SlideShare une entreprise Scribd logo
1  sur  75
We have seen that there is abundant evidence for the common descent of human beings and the rest of the living world. In Darwin’s time very little was known of the steps or intermediate stages that led to us.  This has changed dramatically in the last 150 years and now we have a wealth of data that enables us to reconstruct much of our origins.
Human beings have always pondered over how they came into existence. This has given rise to a wide variety of speculation and several beautiful stories. The Judeo-Christian tradition has the myth of Adam and Eve and the garden of Eden.
In ancient Indian mythology, Brahma created the world. He along with Siva the destroyer and Vishnu the preserver formed the Hindu trinity of Gods. However, moving beyond mythologies science has pieced together a far more interesting story that is still in the process of development.
The scientific history of the human race would not have been possible but for many great explorer-scientists who combined their love of adventure with their immense scientific curiosity. Though Darwin had surmised that evolution of hominids was in Africa, very soon the majority opinion shifted to Asia as the most likely place for early hominid evolution. Eugene Dubois gave up a prestigious academic career to go looking for the so called ‘missing link’ between apes and humans, in the remote islands of the Malay archipelago. He was rewarded by the find of what came to be known as the Java man in Indonesia. We now recognize this as the ‘Homo erectus’.
The focus shifted back to Africa in the 20th century. Much of the fossil evidence for the current view on human evolution has come from the great rift valley in Africa spanning from Ethiopia to East Africa.
The husband and wife team of Louis Leakey and Mary Leakey were pioneers in the exploration for human origins in Africa.
Most of the studies of the Leakeys were done in the Olduvai gorge and the nearby Laetoli in Tanzania.
The Olduvai gorge is a steep-sided ravine from where  fossil remains of human ancestors have been found from as long as 2.5 million years ago. It is also a site from which very old stone tools dating to about the same time were unearthed. These tools called Oldowan tools indicate that our hominid ancestors started using tools from as early as 2.5 million years ago.
Richard Leakey (son of Louis and Mary) and Donald Johanson (right). Richard’s digs near the Lake Turkana in Kenya and Johanson’s in the Afar region of Ethiopia helped discover landmark fossils.
A team of researchers excavating in northern Chad unearthed in 2002 the well-preserved skull and other fossilized remains of what they believe was an early human precursor, that lived six to seven million years ago. It is probably  the oldest known ancestor of humans. Named Sahelanthropustchadensis, it is believed to have walked upright, but not all scientists agree on this.
The term ‘missing link’ is often misinterpreted by those who oppose the theory of evolution, particularly the creationists.  It is understandable to talk of a common ancestor, in this case a now extinct ape which led to the lineages of Chimpanzees and Bonobos on one hand and humans on the other. It is to be remembered that both groups have evolved in its own way for millions of years before taking the present characteristics.  ‘Missing link’ between chimps and humans is that way absurd, because evolutionary theory does not postulate the existence of such a creature that is half human and half chimp.
It is generally agreed that upright posture and walking on two feet was the most important event that led to the evolution of the hominid branch. This led to the freeing of the hand which in turn led to the making and use of better and better tools. With tool making and the precision and co-ordination required for it, the brain capacity became an important factor for natural selection to operate. The increase in brain size followed in successive hominids reaching a culmination in Homo sapiens.
How do we get clues regarding bipedalism from the available fossil evidence?  Foramen magnum is the large hole in the underside of the skull, through which the spinal cord passes. It is found towards the back in animals that walk on all four limbs like that of the chimpanzee on the left. In the bipedal and upright animals like humans, the foramen magnum is seen much more towards the center.
The way bones are joined together in the pelvis and foot and the shape of the leg bones and vertebrae also give us a good idea about bipedalism.
The skeleton of ‘Lucy’, the famous fossil of the definitely bipedal hominid discovered by Donald Johanson in the Afar region of Ethiopia dated to be about 3.2 million years ago. On the right is a reconstruction of how Lucy would have looked like. Since then more remains have been unearthed of this creature named ‘Australopithecus afarensis’. A afarensis had a small brain size like that of the apes. This is proof that bipedalism preceded increase of brain size during evolution of the hominids.
3.6 million year old footprints (dated by radiometric methods) discovered by Mary Leakey in Laetoli. The prints are strikingly different from those of a chimpanzee, and in fact are hardly distinguishable from those of modern humans. The only known hominid fossils of that age in that location are those of Lucy and her kind, the small-brained but upright-walking hominids classified as Australopithecus afarensis.  While the detailed interpretation of the prints remains a matter of debate, they remain an extraordinary and fascinating fossil find, preserving a moment in prehistoric time.
Homo habilis existed from 2.3 million to 1.6 million years ago. It displayed human like traits not seen in earlier hominids like the shape of its upper jaw. But they retained a number of ape like characters like long arms and short legs. Homo habilis is believed to be one among the first tool users.
Homo habilis tools were simple stone flakes with a sharp edge. They probably used these tools for cleaving meat off of dead animals rather than hunting.
Homo ergaster which lived 1.9 million to 1.3 million years ago had a larger brain than Homo habilis.  Some regard this as a subspecies of Homo erectus.
Homo erectus which lived from 1.8 million to less than 100000 years ago was the first human ancestor to leave Africa and reach various parts of Asia and Europe.  They had brain sizes varying fro 850cc in the older to about 1100 cc in the later specimens. Many consider Homo erectus to be the direct predecessor of modern humans and the Neanderthals.
