These alain hehn

1 068 vues

Publié le

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
1 068
Sur SlideShare
0
Issues des intégrations
0
Intégrations
4
Actions
Partages
0
Téléchargements
12
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

These alain hehn

  1. 1. UNIVERSITE LOUIS PASTEUR STRASBOURG I 1995 THESE présentée à LUFR DES SCIENCES DE LA VIE ET DE LA TERRE pour obtenir le titre de DOCTEUR DE LUNIVERSITE LOUIS PASTEUR domaine : BIOLOGIE MOLECULAIRE par Alain HEHNLES GENES 3 PROXIMAUX DU RNA 2 DU VIRUS DES NERVURES JAUNES ET NECROTIQUES DE LA BETTERAVE (OU BNYVV) :LEUR ROLE DANS LA REPLICATION ET LA TRADUCTION DU GENOME VIRAL AINSI QUE DANS LE MOUVEMENT DU VIRUS DE CELLULE A CELLULE. Soutenue le 27 juin 1995 devant la Commission dExamen Dr. M. LEGRAND Rapporteur interne Pr. A. VAN KAMMEN Rapporteur externe Dr. T. CANDRESSE Rapporteur externe Dr. K. RICHARDS Examinateur Pr. G. JONARD Directeur de Thèse Institut de Biologie Moléculaire des Plantes (IBMP-CNRS) Strasbourg
  2. 2. à mes parents,à Valérie, à Michel
  3. 3. Je voudrais remercier ici, le professeur Jonard qui ma accordé sa confiance un matindavril 1991 en maccueillant au sein de son groupe, me donnant ainsi lopportunité deréaliser cette thèse.La recherche est un labyrinthe dans lequel on peut aisément ségarer. Merci àmessieurs Guilley et Richards, les 2 autres membres du TCB, davoir été disponiblepour mécouter, me conseiller et me diriger efficacement quand il le fallait.Jaimerai exprimer ma gratitude aux membres du jury : messieurs Candresse, Legrandet Van Kammen pour avoir accepté de juger ce travail.Mes remerciements vont tout particulièrement à Salah Bouzoubaa qui, armé debeaucoup de patience (si, si, beaucoup de patience ! ), a su minitier à la paillasse et àla recherche en général.Merci également à Mme Marbach pour avoir préparé chaque semaine, inlassablement,ces fameux protoplastes, source de joie et souvent de dépit.Je tiens a exprimer ma reconnaissance à Mme Fritsch qui, au cours de nos discussions,ma permis de mieux comprendre la maturation mais aussi le frame-shift...!Enfin, je voudrais remercier toutes les personnes qui, de près ou de loin, ont contribué àfaire de cette thèse ce quelle est et avec qui jai partagé tant de gâteaux, de chocolats etautre thé à la menthe.
  4. 4. SOMMAIRESOMMAIRE.........................................................................................................................1INTRODUCTION ...............................................................................................................7 RESULTATSCHAPITRE 1 : LES PROTEINES EXPRIMEES A PARTIR DU "TRIPLE GENEBLOCK" (TGB) SONT DIRECTEMENT IMPLIQUEES DANS LEMOUVEMENT DU VIRUS DE CELLULE A CELLULE. ............................................17I-Etat des connaissances sur les mécanismes de transport des virus. ....................................19 1-Stratégie utilisée par les tobamovirus. ....................................................................20 2-Stratégie utilisée par les comovirus, les népovirus et les caulimovirus..................20 3-Stratégie utilisée par les hordeivirus, les potexvirus et les furovirus......................21II-Rôle du Triple Gene Block dans le mouvement de cellule à cellule du BNYVV. ............23 1-Le Triple Gene Block du BNYVV est impliqué dans le mouvement du virus de cellule à cellule...........................................................................................................23 2-Les protéines P42 et P13 du Triple Gene Block sont exprimées à partir de RNA subgénomiques. ................................................................................................27III-Conclusions et perspectives. .............................................................................................28Publication n°1 : EFFICIENT CELL TO CELL MOVEMENT OF BEET NECROTICYELLOW VEIN VIRUS REQUIRES 3 PROXIMAL GENES LOCATED ON RNA 2.....31
  5. 5. Sommaire______________________________________________________________________CHAPITRE 2 : ETUDE DE LA PROTEINE P14 CODEE PARLORF 3 PROXIMALE DU RNA 2 DU BNYVV............................................................ 41I-Mise en évidence du rôle de la protéine P14 dans le cycle de multiplication duBNYVV. ................................................................................................................................ 41 1-Des mutations introduites dans le gène VI du RNA 2 engendrent une diminution du taux de réplication des RNA viraux. (publication n°1).....................41 2-La protéine P14 joue un rôle en cis dans la réplication du RNA 2 et active en trans la synthèse de la protéine de coque. (publication n°2) ..................................... 48 3-Mode daction de la protéine P14. .......................................................................... 54II-Mise en évidence de limportance des résidus cystéines 69, 72, 106 et 109 danslactivité de la protéine P14.................................................................................................... 60 1-Construction de mutants alanine (Giesman-Cookmeyer & Lommel, 1993). .........62 2-Propriétés biologiques des mutants alanine............................................................62III-Mise en évidence dinteractions protéine P14-acides nucléiques. .................................... 65 1-Clonage du gène VI dans le vecteur pET. .............................................................. 65 2-Purification partielle de la protéine P14 par chromatographie daffinité sur une colonne "Zinc Chelate Affinity Adsorbent" (ZCAA). ............................................... 67 3-Mise en évidence dinteractions protéine P14-acides nucléiques par la technique de "Northwestern" (Gramstat et al, 1990). ................................................69IV-Conclusion ....................................................................................................................... 69Publication n°2 : THE SMALL CYSTEIN-RICH PROTEIN P14 OF BEET NECROTICYELLOW VEIN VIRUS REGULATES ACCUMULATION OF RNA 2 IN CIS ANDCOAT PROTEIN IN TRANS................................................................................................. 73CHAPITRE 3 : DES RNA 2 DEFECTIFS SONT CAPABLES DINHIBER LAREPLICATION DU BNYVV ............................................................................................. 103 I-Rappel sur les stratégies de lutte antivirale par transgénose : expression de séquences dérivées du pathogène............................................................................... 103 II-Obtention de RNA défectifs artificiels du BNYVV : leur effet sur la réplication du virus. ................................................................................................... 109 2
  6. 6. Sommaire______________________________________________________________________ 1-Obtention de RNA défectifs.................................................................... 109 2-Seules les délétions introduites dans le RNA 2 produisent des RNA ayant un effet Défectif Interférant........................................................................ 109 3-Analyse de leffet DI en fonction de la quantité de RNA DI utilisée et du temps. ......................................................................................................... 110 4-Analyse dans les plantes de leffet DI des différents mutants du RNA 2.112 III-Conclusions et perspectives. .................................................................................113Publication n°3 : ARTIFICIAL DEFECTIVE INTERFERING RNAs DERIVED FROMRNA 2 OF BEET NECROTIC YELLOW VEIN VIRUS .....................................................115CHAPITRE 4 : MISE EN EVIDENCE DUNE ACTIVITE PROTEOLYTIQUEASSOCIEE A LA PROTEINE P237 CODEE PAR LE RNA 1 DU BNYVV. ...............125 I-Les protéases dorigine virale et leurs caractéristiques ............................................127 1-Généralités sur les protéases. .................................................................. 127 2-Exemples de protéines virales présentant une activité protéasique ........ 130 II-Cas du BNYVV......................................................................................................131 1-Comparaison de séquences avec des domaines protéases dautres phytovirus................................................................................................... 131 2-Mise en évidence dune activité protéase associée à la protéine P237.... 134 III-Conclusions :.........................................................................................................135CONCLUSION ....................................................................................................................137 MATERIEL ET METHODESA-AMPLIFICATION, EXTRACTION ET MODIFICATIONS DE DNAPLASMIDIQUE...................................................................................................................141I-Souches bactériennes, vecteurs de clonage ou dexpression et milieux de culture. ............141 1-Souches bactériennes .............................................................................................141 2-Vecteurs .................................................................................................................143 3
