This document discusses genomic resources for the bay scallop, including its use as a fishery and aquaculture product. It summarizes research on genes involved in scallop metamorphosis and muscle growth. Specifically, it examines differentially expressed genes during metamorphosis and the role of the myostatin gene in muscle growth, finding it is highly expressed in scallop adductor muscle tissue. The document also discusses using ESTs and markers for environmental response, population genetics, and restoration.

1. Overview and Application of Bay Scallop Genomic Resources Steven Roberts Marine Biological Laboratory Woods Hole, MA USA

2. Bay Scallop -fishery product -aquaculture product -scientific model -muscle biology -photoreception -essential environmental component

4. Metamorphosis Trocophore -> D-hinge Between day 9-20 larvae first become “competent” then metamorphose into adult form . High Mortality

6. Approach Comparative transcriptomic analysis of developing bay scallops prior to (D-hinge), during (pediveliger), and following metamorphosis (spat)

7. Differentially Expressed Genes (DEG) Primer Pair B Primer Pair A Primer Pair C

8. Differentially Expressed Genes (DEG) “ D” hinge pediveliger spat “ D” hinge pediveliger spat * * * * Arbitrary Primers: MW ACP 22 ACP 29 a= Heat shock protein 70 b= serine protease precursor c= pheromone receptor “ D” hinge pediveliger spat “ D” hinge pediveliger spat ACP 27 ACP 28 a b c

9. Expressed Sequence Tags (ESTs) agtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc ttcgctgacacagtcgacagtcn agtacgtaccgatcgcgcgcc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc tcgctgacacagtcgacagtc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctannnggttctcgttga ttcgctgacacagtcgacagtcn mRNA cDNA mRNA cDNA mRNA cDNA Data Processing

12. Hind limbs, rapid differentiation Fore-limb emergence to complete tail reabsorption Acquisition of hypothalamic sensitivity to thyroid hormones Premetamorphosis Prometamorphosis Climax Postmetamorphosis T3/T4 TSH TRH Frog Metamorphosis

14. T-iso Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso Deiodinase u ( ai Du) Deiodinase v ( ai Dv) CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso

15. Interrelationship with External Factors Diet: Pavlova (e.g. CCMP549) has over 3 times more (%) phenylalanine than Isochrysis Differential uptake by algae of selenium. Selenium required for synthesis of deiodinases.

16. Does myostatin function in a similar manner in shellfish as it does in mammals? = =

17. Myostatin expression in fish

18. Scallop Myostatin Real-time RT-PCR – Dual labeled probes Northern Blot At least 6 times higher expression in adductor muscle tissue Heart 1 Heart 2 Gill 1 Gill 2 Digestive Gland 1 Digestive Gland 2 Gonad 1 Gonad 2 Mantle 1 & 2 Muscle 1 & 2

19. Myo-Blast Experiment Figure 5. PCR products from RNA from adult scallops (N=2) treated with MyoZap and not treated (contols). Differentially expressed genes are indicated with lower case letters. Cyclin T

20. Myo-Blast Experiment Control Experimental

21. Other uses of ESTs

23. Enhancement Broodstock Condition Spawn x x

24. Seed Wellfleet Chatham Dennis 32 101

25. EST-SSR M26 Wellfleet Chatham Dennis 40 10 30 Falmouth Chilmark 20km

26. Wellfleet Dennis 32 101 Chatham g340 m26 n391 s336 Diver (aug) Diver (nov) Diver (nov) Spat Bag

27. Regional N391 G340 M26 N391 G340 M26

29. EST-SNPs