Homo ergaster and Homo erectus made tools which were more sophisticated than the stone flakes used by Homo habilis. The tools indicate that they were definitely hunters. These type of tools called the Acheulean tools have been recovered from all over the world and had remained unchanged for nearly a million years.
Homo erectus was the first to have definitely used controlled fire, though whether they made fire is debatable.
Neanderthal and modern humans. Both spread from Africa to Europe and Asia and co-existed till about 30000 years ago when the Neanderthals disappeared. There is difference of opinion whether to regard them as two sub-species of Homo sapiens or as separate species ie. H sapiens and H neanderthalis. Both the groups had similar brain size of about 1400 cc.
Brain size increased progressively during hominid evolution to the 1400 cc or so in the moderns and neanderthals.  We have seen that bipedalism preceded increase in brain size and that resulted in freeing of hands and its it use in fine co-ordinated movements.  This is reflected in the anatomy of the human brain.
This is the human brain. Areas shown in red and blue are those concerned with voluntary  movements and their coordination.
See the various parts of the body represented in the motor areas of the brain according to scale. Note that about one third of the area is just for the hand.
The Neanderthals were our closest cousins. They spread from Africa to the colder climates of Europe and Northern Asia earlier than us. Their body was more adapted to cold. They were stockier and had large noses and a heavy ridges on the brows.
Their tools were far more sophisticated than that of Homo erectus.
Reconstruction of how a Neanderthal girl would have looked like. We wouldn’t have recognized her in a crowd of modern humans as someone belonging to a different species. Did we interbreed with the Neanderthals? Current evidence from DNA isolated from  Neanderthal remains says no.
Both Neanderthals and modern humans buried their dead. Modern humans frequently buried other artifacts along with their dead indicating rituals. Here is a Homo sapiens woman and a baby buried together  in a cave in Israel some 100,000 years ago.
Homo sapiens tools were superior and used material like quartz. They also made new kind of tools like arrowheads.
One thing that seems to have set apart Homo sapiens from others is the capacity for abstract thought and expression.  Animal figures engraved in the Cussac cave (France) about 22000 years ago.
A 24000 year old sculpture of a woman’s head (France)
The family tree of hominids spanning about 4 million years. It has branching shape some branches leading to dead ends.
There have been two theories regarding the origin of modern humans ie. Homo sapiens sapiens. One view called the ‘Multiregional model’ is that modern humans arose separately in the different continents from the predecessor species ie. Homo erectus.  The second view dubbed the ‘Out of Africa model’ holds that modern humans rose in Africa and spread to rest of the world.
The multiregional model. The model according to some of its proponents also holds that the different races like Africans, Europeans and Asians evolved separately.
The ‘Out of Africa’ model The ‘Out of Africa’ model.  The numbers shown is the time (in years) when the earliest  fossils of modern humans have been found in different parts of the world.
The multiregional hypothesis by its implication of separate evolution of different races over a long duration of time has been used by racists to justify their theories. Nineteenth century textbooks used misleading imagery to suggest that "Negroes" had been created to rank between "Greeks" and chimpanzees.
Craniometry, the technique of measuring the bones of the skull and finding the cranial capacity was used in the nineteenth century to justify the hierarchical ordering of races with Europeans at the top and Africans at the bottom. These studies have now been shown to be unscientific or even fabricated in some cases. But such studies have been cited to support the idea that negroes had been created unequal, suited to slavery
Human zoos were 19th and 20th century public exhibits of human beings, usually in a "natural" or "primitive" state. The displays often emphasized the cultural differences between Western and non-European peoples. Ethnographic zoos were based on scientific racism, and a version of Social Darwinism. A number of them placed indigenous people (particularly Africans) in a continuum somewhere between the great apes and human beings of European descent.
Caricature of SaartjieBaartman (1789 - 1815) who was exhibited – nearly nude – in various shows in 19th century Europe under the name Hottentot Venus.   Saartjie Baartman (Hottentot Venus)
Starting from the 17th century and lasting to the nineteenth, 10 to 12 million Africans were taken to the Americas and sold in slavery. They were packed into ships like this like cattle. Many thousands died on the way.
Inhuman treatment was meted out to them. A photograph from 1863. Whipping was a common punishment in the Southern states of America.
Hitler and his Nazi Party published many books on scientific racism maintaining that the Aryan race was the most superior.
These ideas led to the concentration camps where millions perished.
Millions were put to death in gas chambers in camps like Auschwitz and Belsen. Their main fault was belonging to the allegedly inferior races.
So called scientific theories of racism was used to justify such horrors.
Segregation based on color of the skin was practiced as late as the second half of the twentieth century in Southern United States and South Africa.
In South Africa, the oppressive system of Apartheid was practiced. This was also based on theories of racial superiority and inferiority.
IQ The most recent pseudo-science is the theory of heritable racial differences in IQ. In its crudest form it states that General intelligence or the ’g factor’ is inherited as a simple phenotypic trait Determinant of IQ is predominantly genetic and environment has very little influence There are IQ differences between races and the blacks are inferior in this respect.
Books like the bell curve publlshed in 1994 still peddle these outmoded theories. They maintain that black children in America score less in IQ tests consistently and that this is due genetic reasons.  The political message they convey is that affirmative action and special education for black children are of no use.