  7. 7. Sommaire______________________________________________________________________ 3-Milieux. .................................................................................................................. 146II-Transformation des souches bactériennes et mise en culture. ........................................... 146 1-Utilisation de Chlorure de Calcium........................................................................ 146 2-Transformation par électroporation ........................................................................ 147 3-Caractérisation des clones par hybridation in situ. ................................................. 148III-Extraction et analyse de DNA plasmidique......................................................................148 1-Minipréparation et maxipréparation ....................................................................... 148 2-Analyse. ..................................................................................................................150IV-Préparation de DNA plasmidique simple brin uridylé et mutagénèse dirigée selon laméthode de Kunkel . .............................................................................................................. 152 1-Culture. ................................................................................................................... 152 2-Purification du DNA simple brin. ..........................................................................152 3-Mutagénèse dirigée en utilisant des oligonucléotides modifiés (Zoller & Smith, 1982). .........................................................................................................................152V-Techniques de sous clonage par lutilisation denzymes.................................................... 153 1-Digestion enzymatique. .......................................................................................... 153 2-Obtention dextrémités franches. ............................................................................ 154 3-Déphosphorylation..................................................................................................155 4-Phosphorylation. ..................................................................................................... 156 5-Ligation................................................................................................................... 156VI-Amplification dun fragment de DNA par la technique de la PCR. .................................157 1-Principe de la méthode et conditions générales...................................................... 157 2-Cas particulier du RNA 2 du BNYVV. .................................................................. 158VII-Purification sur gel dagarose dun fragment de DNA obtenu par digestionenzymatique ou par PCR. ...................................................................................................... 158 1-Par électroélution....................................................................................................158 2-Par extraction dun gel LMP. ..................................................................................159VIII-Séquençage selon la méthode de Sanger, modifiée pour la T7 DNA polymérase.........159 1-Séquençage dun DNA plasmidique. ...................................................................... 159 4
  8. 8. Sommaire______________________________________________________________________ 2-Séquençage dun produit PCR.................................................................................160IX-Transcription in vitro........................................................................................................161 1-Obtention de transcrits infectieux du BNYVV.......................................................161 2-Synthèse de sondes ribonucléiques.........................................................................163X-Analyse des transcrits par hybridation in situ ....................................................................163 1-Séparation des RNA par migration sur gel dagarose en conditions dénaturantes................................................................................................................163 2-Hybridation avec des sondes spécifiques radioactives. ..........................................165XI-Analyse de la descendance par réverse transcription........................................................166B-EXPRESSION IN VIVO OU TRADUCTION IN VITRO DES PROTEINES DEBNYVV .................................................................................................................................167I-Expression de protéines dans un système bactérien (Studier et al, 1990)...........................167II-Purification par chromatographie daffinité sur une colonne ZCAA (Zinc ChelateAffinity Adsorbent)................................................................................................................167III-Traduction in vitro dans un système acellulaire de réticulocytes de lapins. .....................168 1-Préparation du lysat de réticulocytes de lapins. ......................................................168 2-Traduction des produits de transcriptions...............................................................169IV-Analyse. ............................................................................................................................169 1-Par électrophorèse en conditions dénaturantes sur gel de polyacrylamide. ............169 2-Par immunorévélation après transfert. ....................................................................170V-Etude de lactivité fixatrice dune protéine par northwestern. (Gramstat et al, 1990)........173C-MULTIPLICATION DU VIRUS DANS UNE PLANTE HOTE :CHENOPODIUM QUINOA. ...............................................................................................173I-Plante hôte. ..........................................................................................................................173II-Préparation du virus. ..........................................................................................................174III-Extraction de RNA viraux à partir de feuilles de C. quinoa.............................................174 1-En présence de tampon "polysome" (Jackson & Larkins, 1976) ...........................174 5
  9. 9. Sommaire______________________________________________________________________ 2- En présence de tampon Tris-Magnésium. .............................................................175IV-Préparation, inoculation et mise en culture de protoplastes. ............................................176 1-Préparation des protoplastes (Veidt et al, 1992)..................................................... 176 2-Infection des protoplastes par des acides nucléiques (RNA de BNYVV ou DNA plasmidique) et mise en culture........................................................................ 176V-Extraction des RNA viraux de protoplastes. ..................................................................... 177VI-Expression transitoire dans les feuilles de C. quinoa et Nicotiana tabacum. .................. 178 ANNEXESPublication n°4 : IDENTIFICATION AND CHARACTERIZATION OF RESISTANCETO RHIZOMANIA IN AN ECOTYPE OF BETA VULGARIS SUBSP. MARITIMA. ......... 179ABREVIATIONS ..................................................................................................................195REFERENCES BIBLIOGRAPHIQUES............................................................................... 199 6
  10. 10. INTRODUCTION Cest en 1959, dans la vallée du Pô (Italie), que Canova décrit pour la premièrefois des betteraves malades présentant comme symptômes (1) des feuilles gaufrées avecdes tâches jaunes diffuses le long des nervures (voir figure 1-B) ; (2) un pivot de tailleréduite par rapport à celui dune plante saine ; (3) une nécrose des anneaux vasculairesfacilement observable lorsque le pivot est coupé transversalement ; et (4) une abondantebarbe "poivre et sel" due à une prolifération anormale et anarchique des radicelles (voirfigure 1-A). Cette dernière observation, la plus caractéristique, donne son nom à lamaladie : la rhizomanie, ce qui signifie étymologiquement "démence des racines" (rhizo= racines ; mania = folie) (voir figure 1-A). Cette maladie a ensuite été décrite au Japonen 1965 et fait son apparition en France, plus précisément en Alsace, dans les années 70(Putz et Vuittenez, 1974). La rhizomanie engendre une perte considérable dans lerendement en sucre qui passe de 18 à 8%, rendant lexploitation impropre. Dès 1966, Canova suggère que la maladie est due à un champignon du sol :Polymyxa betae. Cest un champignon inférieur, à zoospores biflagellées, parasiteintracellulaire des racines de betteraves. Il appartient à la classe des Myxomycètes et àlordre des Plasmodiophorales (Chadefaud & Emberger, 1942). Les spores de résistancese trouvant dans un sol contaminé vont germer et libérer des zoospores qui se déplacentvers les radicelles dune betterave, la propulsion se faisant grâce au mouvementcoordonné des 2 flagelles de la zoospore. Lorsque le contact avec une radicelle a lieu,les flagelles disparaissent et la zoospore déverse son contenu cellulaire dans la cellulehôte. Après 16 heures, on peut déjà observer un jeune plasmode qui va se différencier en
  11. 11. Introduction______________________________________________________________________ABFigure 1 : Sym ptômes de la rhizomanie : (A) photo représentant des betteraves saines (à gauche) et rhizom aniées (à droite).(Photo fournie par lINRA de Colm ar). (B) Photo montrant les sym ptômes foliaires qui ont donné leur nom au virus. 8
  12. 12. Introduction______________________________________________________________________ Figure 3 : Cycle de Polymyxa betae (daprès Keskin, 1967) 9
