 25. What is tumor DNA fraction? Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 TOTAL DNA ~ 90 ng/ml TUMOR FRACTION 4-fold higher Normal DNA Tumor DNA
- 26. Patient Time point Observed allelic fraction of TP53 mutation Rossi 1 10% Rossi 2 10% Rossi 3 5% Verdi 1 50% Why is important?
- 27. Patient Time point Observed allelic fraction of TP53 mutation Tumor DNA fraction Percentage of tumor molecules harboring TP53 mutation Rossi 1 10% 1 10% Rossi 2 10% 0.2 50% Rossi 3 5% 0.5 100% Verdi 1 50% 0.7 71% Any time we need to compare multiple plasma samples, either longitudinal or cross-sectional Why is important?
- 28. Normal cell Tumor cell 1 Maternal Paternal Maternal Paternal Informative SNPs reference alternative base Allelic Fraction Proportion of reads supporting the reference base SNP1 SNP2 SNP3 Allelic fraction property
- 29. gene A gene B Baca S et al, Cell 2013 Prandi D et al, Genome Biology 2014 Tumor fraction estimation Clonal Subclonal
- 30. Is an informative biomarker Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Tumor fraction is a biomarker Advanced patients with high tumor DNA fraction live less and some treatments are less effective
- 31. Tumor clones Blood vein DNA release
- 32. No aberration Subclonal aberration Clonal aberration Dynamics of tumor over time
- 33. Appearing Progression on anti-androgens Start taxane Disappearing NKX3-1PTEN Pre-castration Carreira S*, Romanel A*, et al, Science Transl Med 2014 Independent tumor clones
- 35. Create a temporal map Carreira S*, Romanel A*, et al, Science Transl Med 2014 Identify mechanisms or biomarkers of drug resistance
- 36. Mutations with temporal relationship with progression Carreira S*, Romanel A*, et al, Science Transl Med 2014 Romanel A*, Gasi Tandefelt D*, et al, Science Transl Med 2015 Drug resistance biomarkers AR
- 37. Drug resistance biomarkers Patients with high AR copy number live less and show stronger resistance to some drugs
- 39. Where are we?
- 40. Early detection of cancers
- 41. Current limitations Many tumors lack well-establish biomarkers Heterogeneity adds a level of complexity in liquid biopsy test establishment Biomarkers for different tumors at different stages DNA in blood is truly representative of all tumors? Can liquid biopsies improve cancer survival? Large studies and clinical trial needed Precision/recall of aberration identification Advances in technology Improvement of computational methods
- 42. Laboratory of Functional and Computational Oncology Francesca Demichelis POST-DOC positions Contact: f.demichelis@unitn.it OPEN POSITIONS at CIBIO