 Average IQ of different racial groups residing in the United States  Black  		  Spanish                          White                              Asians The graph shows average IQ of different racial groups residing in the United States according to one study. Though these statistics are used to establish genetic differences in intelligence between groups, it appears prima facie fallacious.  The average IQ shown correlates best with the average income. It is significant that Asians have the highest average IQ. They also have the highest income since the immigrants to USA from Asia are generally better educated and contain a large number of professionals.
Equal light Adequate nutrients Not adequate nutrients Even if a trait is almost fully heritable, the group differences need not be genetic.  In the example shown the height of corn plants is almost 100% heritable. But there is marked difference in height between plants that get adequate nutrients and those that do not.
The pseudo-scientific theories regarding racial differences and social inequality are sometimes called ‘Social Darwinism’. This is an unfortunate term since it has nothing to do with Darwinism. Darwin himself believed in the unity of the human species and was against polygenic theory of races. He was a staunch opponent of slavery.
Let us briefly  see what current studies in molecular biology tell us about our past
This is a landmark paper published by Allan Wilson and colleagues in the journal Nature in 1987. They examined mitochondrial DNA variations in different human populations from all round the world.
Mitochondria are tiny organelles in eukaryote cells  that generate most of its chemical energy.
They are believed to have originally been bacteria that colonized a proto eukaryotic cell.
They have their own circular DNA, which is very similar in all vertebrate cells.  There are 37 genes in all of them and this again is evidence of common descent. The differences between the various groups is exactly as predicted by the evolutionary relationships.
ATTTCGGCCTTACCGTTAAGTCCTTTTAAGT ATTTCGGCCTTACCATTAAGTCCTTTTAAGT ATTTCGGCCTTACCATTAAGTGCTTTTAAGT ATTTCGGCCTTACCATTAAGTGCTTTTAAGA The differences in the mitochondrial genes can also be used in another way. Random mutations occur in certain regions of the mitochondrial DNA ate a fixed rate. They thus serve as a sort of molecular clocks. This is what Allan Wilson and colleagues did in the study mentioned earlier.
All the mitochondria in our cells come from our mothers. When the egg and sperm unite to form an embryo the few mitochondria present in the sperm is lost and only those in the egg are passed onto the baby. So all the mitochondrial DNA that each of us have belongs to our mothers.
My mitochondrial DNA comes from my mother. Hers from her mother and so on. Five generations back I would have had a maximum of 32 ancestors – 16 men and 16 women. But of these all my mitochondrial DNA would have come fro a single woman.
If there are 3 billion women in the world today, the number of their female ancestors in the previous generation would have been less than that number, since some would have had more than one daughter. If we go back in time long enough, the female ancestor of all living women today would be only one.
So all of us living in this world today have inherited our mitochondrial DNA from a woman who lived about 160000 years ago in Africa. Studies done by different people using the molecular clock concept agree on this, though the time estimate varies from about 1 to 2 lakh years. It is to be noted that we have not inherited all our genes from this woman. For each gene the convergence may be to a different ancestor. In that sense use of the term ‘Eve’ is inappropriate.
When mitochondrial DNA sequences from people living in different parts of the world are studied, they can be divided into different groups. They are named L, M, N etc. Depending on the mutation patterns it can be inferred which group followed which. For example L is the most ancient, additional mutations in the sequence gives rise to M, more mutations to N etc.  By looking at the predominant group found among indigenous people in each area, the patterns of migration can be inferred. Such studies unmistakably point to Africa as the cradle of the human species.
Y chromosome is the smallest chromosome. It is seen only in males Y chromosome
Y chromosome is inherited from father to son. Similar to what we have seen in case of mitochondrial DNA, the Y chromosome of every male in the world today can be traced back to a single male ancestor in the remote past. And by studying the mutation patterns in the Y chromosome, it can be estimated how long ago that ancestor lived. It is further possible to study the migration patterns of humans using this tool just as in the case of the mitochondrial DNA.
All current evidence point to a man in Africa who lived around 60000 to 90000 years back as our Y chromosome ancestor.  Needless to say the rest of our genes may be traced to other ancestors and so the term Adam is again inappropriate.
Migration patterns established by studying the mutations in Y chromosome DNA again unequivocally proves our African origin.
Because of the popular usage of terms like mitochondrial Eve and Y-chromosome Adam it may be confusing when we say that this Adam and Eve may have lived in different times. In fact every one of our genes will converge on a different ancestor in the past. But we can say with some degree of confidence that all of us, without exception have descended from a rather small band of modern humans in Africa sometime around 200000 years ago.        Adam and Eve might not have met
This means that we human beings are a very young species. Only about 7500 generations separate us from the first band of modern humans in Africa.  This means that the differences between all human beings are only the equivalent of the changes that occur in a species of bacteria in a period of 2 months. The differences amongst are cultural rather than genetic.
Sewall Wright was a pioneer in population genetics. He evolved a measure called Fixation Index (FST) which is a measure of population differentiation based on genetic polymorphism data. According to him, if within a species the FST is more than 0.25 between two groups, then it can be called a separate sub-species or races.
The differences between human beings based on various genes is only about 0.1. To talk of races among Homo sapiens is thus scientifically invalid.
We are misled by the differences in rapidly evolving traits like skin color into imagining bigger differences between human beings than what actually exists. Race in human beings is only skin deep.
Human oneness and equality are not mere ethical concepts. It is true.