  13. 13. Introduction______________________________________________________________________zoosporange ou en cystosore (Keskin, 1964 et 1967) (voir figure 3). Ce nest quen 1973 que Tamada et Baba démontrent que lagent responsable de larhizomanie est un virus : le beet necrotic yellow vein virus ou virus des nervures jauneset nécrotiques de la betterave (encore appelé BNYVV) ; ceci fut confirmé par Fujisawaet Sugimoto en 1977. Le champignon Polymyxa betae, quant à lui, est seulementimpliqué dans la transmission du BNYVV (Fujisawa & Sugimoto, 1976). Enfin, lespremières études au plan moléculaire furent initiées en 1983 (Putz et al, 1983) etdémarrèrent vraiment en 1985 (Richards et al, 1985). Le virus des nervures jaunes et nécrotiques de la betterave est un phytovirus (Putz,1977) appartenant à la famille des furovirus (fungus rod-shaped virus) (Brunt &Richards, 1989 ; Brunt, 1991). Son génome est composé de 4 RNA (voir figure 4) depolarité positive coiffés à leur extrémité 5 et polyadénylés à leur extrémité 3. Ces 4RNA sont encapsidés dans des particules virales de taille variable (390 nm, 265 nm, 100nm et 89 nm) et de symétrie hélicoïdale avec un diamètre constant de 20 nm. Danscertains isolats japonais, un 5ème RNA, de fonction inconnue, a été décrit (Tamada et al,1989). Les RNA 1 et 2 sont nécessaires à la réplication, lencapsidation et le mouvementde cellule à cellule du virus. Ils sont donc suffisants pour provoquer un processusinfectieux quand ils sont inoculés mécaniquement à des feuilles de Chenopodiumquinoa, une plante hôte (voir figure 2-B). Les RNA 3 et 4 restent cependant essentielslors de linfection naturelle des racines de betterave par lintermédiaire du champignonvecteur. Le RNA 1 (6746 nt) code pour une protéine de poids moléculaire 237 kDarenfermant les séquences consensus des méthyltransférase, hélicase (GKS) etpolymérase (GDD) (Bouzoubaa et al, 1987). Dautre part, comme nous le verrons dansle chapitre IV, la protéine P237 contient une séquence caractéristique des protéases detype papaïne (Koonin & Dolja, 1993 ; Rozanov et al, 1995) localisée entre le domainehélicase et le domaine polymérase. Le RNA 1 est capable de sautorépliquer lorsquil estinoculé seul à 10
  14. 14. Introduction______________________________________________________________________ P 237 GKS GDD RNA 1 MTR HEL PRO POL AAA ? ? ? P75 TGB CP P13 P14 RNA 2 GKS AAA UAG 15 K P42 RNA Subgénomique P25 P31 4.6 K RNA 3 AAA RNA 4 AAA N Fonctions dans le cycle de multiplication. Mouvement de Réplication Transmission cellule à cellule Encapsidation Symptomatologie et Régulation de la amplification du réplication et de la virus dans les racines traduction Inconnue Figure 4 : Organisation génétique du virus des nervures jaunes et nécrotiques de la betterave ou BNYVV et fonctions associées aux protéines codées par les différents RNA génomiques. 11
  15. 15. Introduction______________________________________________________________________des protoplastes de cellules de mésophylle de C. quinoa (voir figure 5) (Bouzoubaa &Scheidecker, 1990 ; Gilmer et al, 1992). Le RNA 2 (4612 nt) présente une organisation génétique plus complexe avec 6phases de lecture ouverte (ORF). La première ORF dirige la synthèse de la protéine decapside (CP) dun poids moléculaire de 21 kDa. La protéine de translecture de 75 kDaobtenue par suppression du codon stop UAG de la première ORF (Ziegler et al, 1985 ;Bouzoubaa et al, 1986), joue un rôle dans linitiation de lencapsidation (Schmitt et al,1992), dans la transmission du virus par le vecteur (Tamada & Kusume, 1991) et a étévisualisée par microscopie électronique à lune des extrémités des particules virales(Haeberlé et al, 1994). Les 3 ORF chevauchantes III, IV et V sont regroupées sous leterme de "triple gene block" (ou TGB). Une organisation génétique analogue a étédécrite pour dautres furovirus (Herzog et al, 1994 ; Scott et al, 1994) mais égalementchez des virus comme les carlavirus, les hordeivirus et les potexvirus (Morozov et al,1989). Ces 3 ORF du BNYVV codent respectivement pour des protéines potentielles depoids moléculaire 42, 13 et 15 kDa. La protéine P42 dispose dune séquence consensusGKS caractéristique dune activité NTP-binding souvent associée aux hélicases et a étémise en évidence, ainsi que la protéine P13, dans les fractions membranaires préparées àpartir de feuilles de C. quinoa infectées par le virus (Niesbach-Klösgen et al, 1990). Enrevanche, la protéine P15 na pas encore été détectée in planta. Enfin, lORF 3proximale du RNA 2 code pour une protéine de 14 kDa riche en cystéine et qui a étélocalisée dans la fraction cytosolique de feuilles infectées (Niesbach-Klösgen et al,1990). Cette protéine, comme nous le verrons ultérieurement (voir chapitre 2), joue unrôle dans la régulation de linfection virale. Le RNA 3 (1773 nt) code pour une protéine de 25 kDa impliquée dans lamultiplication virale au niveau des racines de betteraves infectées (Koenig et al, 1986 ;Lemaire et al, 1988 ; Tamada & Abe, 1989) ainsi que dans la symptomatologie auniveau des feuilles (Jupin et al, 1992). Une étude immunocytochimique récente montreque la protéine P25 est synthétisée très tôt dans le cycle viral ; de plus elle est détectée à 12
  16. 16. Introduction______________________________________________________________________la fois dans le cytoplasme et dans le noyau des cellules infectées (Haeberlé & Stussi-Garraud, 13
  17. 17. Introduction______________________________________________________________________ Figure 4 : Protoplastes préparés à partir de cellules de mésophylle de Chenopodium quinoa dans les conditions décrites dans Matériel et méthodes. 14
  18. 18. Introduction______________________________________________________________________1995). Une seconde ORF, lORF N, est exprimée lorsque des délétions dans le gènecodant pour la protéine P25 rapprochent lAUG initiateur de cette petite ORF de laséquence 5 non codante (Jupin et al, 1990). Lexpression de la protéine très hydrophobecodée par ce gène N entraîne lapparition de lésions nécrotiques sur les feuilles desplantes hôtes infectées. Enfin, une troisième ORF a été mise en évidence et code pourune protéine potentielle de 4,6 kDa qui serait exprimée à partir dun RNA subgénomiquedétecté dans les feuilles infectées et qui est redondant avec les 545 derniers nucléotidesdu RNA 3 (Bouzoubaa et al, 1991). Le rôle de ce peptide est actuellement en cours decaractérisation au laboratoire. Des résultats préliminaires montrent que des délétionsréalisées dans cette ORF inhibent le mouvement à longue distance du virus dans Betamacrocarpa (Tamada, communication personnelle) alors que des mutations ponctuellesintroduisant des codons de terminaison restent sans effet (Guntz-Lauber, communicationpersonnelle). Cette observation semble indiquer que cest la séquence nucléotidique dece RNA subgénomique qui est directement impliquée dans ce phénomène de transport àlongue distance et non pas son produit dexpression. Le RNA 4 (1467 nt) code pour une protéine de 31 kDa (Bouzoubaa et al, 1985)qui joue un rôle prépondérant dans la transmission du virus par le vecteur fongique(Koenig & Burgermeister, 1989 ; Tamada & Abe, 1989). Mon travail de thèse a consisté plus particulièrement à caractériser le rôle desproduits des gènes 3 proximaux du RNA 2. Pour cela nous disposions au laboratoiredes clones cDNA complets des 4 RNA viraux (Quillet et al, 1989) permettant dobtenirdes transcrits infectieux. A partir de ces clones, nous avons construit des mutantsponctuels ou des mutants de délétion dans lune ou lautre des séquences codantes, puisnous avons étudié in vivo leffet de ces modifications. Ainsi, dans le premier chapitre,jaborderai les problèmes du mouvement du virus de cellule à cellule et je démontreraique les protéines codées par les trois cistrons du triple gene block sont impliquées dansce processus. Dans le chapitre 2, je présenterai les résultats concernant le rôle de laprotéine P14, codée par lORF VI du RNA 2, dans la réplication et dans la traduction du 15
  19. 19. Introduction______________________________________________________________________RNA 2. Le 3ème chapitre traitera des stratégies antivirales qui peuvent être envisagéespour bloquer la réplication du BNYVV. Jy montrerai comment nous avons obtenu desRNA défectifs interférants (ou RNA DI) à partir du RNA 2, RNA DI que lon peutenvisager dutiliser comme outil de lutte contre ce virus. Enfin dans le chapitre IV, jedécrirai des résultats préliminaires qui permettent daffirmer que la protéine P237, codéepar le RNA 1, est une polyprotéine susceptible dêtre maturée au cours du cycle demultiplication virale par une activité protéasique associée à cette polyprotéine. 16
  20. 20. CHAPITRE 1 : LES PROTEINES EXPRIMEES A PARTIR DU "TRIPLE GENE BLOCK" (TGB) SONT DIRECTEMENT IMPLIQUEES DANS LE MOUVEMENT DU VIRUS DE CELLULE A CELLULE. Linfection dune plante par un virus à RNA passe, en général, par quatre étapesmajeures. Dans un premier temps le virus doit pénétrer dans les cellules de lhôte. Cetteinfection peut se faire par inoculation mécanique en provoquant une lésion au niveaudes tissus de la plante ; elle peut également sétablir par lintermédiaire dun vecteur(aphide, nématode, champignon). Quand il est en place, le virus doit pouvoir semultiplier, multiplication qui sous entend la décapsidation du ou des RNA génomiquesprovenant de linoculum, leur traduction, leur réplication et finalement lencapsidationdes RNA néosynthétisés. Dans un troisième temps, le virus est amené à quitter le sitedinfection pour migrer dans les cellules voisines. Finalement quand il atteint lesvaisseaux conducteurs, il va pouvoir infecter le reste de la plante provoquant ainsi uneinfection systémique. La spécificité dinfection dun virus pour un hôte particulierconsiste donc à pouvoir réaliser toutes ces étapes.
  21. 21. Résultats______________________________________________________________________ Protéines de mouvement Paroi cellulaire Type TMV Réplication du virus ? protéines ? cellulaires RNA viral diffusion de néosynthétisé ? linfection virale Protéines de Type Protéines de mouvement CPMV coque Figure I-1 : Représentation schématique des 2 types de stratégies qui semblent se dégager des études effectuées sur le mouvement de cellule à cellule des virus de plantes. Le premier mécanisme fait appel à une protéine de mouvement qui augmente la limite dexclusion des plasmodesmes et qui permet une linéarisation des RNA viraux qui pourront ainsi diffuser sous forme de complexe ribonucléoprotéique. Cette stratégie est adoptée par le TMV. Le second mécanisme engendre une modification irréversible des plasmodesmes avec la présence de particules virales à lintérieur de microtubules (cest le cas du CPMV). 18
  22. 22. Chapitre 1______________________________________________________________________ Avant de présenter les résultats obtenus dans létude des gènes responsables de ladiffusion du BNYVV, je voudrais rappeler brièvement ce que lon sait sur les différentsmécanismes de diffusion de cellule à cellule de linfection virale.I-Etat des connaissances sur les mécanismes de transport des virus. En raison de la présence de la paroi pectocellulosique qui entoure chaque cellulevégétale, les possibilités de mouvement du virus de cellule à cellule sont très restreintes.Le seul passage possible est représenté par les plasmodesmes qui sont descommunications intercellulaires assurant une continuité cytoplasmique entre 2 celluleset permettant ainsi des échanges de métabolites. Des études par micro injection demolécules fluorescentes de taille variable dans les cellules végétales ont permis demettre en évidence la limite dexclusion moléculaire (SEL ou Size Exclusion Limit) desplasmodesmes. Elle se situe entre 0,7 et 1 kDa ce qui correspond à peu près à undiamètre de 1,5 à 2 nm. (Goodwin, 1983 ; Tucker, 1982). Bien que la SEL soit relativement petite, Esau a montré, dès 1967, la présence devirus de la jaunisse de la betterave (BYV) au niveau des plasmodesmes de plantesinfectées. Or le diamètre de ces virus à symétrie hélicoïdale est voisin de 10 nm, soitcinq fois supérieure à la SEL. Dautres virus à symétrie hélicoïdale tels que le potatovirus X (ou PVX) (Allison & Shalla, 1974) et le barley stripe mosaic virus (ou BSMV)(Mc Mullen et al, 1977), ainsi que des virus à symétrie icosaédrique comme leslutéovirus (Gill & Chong, 1975 ; DArcy & De Zoeten, 1979) et les népovirus (DeZoeten & Gaard, 1969) ont pu être observés au niveau de ces structures. Compte tenu deleur SEL, il est évident que les plasmodesmes doivent donc subir des modificationsstructurales pour permettre le passage de ces virus (Robards & Lucas, 1990). A lheure actuelle, 2 mécanismes majeurs (figure I-1) semblent être mis en jeudans la diffusion de linfection virale à savoir le mécanisme utilisé par le virus de lamosaïque du tabac (ou TMV) et dautres tobamovirus et la stratégie employée par lescomovirus, les népovirus et les caulimovirus. 19
  23. 23. Résultats______________________________________________________________________1-Stratégie utilisée par les tobamovirus. Les résultats majeurs ont été obtenus avec le TMV qui fut pendant longtemps lephytovirus le plus étudié sur le plan physico-chimique et biologique. Il code notammentpour une protéine de 30 kDa essentielle au mouvement du virus de cellule à cellule(Leonard & Zaitlin, 1982 ; Meshi et al, 1987). Des études par microscopie électroniqueont permis de montrer que des plantes infectées par ce virus ont des plasmodesmesayant une SEL supérieure à celle dune plante saine. Elle passe de 1,5 nm à 5-6 nm. Desplantes transgéniques exprimant la protéine P30 de manière constitutive présententmême une SEL de 6 à 9 nm (Deom et al, 1990 ; Wolf et al, 1989). La protéine P30 a puêtre localisée au niveau de ces plasmodesmes (Ding et al, 1992 ; Atkins et al, 1991 ;Moser et al, 1988, Tomenius et al, 1987) sans pour autant en modifier la structure(Shalla et al, 1982). Cette augmentation de la SEL nest pourtant pas suffisante pourpermettre le passage du TMV dune cellule à une autre, les particules virales en bâtonnetayant un diamètre moyen de 18 nm et lencombrement moyen dune molécule de RNAétant de 10 nm (Gibbs, 1976). La protéine P30 a également la propriété de fixer lesacides nucléiques (Citovsky et al, 1990). Ces propriétés ont donc amené Citovsky etcollaborateurs (1992) à proposer un modèle dans lequel la protéine P30 joue un rôledouble dans le mécanisme de mouvement : (1) elle augmente la SEL des plasmodesmesdun facteur 3 à 4 et (2), en se fixant au RNA, elle lui confère une structure déroulée quilui permet de passer au travers des plasmodesmes. Ceci sous-entend que le mouvementde cellule à cellule se fait sous forme de complexe ribonucléoprotéique sans interventionde la protéine de capside. Lintervention de facteurs cellulaires na pas encore étédémontrée pour le moment.2-Stratégie utilisée par les comovirus, les népovirus et les caulimovirus. Ce second mécanisme a été plus particulièrement étudié pour un comovirus : lecowpea mosaic virus (ou CPMV), un virus à génome bipartite qui exprime soninformation sous forme de polyprotéines qui sont ensuite maturées. Linformationgénétique de ce virus est portée par 2 RNA génomiques. Le B-RNA dispose de 20
  24. 24. Chapitre 1______________________________________________________________________linformation nécessaire et suffisante à la réplication car il est capable de sauto répliquerdans les protoplastes (Goldbach et al, 1980). Par contre, en labsence du M-RNA, levirus nest pas capable dinduire une infection dans la plante. Une analyse détaillée amontré que non seulement les protéines 48K/58K, dont linformation est portée par larégion 5 terminale du M-RNA, sont nécessaires au mouvement de cellule à cellule(Rezelman et al, 1982), mais également les protéines de capsides VP37 et VP23. Lesprotéines non structurales 48/58 K ont été localisées au niveau de structures tubulairesdans les plasmodesmes de plantes infectées (Van Lent et al, 1990) : ces structuresmodifient les plasmodesmes de façon irréversible et renferment des particules virales.Ces tubules peuvent également être observées au niveau de la membrane de protoplastesinfectés (Van Lent, 1991). Enfin, plus récemment, grâce à des expériences dexpressiontransitoire, il a été possible de démontrer que la protéine de 48 K était, dune part, laprotéine de mouvement et, dautre part, la seule protéine virale responsable de laformation in vivo de ces tubules (Kasteel et al, 1993 ; Wellink et al, 1993). Cependant,comme dans le cas de la stratégie utilisée par les tobamovirus, la participation deprotéines cellulaires ne peut être exclue à lheure actuelle. La formation de tubules et la présence de particules virales à lintérieur de cesstructures ont également été observées pour dautres types de virus comme leuphorbiamosaic virus (EMV), un géminivirus (Kim & Lee, 1992), le cauliflower mosaic virus(CaMV), un caulimovirus (Stussi-Garraud et al, 1994), le tomato spotted wilt virus(TSWV), un tospovirus (Kormelink, 1994) et le grapevine fanleaf virus (GFLV), unnépovirus (Ritzenthaler et al, 1995).3-Stratégie utilisée par les hordeivirus, les potexvirus et les furovirus. Enfin dautres virus utilisent une stratégie de mouvement qui nécessite la synthèsede 3 protéines à partir de 3 gènes regroupés en triple gene block, mais, à lheure actuelle,le mécanisme mis en oeuvre nest pas encore élucidé. Cette stratégie est utilisée par le 21
  25. 25. Résultats______________________________________________________________________ BNYVV RNA 1 A CP RNA 2 A TGB RNA 3 A RNA 4 A WClMV CP A TGB BSMV RNA α AA RNA ß CP AA TGB RNA γ AA Figure I-2 : Organisation génétique du BNYVV, du WClMV et du BSMV. Domaine hydrophobe Séquence GDD caractéristique des polymérases virales Séquence GKS, site de fixation de nucléotides triphosphates CP Protéine de capside TGB Triple Gene block impliqué dans le mouvement du virus de cellule à cellule Protéine jouant un rôle dans la réplication du virus 22