Contenu connexe

Tendances

Tendances (20)

Study of Human evolution
Study of Human evolutionStudy of Human evolution
Study of Human evolution
 
Osmania University BSc Electronics Syllabus
Osmania University BSc Electronics SyllabusOsmania University BSc Electronics Syllabus
Osmania University BSc Electronics Syllabus
 
photosynthesis
photosynthesisphotosynthesis
photosynthesis
 
Evolution and adaptation
Evolution and adaptationEvolution and adaptation
Evolution and adaptation
 
Causes of water pollution
Causes of water pollutionCauses of water pollution
Causes of water pollution
 
Evolution of man
Evolution of manEvolution of man
Evolution of man
 
Human evolution by martin
Human evolution by martinHuman evolution by martin
Human evolution by martin
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
The Carbon Cycle by Tangstar Science
The Carbon Cycle by Tangstar ScienceThe Carbon Cycle by Tangstar Science
The Carbon Cycle by Tangstar Science
 
Removal of Hexavalent Chromium in Aqueous Solutions through Talisay Leaves
Removal of Hexavalent Chromium in Aqueous Solutions through Talisay LeavesRemoval of Hexavalent Chromium in Aqueous Solutions through Talisay Leaves
Removal of Hexavalent Chromium in Aqueous Solutions through Talisay Leaves
 
Principle of classification of living things
Principle of classification of living thingsPrinciple of classification of living things
Principle of classification of living things
 
Neanderthals, Lecture 9
Neanderthals, Lecture 9Neanderthals, Lecture 9
Neanderthals, Lecture 9
 
Parazoa
Parazoa Parazoa
Parazoa
 
Evolution of Man
Evolution of ManEvolution of Man
Evolution of Man
 
Eykaryotes
EykaryotesEykaryotes
Eykaryotes
 
Algae
AlgaeAlgae
Algae
 
Carbon Cycle
Carbon CycleCarbon Cycle
Carbon Cycle
 
Movement of substances 2013
Movement of substances 2013Movement of substances 2013
Movement of substances 2013
 
Echinodermata Classification.pptx
Echinodermata Classification.pptxEchinodermata Classification.pptx
Echinodermata Classification.pptx
 

En vedette

THE STORY OF HUMAN EVOLUTION
THE STORY OF HUMAN EVOLUTION THE STORY OF HUMAN EVOLUTION
THE STORY OF HUMAN EVOLUTION Amita Yadav
 
Human Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint PresentationHuman Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint Presentationsanfojam
 
Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.PaulVMcDowell
 
Payton_EarlyHumanTools
Payton_EarlyHumanToolsPayton_EarlyHumanTools
Payton_EarlyHumanToolsMs Wilson
 
Groups of Hominids
Groups of HominidsGroups of Hominids
Groups of HominidsA Lecesse
 
Bronze age Ireland
Bronze age IrelandBronze age Ireland
Bronze age IrelandNoel Hogan
 
Human evolution
Human evolutionHuman evolution
Human evolution11
 
Bhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifeBhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifePatnaik Gourishankar
 
Tools used by early people
Tools used by early peopleTools used by early people
Tools used by early peopleMs Wilson
 
A2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionA2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionmissfcmay
 

En vedette (20)

THE STORY OF HUMAN EVOLUTION
THE STORY OF HUMAN EVOLUTION THE STORY OF HUMAN EVOLUTION
THE STORY OF HUMAN EVOLUTION
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Human Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint PresentationHuman Evolution Interactive Powerpoint Presentation
Human Evolution Interactive Powerpoint Presentation
 
Cells
CellsCells
Cells
 
Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.Human Biological and Cultural Evolution.
Human Biological and Cultural Evolution.
 
Human Evolution
Human EvolutionHuman Evolution
Human Evolution
 
Human Evolution
Human EvolutionHuman Evolution
Human Evolution
 
Sun & moon
Sun & moonSun & moon
Sun & moon
 
Payton_EarlyHumanTools
Payton_EarlyHumanToolsPayton_EarlyHumanTools
Payton_EarlyHumanTools
 
Groups of Hominids
Groups of HominidsGroups of Hominids
Groups of Hominids
 
Bronze age Ireland
Bronze age IrelandBronze age Ireland
Bronze age Ireland
 
Human evolution
Human evolutionHuman evolution
Human evolution
 
Bhagwat gita …..and origin of life
Bhagwat gita …..and origin of lifeBhagwat gita …..and origin of life
Bhagwat gita …..and origin of life
 
Homo Zappiens
Homo ZappiensHomo Zappiens
Homo Zappiens
 
Tools used by early people
Tools used by early peopleTools used by early people
Tools used by early people
 
The Bronze Age
The Bronze AgeThe Bronze Age
The Bronze Age
 
A2 exam 2014 growth and evolution
A2 exam 2014 growth and evolutionA2 exam 2014 growth and evolution
A2 exam 2014 growth and evolution
 
Darwins theory final
Darwins theory finalDarwins theory final
Darwins theory final
 
Evolution by stages
Evolution by stagesEvolution by stages
Evolution by stages
 
What about Adam and Eve
What about Adam and EveWhat about Adam and Eve
What about Adam and Eve
 

Similaire à Human Evolution

Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Riverside County Office of Education
 
Neanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryNeanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryChristina Valadez
 
Life And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyLife And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyAshley Davis
 
Similarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesSimilarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesLissette Hartman
 
Australopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAustralopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAmber Moore
 
Paranthropus Boisei
Paranthropus BoiseiParanthropus Boisei
Paranthropus BoiseiSharon Lee
 
Kate early man ppt
Kate early man pptKate early man ppt
Kate early man pptMs Wilson
 
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
MUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docxMUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docx
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docxroushhsiu
 
Understanding Our Past
Understanding Our PastUnderstanding Our Past
Understanding Our Pastpbrock
 
Unit 5 prehistory theory
Unit 5 prehistory theoryUnit 5 prehistory theory
Unit 5 prehistory theorysergio.historia
 
Similarities Between Homo Habilis, Homo Rudolfensis, And...
Similarities Between Homo Habilis, Homo Rudolfensis, And...Similarities Between Homo Habilis, Homo Rudolfensis, And...
Similarities Between Homo Habilis, Homo Rudolfensis, And...Sharon Lee
 
The first humans_prehistory_to_3500_bc_v_03
The first humans_prehistory_to_3500_bc_v_03The first humans_prehistory_to_3500_bc_v_03
The first humans_prehistory_to_3500_bc_v_03Kimberly McClain
 

Similaire à Human Evolution (20)

Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
Dean r berry The Earliest Humans: Human Evolution from Hominids to early civi...
 
Neanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien TheoryNeanderthal Vs Homo Sapien Theory
Neanderthal Vs Homo Sapien Theory
 
Life And Discoveries Of Louis Leakey
Life And Discoveries Of Louis LeakeyLife And Discoveries Of Louis Leakey
Life And Discoveries Of Louis Leakey
 
Similarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And ChimpanzeesSimilarities Between Chimpanzees And Chimpanzees
Similarities Between Chimpanzees And Chimpanzees
 
26-3 PowerPoint.ppt
26-3 PowerPoint.ppt26-3 PowerPoint.ppt
26-3 PowerPoint.ppt
 
Australopithecus Cordi Human Evolution
Australopithecus Cordi Human EvolutionAustralopithecus Cordi Human Evolution
Australopithecus Cordi Human Evolution
 
Paranthropus Boisei
Paranthropus BoiseiParanthropus Boisei
Paranthropus Boisei
 
GROUP-3-UCSP.pptx
GROUP-3-UCSP.pptxGROUP-3-UCSP.pptx
GROUP-3-UCSP.pptx
 
Kate early man ppt
Kate early man pptKate early man ppt
Kate early man ppt
 
An article on human evolution
 An article on human evolution An article on human evolution
An article on human evolution
 
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
MUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docxMUSEUM  OF  NATURAL  HISTORY  PUBLICATION  FOR  EDUCATORSV.docx
MUSEUM OF NATURAL HISTORY PUBLICATION FOR EDUCATORSV.docx
 
Understanding Our Past
Understanding Our PastUnderstanding Our Past
Understanding Our Past
 
Fossil Mosaic Evolution
Fossil Mosaic EvolutionFossil Mosaic Evolution
Fossil Mosaic Evolution
 
Unit 5 prehistory theory
Unit 5 prehistory theoryUnit 5 prehistory theory
Unit 5 prehistory theory
 
Hominid 2
Hominid 2Hominid 2
Hominid 2
 
Similarities Between Homo Habilis, Homo Rudolfensis, And...
Similarities Between Homo Habilis, Homo Rudolfensis, And...Similarities Between Homo Habilis, Homo Rudolfensis, And...
Similarities Between Homo Habilis, Homo Rudolfensis, And...
 
The first humans_prehistory_to_3500_bc_v_03
The first humans_prehistory_to_3500_bc_v_03The first humans_prehistory_to_3500_bc_v_03
The first humans_prehistory_to_3500_bc_v_03
 
Biology
BiologyBiology
Biology
 
African Exodus
African ExodusAfrican Exodus
African Exodus
 
Paleoanthropology
PaleoanthropologyPaleoanthropology
Paleoanthropology
 

Plus de THANKACHAN V P

Plus de THANKACHAN V P (20)

KERALA SASTRA SAHITHYA PARISHATH
KERALA SASTRA SAHITHYA PARISHATHKERALA SASTRA SAHITHYA PARISHATH
KERALA SASTRA SAHITHYA PARISHATH
 
GREEN KERALA
GREEN KERALAGREEN KERALA
GREEN KERALA
 
ELEPHANT RACE GURUVAYOOR
ELEPHANT RACE GURUVAYOORELEPHANT RACE GURUVAYOOR
ELEPHANT RACE GURUVAYOOR
 
My lady of dreams
My lady of dreamsMy lady of dreams
My lady of dreams
 
Iya Activities Of Kssp
Iya Activities Of KsspIya Activities Of Kssp
Iya Activities Of Kssp
 
Science Tour On Wheels
Science Tour On WheelsScience Tour On Wheels
Science Tour On Wheels
 
Traditional Marriage
Traditional MarriageTraditional Marriage
Traditional Marriage
 
Evolutionary Theory in 21st Century
Evolutionary Theory in 21st CenturyEvolutionary Theory in 21st Century
Evolutionary Theory in 21st Century
 
International Year Of Astronomy
International Year Of AstronomyInternational Year Of Astronomy
International Year Of Astronomy
 
India Election 2009
India Election 2009India Election 2009
India Election 2009
 
Study tour to Lakshadweep Islands
Study tour to Lakshadweep IslandsStudy tour to Lakshadweep Islands
Study tour to Lakshadweep Islands
 
To The Medical Student
To The Medical Student To The Medical Student
To The Medical Student
 
ONAM-THE FESTIVAL OF FLOWERS
ONAM-THE FESTIVAL OF FLOWERSONAM-THE FESTIVAL OF FLOWERS
ONAM-THE FESTIVAL OF FLOWERS
 
Race Boat India 1
Race Boat India  1Race Boat India  1
Race Boat India 1
 
Kathakali
KathakaliKathakali
Kathakali
 
Pooram 1
Pooram 1Pooram 1
Pooram 1
 
Asha Poorna
Asha PoornaAsha Poorna
Asha Poorna
 
In The Name Of God
In The Name Of GodIn The Name Of God
In The Name Of God
 
Theyyam
TheyyamTheyyam
Theyyam
 
Silent Valley Pps
Silent Valley PpsSilent Valley Pps
Silent Valley Pps
 

Dernier

AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...apidays
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdflior mazor
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingEdi Saputra
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMESafe Software
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MIND CTI
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesBoston Institute of Analytics
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)wesley chun
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024SynarionITSolutions
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Principled Technologies
 

Dernier (20)

AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation Strategies
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
 