  26. 26. Chapitre 1______________________________________________________________________BSMV) (Petty et al, 1990), un hordeivirus et le white clover mosaic virus (WClMV)(Beck et al, 1991), un potexvirus. Le BNYVV fait appel également à un ensemble de 3gènes pour assurer la fonction de transport. Les ressemblances entres ces 3 virus nesarrêtent pas là ; il faut également noter des homologies de séquences importantes entreces protéines, plus particulièrement au niveau des protéines codées par les 2 premiersgènes du TGB (Figure I-2).II-Rôle du Triple Gene Block dans le mouvement de cellule à cellule du BNYVV. Linoculation mécanique de feuilles de Chenopodium quinoa par des transcrits duRNA 1 et du RNA 2 provoque des lésions chlorotiques localisées. Les RNA 1 et 2 duBNYVV sont donc nécessaires et suffisants aux fonctions de base du virus, à savoir laréplication, lencapsidation et le mouvement de cellule à cellule de linfection virale. Les ORF III, IV et V du RNA 2 du BNYVV sont organisées en triple gene block.La protéine P42 exprimée à partir de lORF III renferme une séquence GKS souventassociée aux hélicases. Les protéines P13 et P15 codées respectivement par les ORF IVet V contiennent des domaines hydrophobes. Les protéines P42 et P13 ont été localiséesau niveau de fractions membranaires dans des plantes infectées (Niesbach-Klösgen et al,1990).1-Le Triple Gene Block du BNYVV est impliqué dans le mouvement du virus decellule à cellule. a-Construction de mutants du TGB. Pour tous les RNA génomiques, nous disposons de clones cDNA complets à partirdesquels il est possible de synthétiser in vitro des transcrits qui se sont révélés êtreinfectieux lors dune inoculation mécanique de feuilles de C. quinoa. Partant de cesconstructions, nous avons pu réaliser des modifications au sein des RNA génomiques 23
  27. 27. Résultats______________________________________________________________________ CP RNA 2 A TGB mutant H A sauvage ACA CTA GTA GAG mutant ACA CTA GCT AGT mutant I A sauvage AT AGA G mutant AT AAC TCG mutant J A sauvage AGG AAT TCG mutant AGG AAT T AA TTC GFigure I-3 : Localisation des mutations introduites dans le triple gene block (TGB) du RNA 2 du BNYVV. Les sites de restriction utilisés pour introduire les modifications (Spe I pour le mutant H et Eco RI pour le mutant J) sont représentés en rouge. Les nucléotides insérés sont soulignés. 24
  28. 28. Chapitre 1______________________________________________________________________afin de pouvoir étudier le rôle des différents gènes. Par mutagénèse dirigée, nous avonsconstruit les mutants décrits figure I-3. Pour obtenir le mutant H, nous avons linéarisé leplasmide pB218 en un site Spe I, puis, par lutilisation du fragment de Klenow de laDNA polymérase, ce site a été rempli, générant ainsi, après religation, un plasmidepB218 ayant une insertion de 4 nucléotides au niveau de lORF III. Lutilisation dunoligonucléotide mutagène nous a permis dinsérer 4 nucléotides (ACTC) dans le gène IVet dobtenir ainsi le mutant I. Enfin, pour construire le mutant J, il nous a fallu faire unedigestion partielle Eco RI du plasmide pBF14 suivie dun remplissage du site derestriction par le fragment de Klenow de la DNA polymérase. Après ligation, le cloneobtenu dispose dune insertion de 4 nucléotides. Pour tous les mutants décrits ci dessus,linsertion de 4 nucléotides génère un changement du cadre de lecture, lapparition duncodon stop et donc la synthèse de protéines tronquées non fonctionnelles. b-Etude de leffet des mutations introduites dans le TGB. Afin de vérifier si les protéines codées par le TGB jouent un rôle dans laréplication, les transcrits correspondants à ces différents mutants ont été coinoculés avecdu RNA 1 (nécessaire à la réplication) à des protoplastes de C. quinoa. Après 48 heuresde culture, les RNA totaux ont été extraits puis analysés par hybridation moléculaire enutilisant des sondes spécifiques des RNA 1 (pB12 : nt 4740 à 6560) et 2 (pB21 : nt 2335à 3793). Nous avons ainsi pu constater quen labsence des protéines P42 (mutant H),P13 (mutant I) et P15 (mutant J) fonctionnelles le virus était encore capable de serépliquer (voir publication 1, figure 4, pistes 2, 3 et 4). Les mutations introduites dansces 3 gènes naltèrent donc pas une structure impliquée en cis dans la reconnaissance parle complexe de réplication. Pour tester limpact des modifications introduites dans le TGB sur la diffusion delinfection virale, les différents mutants ont ensuite été transcrits et coinoculés avec duRNA 1 à des feuilles de C. quinoa. Une semaine après linfection, alors quil apparaît 25
  29. 29. Résultats______________________________________________________________________des symptômes chlorotiques classiques sur les feuilles inoculées par du RNA 1 et 2sauvage, P75 CP 54 kDa P13 P14 RNA 2 A 4,6 kb P42 P15* TGB nt 2324-3789 pB21 A nt 638 à nt 3949 à 2081 ² BB nt 2078 à 4481 ² AS 2715 218Bg 2 sub c A 0,7 kb B 2 sub b A 1,4 kb 2 sub a A 2,6 kb Figure I-4 : Localisation (A) des sondes riboprobes utilisées pour la mise en évidence des RNA subgénomiques (B). (* le produit dexpression du gène V na jamais pu être détecté in vivo). 26
  30. 30. Chapitre 1______________________________________________________________________les feuilles inoculées en présence des mutants du TGB ne présentent pas de lésions.Lanalyse par hybridation moléculaire des RNA extraits de ces feuilles ne permet pas demettre en évidence de RNA viral (Voir publication 1, figure 2, pistes 3, 4 et 5). On peutdonc conclure que les protéines du TGB sont toutes les 3 essentielles au mouvement decellule à cellule de linfection virale. En absence de mouvement, il est impossible dedétecter une infection qui reste limitée aux seules cellules initialement infectées.2-Les protéines P42 et P13 du Triple Gene Block sont exprimées à partir de RNAsubgénomiques. Pour exprimer des protéines codées par des cistrons internes dun RNAgénomique, les virus de plantes ont élaboré de nombreuses stratégies comme : (1) lemécanisme de "terminaison-réinitiation" où les ribosomes, après avoir traduit une ORFglissent sur le messager jusquà ce quils rencontrent un nouvel AUG initiateur (Kozak,1989) ; (2) le "leaky scanning" où les ribosomes initient la traduction au niveau dupremier AUG, mais également au niveau dun autre AUG plus en aval si le premierAUG nest pas dans un contexte favorable (Kozak, 1989) ; (3) le mécanisme "dentréeinterne" quand les ribosomes reconnaissent une séquence au sein dun RNA génomique(Pelletier & Sonnenberg, 1988) ; (4) la translecture obtenue par suppression dun codonstop (Ziegler et al, 1985) ; (5) le changement de cadre de lecture ou frame shift (Brault& Miller, 1992), enfin (6) lutilisation de RNA subgénomiques où le gène à exprimer setrouve localisé à lextrémité 5 du RNA messager. Pour mettre en évidence la présence de RNA subgénomiques correspondant auxcistrons 3 proximaux du RNA 2, nous avons inoculé des feuilles de C. quinoa ou uneautre plante hôte Tetragonia expansa avec du BNYVV isolat Stras 12 contenant lesRNA 1 et 2. Lorsque les lésions apparaissent, les RNA totaux sont extraits puis analyséspar hybridation moléculaire en utilisant des sondes ribonucléiques correspondant à desséquences internes du RNA 2 (figure I-4). Lutilisation dune sonde ∆AS correspondant àlextrémité 3 terminale du RNA 2 (nt 3949 à 4481) nous a permis de mettre en évidence4 bandes ayant une taille de 0,7 kb pour le RNA 2sub c, 1,4 kb pour le RNA 2sub b, 27