Human Evolution

  • 1. We have seen that there is abundant evidence for the common descent of human beings and the rest of the living world. In Darwin’s time very little was known of the steps or intermediate stages that led to us. This has changed dramatically in the last 150 years and now we have a wealth of data that enables us to reconstruct much of our origins.
  • 2. Human beings have always pondered over how they came into existence. This has given rise to a wide variety of speculation and several beautiful stories. The Judeo-Christian tradition has the myth of Adam and Eve and the garden of Eden.
  • 3. In ancient Indian mythology, Brahma created the world. He along with Siva the destroyer and Vishnu the preserver formed the Hindu trinity of Gods. However, moving beyond mythologies science has pieced together a far more interesting story that is still in the process of development.
  • 4. The scientific history of the human race would not have been possible but for many great explorer-scientists who combined their love of adventure with their immense scientific curiosity. Though Darwin had surmised that evolution of hominids was in Africa, very soon the majority opinion shifted to Asia as the most likely place for early hominid evolution. Eugene Dubois gave up a prestigious academic career to go looking for the so called ‘missing link’ between apes and humans, in the remote islands of the Malay archipelago. He was rewarded by the find of what came to be known as the Java man in Indonesia. We now recognize this as the ‘Homo erectus’.
  • 5. The focus shifted back to Africa in the 20th century. Much of the fossil evidence for the current view on human evolution has come from the great rift valley in Africa spanning from Ethiopia to East Africa.
  • 6. The husband and wife team of Louis Leakey and Mary Leakey were pioneers in the exploration for human origins in Africa.
  • 7. Most of the studies of the Leakeys were done in the Olduvai gorge and the nearby Laetoli in Tanzania.
  • 8. The Olduvai gorge is a steep-sided ravine from where fossil remains of human ancestors have been found from as long as 2.5 million years ago. It is also a site from which very old stone tools dating to about the same time were unearthed. These tools called Oldowan tools indicate that our hominid ancestors started using tools from as early as 2.5 million years ago.
  • 9. Richard Leakey (son of Louis and Mary) and Donald Johanson (right). Richard’s digs near the Lake Turkana in Kenya and Johanson’s in the Afar region of Ethiopia helped discover landmark fossils.
  • 10. A team of researchers excavating in northern Chad unearthed in 2002 the well-preserved skull and other fossilized remains of what they believe was an early human precursor, that lived six to seven million years ago. It is probably the oldest known ancestor of humans. Named Sahelanthropustchadensis, it is believed to have walked upright, but not all scientists agree on this.
  • 11. The term ‘missing link’ is often misinterpreted by those who oppose the theory of evolution, particularly the creationists. It is understandable to talk of a common ancestor, in this case a now extinct ape which led to the lineages of Chimpanzees and Bonobos on one hand and humans on the other. It is to be remembered that both groups have evolved in its own way for millions of years before taking the present characteristics. ‘Missing link’ between chimps and humans is that way absurd, because evolutionary theory does not postulate the existence of such a creature that is half human and half chimp.
  • 12. It is generally agreed that upright posture and walking on two feet was the most important event that led to the evolution of the hominid branch. This led to the freeing of the hand which in turn led to the making and use of better and better tools. With tool making and the precision and co-ordination required for it, the brain capacity became an important factor for natural selection to operate. The increase in brain size followed in successive hominids reaching a culmination in Homo sapiens.
  • 13. How do we get clues regarding bipedalism from the available fossil evidence? Foramen magnum is the large hole in the underside of the skull, through which the spinal cord passes. It is found towards the back in animals that walk on all four limbs like that of the chimpanzee on the left. In the bipedal and upright animals like humans, the foramen magnum is seen much more towards the center.
  • 14. The way bones are joined together in the pelvis and foot and the shape of the leg bones and vertebrae also give us a good idea about bipedalism.
  • 15. The skeleton of ‘Lucy’, the famous fossil of the definitely bipedal hominid discovered by Donald Johanson in the Afar region of Ethiopia dated to be about 3.2 million years ago. On the right is a reconstruction of how Lucy would have looked like. Since then more remains have been unearthed of this creature named ‘Australopithecus afarensis’. A afarensis had a small brain size like that of the apes. This is proof that bipedalism preceded increase of brain size during evolution of the hominids.
  • 16. 3.6 million year old footprints (dated by radiometric methods) discovered by Mary Leakey in Laetoli. The prints are strikingly different from those of a chimpanzee, and in fact are hardly distinguishable from those of modern humans. The only known hominid fossils of that age in that location are those of Lucy and her kind, the small-brained but upright-walking hominids classified as Australopithecus afarensis. While the detailed interpretation of the prints remains a matter of debate, they remain an extraordinary and fascinating fossil find, preserving a moment in prehistoric time.
  • 17. Homo habilis existed from 2.3 million to 1.6 million years ago. It displayed human like traits not seen in earlier hominids like the shape of its upper jaw. But they retained a number of ape like characters like long arms and short legs. Homo habilis is believed to be one among the first tool users.
  • 18. Homo habilis tools were simple stone flakes with a sharp edge. They probably used these tools for cleaving meat off of dead animals rather than hunting.
  • 19. Homo ergaster which lived 1.9 million to 1.3 million years ago had a larger brain than Homo habilis. Some regard this as a subspecies of Homo erectus.
  • 20. Homo erectus which lived from 1.8 million to less than 100000 years ago was the first human ancestor to leave Africa and reach various parts of Asia and Europe. They had brain sizes varying fro 850cc in the older to about 1100 cc in the later specimens. Many consider Homo erectus to be the direct predecessor of modern humans and the Neanderthals.
  • 21. Homo ergaster and Homo erectus made tools which were more sophisticated than the stone flakes used by Homo habilis. The tools indicate that they were definitely hunters. These type of tools called the Acheulean tools have been recovered from all over the world and had remained unchanged for nearly a million years.
  • 22. Homo erectus was the first to have definitely used controlled fire, though whether they made fire is debatable.
  • 23. Neanderthal and modern humans. Both spread from Africa to Europe and Asia and co-existed till about 30000 years ago when the Neanderthals disappeared. There is difference of opinion whether to regard them as two sub-species of Homo sapiens or as separate species ie. H sapiens and H neanderthalis. Both the groups had similar brain size of about 1400 cc.
  • 24. Brain size increased progressively during hominid evolution to the 1400 cc or so in the moderns and neanderthals. We have seen that bipedalism preceded increase in brain size and that resulted in freeing of hands and its it use in fine co-ordinated movements. This is reflected in the anatomy of the human brain.
  • 25. This is the human brain. Areas shown in red and blue are those concerned with voluntary movements and their coordination.
  • 26. See the various parts of the body represented in the motor areas of the brain according to scale. Note that about one third of the area is just for the hand.
  • 27. The Neanderthals were our closest cousins. They spread from Africa to the colder climates of Europe and Northern Asia earlier than us. Their body was more adapted to cold. They were stockier and had large noses and a heavy ridges on the brows.
  • 28. Their tools were far more sophisticated than that of Homo erectus.
  • 29. Reconstruction of how a Neanderthal girl would have looked like. We wouldn’t have recognized her in a crowd of modern humans as someone belonging to a different species. Did we interbreed with the Neanderthals? Current evidence from DNA isolated from Neanderthal remains says no.
  • 30. Both Neanderthals and modern humans buried their dead. Modern humans frequently buried other artifacts along with their dead indicating rituals. Here is a Homo sapiens woman and a baby buried together in a cave in Israel some 100,000 years ago.
  • 31. Homo sapiens tools were superior and used material like quartz. They also made new kind of tools like arrowheads.
  • 32. One thing that seems to have set apart Homo sapiens from others is the capacity for abstract thought and expression. Animal figures engraved in the Cussac cave (France) about 22000 years ago.
  • 33. A 24000 year old sculpture of a woman’s head (France)
  • 34. The family tree of hominids spanning about 4 million years. It has branching shape some branches leading to dead ends.
  • 35. There have been two theories regarding the origin of modern humans ie. Homo sapiens sapiens. One view called the ‘Multiregional model’ is that modern humans arose separately in the different continents from the predecessor species ie. Homo erectus. The second view dubbed the ‘Out of Africa model’ holds that modern humans rose in Africa and spread to rest of the world.
  • 36. The multiregional model. The model according to some of its proponents also holds that the different races like Africans, Europeans and Asians evolved separately.
  • 37. The ‘Out of Africa’ model The ‘Out of Africa’ model. The numbers shown is the time (in years) when the earliest fossils of modern humans have been found in different parts of the world.
  • 38. The multiregional hypothesis by its implication of separate evolution of different races over a long duration of time has been used by racists to justify their theories. Nineteenth century textbooks used misleading imagery to suggest that "Negroes" had been created to rank between "Greeks" and chimpanzees.
  • 39. Craniometry, the technique of measuring the bones of the skull and finding the cranial capacity was used in the nineteenth century to justify the hierarchical ordering of races with Europeans at the top and Africans at the bottom. These studies have now been shown to be unscientific or even fabricated in some cases. But such studies have been cited to support the idea that negroes had been created unequal, suited to slavery
  • 40. Human zoos were 19th and 20th century public exhibits of human beings, usually in a "natural" or "primitive" state. The displays often emphasized the cultural differences between Western and non-European peoples. Ethnographic zoos were based on scientific racism, and a version of Social Darwinism. A number of them placed indigenous people (particularly Africans) in a continuum somewhere between the great apes and human beings of European descent.
  • 41. Caricature of SaartjieBaartman (1789 - 1815) who was exhibited – nearly nude – in various shows in 19th century Europe under the name Hottentot Venus. Saartjie Baartman (Hottentot Venus)
  • 42. Starting from the 17th century and lasting to the nineteenth, 10 to 12 million Africans were taken to the Americas and sold in slavery. They were packed into ships like this like cattle. Many thousands died on the way.
  • 43. Inhuman treatment was meted out to them. A photograph from 1863. Whipping was a common punishment in the Southern states of America.
  • 44. Hitler and his Nazi Party published many books on scientific racism maintaining that the Aryan race was the most superior.
  • 45. These ideas led to the concentration camps where millions perished.
  • 46. Millions were put to death in gas chambers in camps like Auschwitz and Belsen. Their main fault was belonging to the allegedly inferior races.
  • 47. So called scientific theories of racism was used to justify such horrors.
  • 48. Segregation based on color of the skin was practiced as late as the second half of the twentieth century in Southern United States and South Africa.
  • 49. In South Africa, the oppressive system of Apartheid was practiced. This was also based on theories of racial superiority and inferiority.
  • 50. IQ The most recent pseudo-science is the theory of heritable racial differences in IQ. In its crudest form it states that General intelligence or the ’g factor’ is inherited as a simple phenotypic trait Determinant of IQ is predominantly genetic and environment has very little influence There are IQ differences between races and the blacks are inferior in this respect.
  • 51. Books like the bell curve publlshed in 1994 still peddle these outmoded theories. They maintain that black children in America score less in IQ tests consistently and that this is due genetic reasons. The political message they convey is that affirmative action and special education for black children are of no use.