  31. 31. Résultats______________________________________________________________________2,6 kb pour le RNA 2sub a et enfin 4,6 kb pour le RNA 2 complet (voir publication 1,figure 5, piste 4). Lorsque lon utilise dautres sondes, seule lune ou lautre de ces bandesapparait après autoradiographie. Ainsi la sonde 218Bg (nt 2078 à 2715) ne révèle que leRNA 2sub a et le RNA 2. Enfin la sonde ∆BB (nt 638 à 2081) ne shybride quau RNAgénomique. La taille de ces différents RNA subgénomiques correspond aux taillesattendues pour des RNA permettant lexpression de la protéine P42 (RNA 2sub a), de laprotéine P13 (RNA 2sub b) et de la protéine P14 (RNA 2sub c). Pour la protéine P15, aucun RNA subgénomique na pu être mis en évidence. Pourexpliquer cela, 2 hypothèses peuvent être émises : soit la synthèse du RNAsubgénomique est très faible, soit la protéine P15 est exprimée sous forme duneprotéine de fusion P13-P15. Ceci impliquerait alors un changement de cadre de lecturede lORF IV. Dans ce cas, la synthèse de la protéine P13-P15 se ferait à un taux trèsfaible, ce qui expliquerait pourquoi elle na pas encore pu être détectée in vivo enutilisant un sérum anti P13.III-Conclusions et perspectives. Nous avons montré dans ce chapitre que les protéines exprimées à partir du TGBétaient toutes les 3 essentielles au mouvement du virus de cellule à cellule. En leurabsence, linfection dune plante ne peut avoir lieu. Nous avons également montré quelexpression de 2 des 3 protéines au moins se faisait à partir de RNA subgénomiques.Ces résultats vont dans le sens dobservations faites pour dautres virus comme leWClMV, un potexvirus (Beck et al, 1991) et pour le BSMV, un hordeivirus (Petty et al,1990). Des études ont été entreprises au laboratoire, afin de mieux comprendre le rôle deces 3 protéines dans le mouvement de cellule à cellule. Les résultats préliminairesindiquent que la protéine P42 est dotée dune activité ATP binding à limage de laprotéine de 58 K codée par le RNA ß du BSMV (Jackson et al, 1991). Enfin, commedans le cas de la protéine de coque dAMV (Baer et al, 1994), il semblerait que 28
  32. 32. Chapitre 1______________________________________________________________________lextrémité N-terminale de la protéine P42 soit indispensable à lactivité de fixation desacides nucléiques (C. Bleykasten, communication personnelle). Des études dinteractionentre les 3 protéines du TGB ont également été initiées en utilisant la technique "doublehybride" (Hope & Struhl, 1986 ; Keegan et al, 1986 ; Ma & Pasthne, 1987). En effet, lesprotéines P13 et P42 ont été retrouvées au niveau de fractions membranaires (Niesbach-Klösgen et al, 1990). Or, seule la protéine P13 est dotée de régions hydrophobespouvant faciliter lancrage au niveau des membranes. Pour expliquer la colocalisationmembranaire de la protéine P42, on peut donc imaginer des interactions entre cetteprotéine et la protéine P13. 29
  33. 33. Résultats______________________________________________________________________ 30
  34. 34. Publication n°1EFFICIENT CELL TO CELL MOVEMENT OF BEET NECROTIC YELLOW VEIN VIRUS REQUIRES 3 PROXIMAL GENES LOCATED ON RNA 2 D. Gilmer, S. Bouzoubaa, A. Hehn, H. Guilley, K. Richards and G. Jonard. Virology (189, 40-47) (1992)
  35. 35. Résultats______________________________________________________________________ 32
  36. 36. Publication n°1______________________________________________________________________ 33
  37. 37. Résultats______________________________________________________________________ 34
  38. 38. Publication n°1______________________________________________________________________ 35
  39. 39. Résultats______________________________________________________________________ 36
  40. 40. Publication n°1______________________________________________________________________ 37
  41. 41. Résultats______________________________________________________________________ 38
  42. 42. Publication n°1______________________________________________________________________ 39
  43. 43. Résultats______________________________________________________________________ 40
  44. 44. CHAPITRE 2 : ETUDE DE LA PROTEINE P14 CODEE PAR LORF 3 PROXIMALE DU RNA 2 DU BNYVV.I-Mise en évidence du rôle de la protéine P14 dans le cycle de multiplication duBNYVV.1-Des mutations introduites dans le gène VI du RNA 2 engendrent une diminution dutaux de réplication des RNA viraux. (publication n°1) Dans le chapitre précédent, nous avons montré que les trois protéines codées parle TGB sont nécessaires au mouvement à courte distance du virus. Dans ce deuxièmechapitre, nous allons nous intéresser plus particulièrement au rôle de lORF 3 proximaledu RNA 2 (encore appelée ORF VI) dans le cycle de multiplication du BNYVV. CetteORF code pour une protéine de 14 kDa qui a été localisée par immunochimie au niveaude la fraction cytosolique (Niesbach-Klösgen et al, 1990) et qui est exprimée à partirdun RNA subgénomique, le RNA 2sub c. Pour essayer de mieux comprendre lafonction de cette protéine dans le cycle de multiplication viral, nous avons utilisé lamême approche
  45. 45. Résultats______________________________________________________________________ TGB P75 RNA 2 CP P13 P14 A P42 15 kDa nt 4043 mutant 3722 ATG GAG ATC TGG TAG nt 4043 nt 4078 mutant 4003 GGT TGA TGC nt 4043 nt 4148 mutant 3992 TGG TAA TTG Figure II-1 : Caractéristiques des mutants du RNA 2 nexprimant pas la protéine P14. Les nucléotides introduits dans le génome viral sont écrits en rouge. Les codons stop qui apparaissent sont soulignés. 42
  46. 46. Chapitre 2_____________________________________________________________________que précédemment dans létude du TGB, à savoir lintroduction de mutations dans lORFVI et lanalyse des conséquences au niveau biologique. a-Construction de mutants nexprimant pas la protéine P14. Lintroduction de mutations dans la région 3 proximale du RNA 2 pouvaittoucher des séquences impliquées en cis dans la réplication du RNA 2. Cest pourquoi,pour minimiser ce risque, nous avons multiplié les constructions et réparti les mutationstout au long de la séquence de lORF VI. Deux approches différentes ont été utilisées : lapremière a consisté à insérer un linker Bgl II de 10 nucléotides au niveau du site Sma Isitué en position 4331, entraînant ainsi un changement du cadre de lecture (+1) (voirpublication 1, figure 1) et donnant le mutant RNA 2-L. La seconde approche repose surlintroduction de mutations ponctuelles (figure II-1) dans un fragment correspondant aux824 derniers nucléotides du RNA 2 cloné dans le vecteur Bluescribe. Trois mutants ontainsi été obtenus : (1) le mutant RNA 2-3722 (voir publication 1, figure 1) où 2nucléotides ont été insérés en position 4050 ce qui a pour conséquence déliminer le2ème ATG initiateur et dintroduire un changement du cadre de lecture qui entraînelapparition dun codon stop. (2) Le mutant RNA 2-3992 où la substitution dunnucléotide génère un codon stop en position 4148. (3) Le mutant RNA 2-4003 oùlintroduction dun T en position 4078 fait apparaître un codon de terminaison TAA. Toutes ces mutations entraînent soit labsence de synthèse de protéine P14(mutant 3722), soit conduisent à la synthèse dune protéine P14 plus ou moins tronquée(mutants 3994 et 4003). Le fragment de 824 nt a finalement été réinséré dans le clonecDNA complet du RNA 2. b-Effet in planta des mutations introduites dans le gène VI. Pour analyser les effets des mutations introduites dans le gène VI, les différentsmutants ont été transcrits puis coinoculés avec des transcrits du RNA 1 à des feuilles deC. quinoa. Huit à dix jours après linfection, on voit apparaître des lésions ayant un 43
  47. 47. Résultats______________________________________________________________________phénotype différent de celui des lésions provoquées par lisolat sauvage : ces lésionssont 44
  48. 48. Chapitre 2_____________________________________________________________________A Stras 123 Mutant 2-3722B RN RN RN A A A RN 2- 2- 2- A2 37 39 40 22 92 03 RNA 1 RNA 2 1 2 3 4Figure II-2 : Effets des mutations introduites dans le gène VI. (A) Symptômes observés sur des feuilles de C. quinoa inoculées avec lisolat sauvage et le mutant RNA 2-3722 (B) Analyses par hybridation moléculaire des RNA totaux extraits des feuilles de C. quinoa : sur la piste 1 ont été déposés 1/20 des RNA totaux extraits des feuilles inoculées avec lisolat sauvage Stras 123. Les pistes 2, 3 et 4 correspondent respectivement à la totalité des RNA extraits de feuilles inoculées par les mutants RNA 2-3722, RNA 2-3992 et RNA 2-4003. 45
  49. 49. Résultats______________________________________________________________________petites et nécrotiques en leur centre (figure II-2-A). Afin danalyser la quantité de RNAviral présent dans les feuilles inoculées, nous avons prélevé ces lésions ainsi que leslésions provoquées par les RNA viraux sauvages, en prenant garde de récupérer lamême surface foliaire dans les 2 cas. Les RNA sont extraits en présence de tamponpolysome, comme cela a été décrit dans le chapitre matériel et méthodes. La lecture dela DO260nm permet destimer la quantité de RNA total présent dans lextrait et 300 ngsont déposés sur gel dagarose en conditions dénaturantes. Après transfert sur membranede nitrocellulose, les RNA sont analysés par hybridation moléculaire en utilisant dessondes ribonucléiques spécifiques complémentaires du RNA 1 (pB12 : nt 4740 à 6560)et du RNA 2 (pB21 : nt 2335 à 3793). Quel que soit le mutant analysé, on peut constaterune forte diminution de la quantité de RNA 2 mutant par rapport au RNA 2 sauvage. Laréplication du RNA 1 est également affectée mais dans des proportions plus faibles(publication 1, figure 2, pistes 6, 7, 9 et 10, et voir figure II-2, pistes 2, 3 et 4). Ces résultats suggèrent donc que la protéine P14 nest pas essentielle à linfectionvirale mais la favorise, soit en améliorant lefficacité du mouvement de cellule à cellule,soit en stimulant la multiplication du virus. Pour discriminer entre ces 2 possibilités,nous avons inoculé ces mêmes mutants à des protoplastes de C. quinoa. c-Mise en évidence du rôle de la protéine P14 dans la réplication du BNYVV et la quantité de protéine de capside synthétisée. Les transcrits des différents mutants nexprimant pas la protéine P14 ainsi que lestranscrits du RNA 1 (nécessaire à la réplication) ont été coinoculés à des protoplastes deC. quinoa. Après 48 heures de culture, nous avons extrait et analysé les RNA totaux parhybridation moléculaire. Les résultats que nous avons obtenus révèlent une chuteimportante de la quantité de RNA 2 et une diminution beaucoup plus faible voire parfoisnulle du signal correspondant au RNA 1 (voir publication 1, figure 4, pistes 5 et 6). Cesrésultats qui sont tout à fait comparables à ceux obtenus sur plantes sont regroupés dansle tableau II-1 : le pourcentage dinhibition de la réplication du RNA 2 en absence desynthèse de protéine P14 peut atteindre 85 à 98 % ; par contre ce pourcentage nest plus 46
  50. 50. Chapitre 2_____________________________________________________________________ Accumulation par rapport au témoin sauvage Expérience n° Mutant RNA 1 RNA 2 2-4003 120 % 13 % 1 2-3992 150 % 14 % 2-3722 42 % 2% 2-4003 58 % 2% 2 2-3992 38 % 7% 3 2-4003 64 % 5% 4 2-4003 37 % 2%Tableau II-1: Effets des mutations introduites dans le gène VI sur la réplication des RNA 1 et RNA 2 de BNYVV. Synthèse de Réplication protéine de du RNA 2 coque RNA 1 + RNA 2 ++++ ++++ RNA 1 + RNA 2-4003 + + RNA 1 + RNA 2-4003 + RNA 2-F + ++++ RNA 1 + RNA 2-4003 + rep 14 + +++ Tableau II-2 : Bilan des expériences de complémentation démontrant que la protéine P14 a une action en cis sur la réplication du RNA 2 et en trans sur la synthèse de protéine de capside. 47
  51. 51. Résultats______________________________________________________________________ Figure II-3 : Cinétique de réplication des RNA viraux et de synthèse des protéines P14, CP et P42 dans des protoplastes de C. quinoa infectés par lisolat Stras 12 de BNYVV. Les prélèvements ont été effectués au bout de 9, 16, 24 et 48 heures dinfection et les analyses réalisées par hybridation moléculaire et par immunoempreinte pour détecter les RNA viraux (A) et les protéines P14 (B), CP (C) et P42 (D) 48
  52. 52. Chapitre 2_____________________________________________________________________que de 63 % dans le pire des cas pour le RNA 1. Dautres expériences ont égalementmontré que la réplication du RNA 3 est peu ou pas affectée par labsence de protéineP14. Lautre effet significatif des mutations introduites dans lORF VI est unediminution importante de la quantité de protéine de capside synthétisée (tableau II-2 etpublication 2, figure 4-B, pistes 3 et 4) alors que la synthèse de protéine P25 codée parle RNA 3 nest pas affectée (publication 2, figure 4-A, pistes 3 et 4). Enfin, pourexpliquer la petite taille des lésions et leur phénotype nécrogène, on peut émettrelhypothèse suivante. En absence de protéine P14, les taux de réplication des RNAviraux et de synthèse de protéine de coque sont considérablement abaissés ce qui peut serépercuter de manière directe ou indirecte sur la synthèse des protéines de mouvementdu virus, ralentissant ainsi sensiblement le processus infectieux. Cet effet pourrait alorspermettre à la plante de mettre en place un système de défense qui sapparenterait, dansce cas là, à une réaction dhypersensibilité sévère caractérisée par lapparition de lésionsnécrotiques.2-La protéine P14 joue un rôle en cis dans la réplication du RNA 2 et active en transla synthèse de la protéine de coque. (publication n°2) Avant de décrire les expériences de complémentation qui nous ont permis demieux comprendre le mécanisme daction de la protéine P14 dans la réplication et dansla traduction du RNA 2, il était intéressant détudier la cinétique dapparition de cetteprotéine ainsi que son rôle dans la synthèse de RNA de polarité négative. a-Cinétique dapparition de la protéine P14 lors de linfection de protoplastes de C. quinoa. Les cinétiques réalisées avec lisolat Stras 12 montrent que la protéine P14 peutêtre détectée en western blot à partir de 16 heures (figure II-3-B, piste 3). Des étudeseffectuées en parallèle sur la synthèse de protéine capsidaire et de la protéine P42révèlent que toutes ces protéines apparaissent en même temps (figure II-3-C et D, piste 49
  53. 53. Résultats______________________________________________________________________3). Cependant au bout de 48 heures de culture, la synthèse de protéine P42 atteint unmaximum alors que les protéines P14 et CP continuent à saccumuler ; nous avons pumontrer dans dautres expériences que laccumulation de protéine de coque et deprotéine P14 continuait jusquau temps 72 heures. Au delà de ce temps, le taux demortalité des protoplastes devient trop important pour que les résultats obtenus puissentêtre pris en considération. Ces observations suggèrent que la synthèse de protéine P42est donc régulée différemment des 2 autres protéines étudiées. Des observationsanalogues ont été faites par Davies et collaborateurs (1993) en ce qui concerne laprotéine P25 synthétisée à partir de la première ORF du TGB du potato virus X (ouPVX). b-Labsence de protéine P14 a un effet inhibiteur sur la synthèse de RNA (-). Après avoir mis en évidence un effet négatif sur la synthèse des brins (+), nousavons cherché à savoir si labsence de protéine P14 affectait également la synthèse desbrins (-). Pour cela, les RNA totaux ont été extraits de protoplastes infectés après 36heures de culture dans les conditions décrites dans le chapitre matériel et méthodes. Laseule modification introduite dans le protocole expérimental consiste à précipiterlensemble des acides nucléiques en présence déthanol et dacétate dammonium 2 M.Nous avons ainsi pu montrer quen labsence de protéine P14, leffet observé pour lesRNA brin (+) se retrouve au niveau de la synthèse des RNA brins (-) (publication 2,figure 5-A et B) en provoquant une réduction importante de lintensité des signaux plusparticulièrement au niveau des brins (-) correspondant au RNA 2. c-La protéine P14 agit en cis sur la réplication du RNA 2. Dans les expériences décrites ci-dessous, nous avons entrepris de complémenterleffet des mutations introduites dans lORF VI par lapport de protéine P14 sauvage. Cesexpériences de complémentation ont été réalisées de 2 façons différentes : 50
  54. 54. Chapitre 2_____________________________________________________________________ - Dans une première série dexpériences, nous avons utilisé le mutant RNA 2-F(figure II-4) caractérisé par une délétion de 935 nt au niveau de lORF II. Ce mutant estcapable de se répliquer dans les protoplastes (voir publication 1, figure 4, piste 1 ; 1143 2077 RNA 2-F An RNA 2 sub c An 382 1688 tRep 14 An Protéine P14Figure II-4 : Caractéristiques des transcrits RNA 2 F et tRep 14 exprimant la protéine P14 dans les expériences de complémentation. : Séquences 5 et 3 non codantes du RNA 3. : ORF VI dirigeant la synthèse de la protéine P14. : Protéine P14.. 51
  55. 55. Résultats______________________________________________________________________ 52
  56. 56. Chapitre 2_____________________________________________________________________ 380 linker BamHI 1470 Bam HI Bam HI + P14 promoteur T7 pB6 (²ES) PCR ORF VI (+ sites Bam HI) Rep 14 P14 tRep 14 P14 AnFigure II-5 : Représentation schématique de la construction du clone Rep 14. Après amplification par PCR, lORF VI du RNA 2 de BNYVV est introduit dans le clone cDNA du RNA 3 délété de toute linformation codante (pB6 (²ES). 53