  • 52. Average IQ of different racial groups residing in the United States Black Spanish White Asians The graph shows average IQ of different racial groups residing in the United States according to one study. Though these statistics are used to establish genetic differences in intelligence between groups, it appears prima facie fallacious. The average IQ shown correlates best with the average income. It is significant that Asians have the highest average IQ. They also have the highest income since the immigrants to USA from Asia are generally better educated and contain a large number of professionals.
  • 53. Equal light Adequate nutrients Not adequate nutrients Even if a trait is almost fully heritable, the group differences need not be genetic. In the example shown the height of corn plants is almost 100% heritable. But there is marked difference in height between plants that get adequate nutrients and those that do not.
  • 54. The pseudo-scientific theories regarding racial differences and social inequality are sometimes called ‘Social Darwinism’. This is an unfortunate term since it has nothing to do with Darwinism. Darwin himself believed in the unity of the human species and was against polygenic theory of races. He was a staunch opponent of slavery.
  • 55. Let us briefly see what current studies in molecular biology tell us about our past
  • 56. This is a landmark paper published by Allan Wilson and colleagues in the journal Nature in 1987. They examined mitochondrial DNA variations in different human populations from all round the world.
  • 57. Mitochondria are tiny organelles in eukaryote cells that generate most of its chemical energy.
  • 58. They are believed to have originally been bacteria that colonized a proto eukaryotic cell.
  • 59. They have their own circular DNA, which is very similar in all vertebrate cells. There are 37 genes in all of them and this again is evidence of common descent. The differences between the various groups is exactly as predicted by the evolutionary relationships.
  • 60. ATTTCGGCCTTACCGTTAAGTCCTTTTAAGT ATTTCGGCCTTACCATTAAGTCCTTTTAAGT ATTTCGGCCTTACCATTAAGTGCTTTTAAGT ATTTCGGCCTTACCATTAAGTGCTTTTAAGA The differences in the mitochondrial genes can also be used in another way. Random mutations occur in certain regions of the mitochondrial DNA ate a fixed rate. They thus serve as a sort of molecular clocks. This is what Allan Wilson and colleagues did in the study mentioned earlier.
  • 61. All the mitochondria in our cells come from our mothers. When the egg and sperm unite to form an embryo the few mitochondria present in the sperm is lost and only those in the egg are passed onto the baby. So all the mitochondrial DNA that each of us have belongs to our mothers.
  • 62. My mitochondrial DNA comes from my mother. Hers from her mother and so on. Five generations back I would have had a maximum of 32 ancestors – 16 men and 16 women. But of these all my mitochondrial DNA would have come fro a single woman.
  • 63. If there are 3 billion women in the world today, the number of their female ancestors in the previous generation would have been less than that number, since some would have had more than one daughter. If we go back in time long enough, the female ancestor of all living women today would be only one.
  • 64. So all of us living in this world today have inherited our mitochondrial DNA from a woman who lived about 160000 years ago in Africa. Studies done by different people using the molecular clock concept agree on this, though the time estimate varies from about 1 to 2 lakh years. It is to be noted that we have not inherited all our genes from this woman. For each gene the convergence may be to a different ancestor. In that sense use of the term ‘Eve’ is inappropriate.
  • 65. When mitochondrial DNA sequences from people living in different parts of the world are studied, they can be divided into different groups. They are named L, M, N etc. Depending on the mutation patterns it can be inferred which group followed which. For example L is the most ancient, additional mutations in the sequence gives rise to M, more mutations to N etc. By looking at the predominant group found among indigenous people in each area, the patterns of migration can be inferred. Such studies unmistakably point to Africa as the cradle of the human species.
  • 66. Y chromosome is the smallest chromosome. It is seen only in males Y chromosome
  • 67. Y chromosome is inherited from father to son. Similar to what we have seen in case of mitochondrial DNA, the Y chromosome of every male in the world today can be traced back to a single male ancestor in the remote past. And by studying the mutation patterns in the Y chromosome, it can be estimated how long ago that ancestor lived. It is further possible to study the migration patterns of humans using this tool just as in the case of the mitochondrial DNA.
  • 68. All current evidence point to a man in Africa who lived around 60000 to 90000 years back as our Y chromosome ancestor. Needless to say the rest of our genes may be traced to other ancestors and so the term Adam is again inappropriate.
  • 69. Migration patterns established by studying the mutations in Y chromosome DNA again unequivocally proves our African origin.
  • 70. Because of the popular usage of terms like mitochondrial Eve and Y-chromosome Adam it may be confusing when we say that this Adam and Eve may have lived in different times. In fact every one of our genes will converge on a different ancestor in the past. But we can say with some degree of confidence that all of us, without exception have descended from a rather small band of modern humans in Africa sometime around 200000 years ago. Adam and Eve might not have met
  • 71. This means that we human beings are a very young species. Only about 7500 generations separate us from the first band of modern humans in Africa. This means that the differences between all human beings are only the equivalent of the changes that occur in a species of bacteria in a period of 2 months. The differences amongst are cultural rather than genetic.
  • 72. Sewall Wright was a pioneer in population genetics. He evolved a measure called Fixation Index (FST) which is a measure of population differentiation based on genetic polymorphism data. According to him, if within a species the FST is more than 0.25 between two groups, then it can be called a separate sub-species or races.
  • 73. The differences between human beings based on various genes is only about 0.1. To talk of races among Homo sapiens is thus scientifically invalid.
  • 74. We are misled by the differences in rapidly evolving traits like skin color into imagining bigger differences between human beings than what actually exists. Race in human beings is only skin deep.
  • 75. Human oneness and equality are not mere ethical concepts. It is true.