  57. 57. Résultats______________________________________________________________________publication 2, figure 1, piste 2) et permet la synthèse dune protéine P14 native. Lesexpériences de complémentation ont consisté à coinoculer le mutant RNA 2-F avec leRNA 1 et le RNA 2-4003 nexprimant pas la protéine P14. Ces expériences qui ont étérépétées un grand nombre de fois nont jamais permis de déceler une stimulation de laréplication du RNA 2-4003 (publication 2, figure 1, piste 4) suggérant ainsi que laprotéine P14 ne peut être efficace lorsquelle est apportée en trans. Cependant on peutimaginer une autre explication : la synthèse de protéine P14 à partir du RNA 2-F seferait à un taux trop faible pour être efficace dans une action en trans. - Cest pourquoi, dans une deuxième série dexpériences, nous avons utilisé untranscrit exprimant la protéine P14 en grande quantité, le transcrit rep 14 (figure II-4)correspondant obtenu de la manière suivante (voir figure II-5) : le gène VI a dabord étéamplifié par PCR en utilisant des amorces contenant les sites de restriction Bam HI.Après digestion Bam HI, le produit PCR a été introduit dans le clone pB6 (∆ES) entreles séquences 5 (1 à 380) et 3 (1470 à 1773) non traduites du RNA 3 du BNYVV. Dansce clone construit par Isabelle Jupin (Jupin et al, 1990), la séquence virale est placéesous le contrôle du promoteur T7 . Le produit de transcription rep 14 est capable de serépliquer dans les protoplastes lorsquil est inoculé en présence de transcrits du RNA 1.De plus ce transcrit est capable dexprimer efficacement la protéine P14 (publication 2,figure 3-B, piste 4 et 5). Le transcrit rep 14 a donc été coinoculé avec les RNA 1 et 2-4003 et, là encore, les résultats de ces expériences de complémentation ne révèlentaucune stimulation de la réplication du RNA 2-4003 (publication 2, figure 1, piste 6).On peut donc en conclure que la protéine P14 joue très certainement un rôle en cis sur laréplication du RNA 2 (voir tableau II-2). d-La protéine P14 stimule en trans la synthèse de la protéine de capside. Parallèlement à ces analyses par hybridation moléculaire, nous avons recherchépar immunoempreinte la présence de protéine de coque. Nous avons ainsi pu mettre enévidence une seconde fonction liée à la protéine P14 : indépendamment de leffet en cissur la réplication, la protéine P14 peut stimuler fortement en trans, la synthèse de la 54
  58. 58. Chapitre 2_____________________________________________________________________protéine de coque. En effet, le signal correspondant à la protéine de coque est beaucoupplus intense en présence de protéine P14 apportée en trans par le transcrit rep 14(publication 2, figure 3-A, piste 5) quen son absence (publication 2, figure 3-A, piste 3)bien que le taux de réplication du RNA 2-4003 ne soit pas stimulé (publication 2,figure 2, piste 3 et 6 et tableau II-2). Pour expliquer ce résultat, nous avons émis lhypothèse que la protéine P14 a uneaffinité pour une séquence spécifique du RNA 2 et favorise ainsi la traduction de laprotéine capsidaire. Cest pourquoi nous avons entrepris des expériences dexpressiontransitoire en bombardant des feuilles de C. quinoa et de Nicotiana tabacum avec 2types de vecteurs : lun permet la synthèse de protéine P14 et lautre renferme laséquence cible potentielle reconnue par la protéine P14, en loccurrence la région 5terminale de lun ou lautre RNA du BNYVV. Cette séquence cible est placée en amontdun gène rapporteur permettant de visualiser la stimulation si celle-ci a lieu. Lescaractéristiques de ces vecteurs sont les suivantes : - Les vecteurs permettant lexpression de la protéine P14 native ou tronquée ontété obtenus par insertion de la séquence nucléotidique correspondante dans le plasmidepMJD 82 (Dowson Day et al, 1994). Pour cela, nous avons amplifié, par PCR, le cistronde la protéine P14 sauvage ou mutée en utilisant une amorce 5 renfermant le site Nco Iet un oligonucléotide correspondant à lextrémité 3 du RNA 2. Ce produit PCR aensuite été digéré par les enzymes Nco I et Stu I (site naturel localisé en position 4479du RNA 2) puis inséré dans le vecteur pMJD 82 linéarisé par Nco I et Sma I. Nousavons ainsi obtenu les vecteurs pMJD-P14 exprimant la protéine P14 sauvage et pMJD-P14∆1 exprimant une protéine P14 délétée de 30 acides aminés. Ce mutant de délétiona été obtenu par une digestion à lexonucléase III générant une délétion de 98 nt (nt4286-4284) suivie dune insertion dun linker de 8 nucléotides permettant de récupérer laphase de lecture. Lorsque ce mutant du gène VI est introduit dans le RNA 2 et que letranscrit correspondant est inoculé à des protoplastes, on obtient des résultats analoguesaux résultats obtenus avec les mutants ponctuels RNA 2-3722, -3992 et -4003. Le clone 55
  59. 59. Résultats______________________________________________________________________pMJD-P14∆1 nous a servi de témoin négatif dans les expériences dexpressiontransitoire décrites ci-dessous. - Les vecteurs renfermant les séquences cibles ont été obtenus par insertion deproduits PCR correspondant aux extrémités 5 non codantes des RNA 2, 3 et 4 duBNYVV (respectivement les 142, 442 et 377 premiers nucléotides) dans le vecteurpRT2-syn-LUC : les amplifications PCR ont été effectuées en utilisant desoligonucléotides renfermant un site Xho I pour lamorce 5 et un site Nco I pour lamorce3. Après digestion par ces 2 enzymes, les fragments ont été introduits dans le vecteurrapporteur pRT2-syn-LUC coupé par Xho I et Nco I. Les plasmides recombinants ainsiobtenus ont été appelés pRT-BN2-LUC, pRT-BN3-LUC et pRT-BN4-LUC. Lesdifférents plasmides recombinants ont ensuite été cobombardés (un vecteur de typepMJD avec un vecteur de type pRT) sur des feuilles de C. quinoa et de N. Tabacum(voir matériel et méthodes). Vingt quatre heures après linoculation, la stimulation delactivité luciférase a été analysée. Les résultats (publication 2, tableau 2) démontrentque la protéine P14 est en mesure de stimuler lactivité luciférase dans les 2 types defeuilles bombardées ; ce facteur de stimulation peut varier de 2,4 à 4,5 . Cependant,cette stimulation nest pas spécifique dune séquence présente dans la région 5 leader duRNA 2 car elle a lieu quelle que soit la séquence cible utilisée ; même le vecteurrapporteur renfermant uniquement la cassette de clonage montre une stimulation delactivité luciférase en présence de la protéine P14. Cependant, le facteur de stimulationest plus faible que celui observé lors de la synthèse de protéine CP dans les expériencesde complémentation dans les protoplastes où la protéine P14 est apportée en trans. Il estclair que ces expériences devront donc être reprises avec des séquences du RNA 2 duBNYVV allongées au delà de la séquence 5 leader si lon veut observer une stimulationbeaucoup plus significative.3-Mode daction de la protéine P14. Pour expliquer les résultats décrits ci dessus, nous avons proposé le modèlesuivant (voir figure II-6) : dans les premiers instants de linfection, les RNA décapsidés 56
  60. 60. Chapitre 2_____________________________________________________________________ CP P75 5 3 Brin plus Brin moins 3 5 Rôle au niveau de la RNA 2 sub c 5 3 réplication Rôle au niveau (en cis) de la traduction P14 (en trans) CP P75 5 3 Brin plus Figure II-6 : Modèle permettant dexpliquer le rôle de la protéine P14 dans le cycle de multiplication du BNYVV. 57
  61. 61. Résultats______________________________________________________________________ Synthèse de RNA brin + et de RNA subgénomiques 3 5 - Complexe de réplication 5 3 - + La protéine P14 naissante se fixe au complexe de réplication et reconnait une séquence sur le brin + néosynthétisé. Puis elle stimule la synthèse de RNA brin -. 3 - + + - Figure II-7 : Modèle proposé pour expliquer le rôle en cis de la protéine P14 dans la réplication du RNA 2. 58
  62. 62. Chapitre 2_____________________________________________________________________de polarité positive provenant de linoculum, sont traduits permettant, entre autre, lasynthèse de RNA polymérase RNA dépendante. Cette enzyme va permettre la formationdun complexe de réplication induisant, à un taux que nous allons qualifier de basal, lasynthèse de RNA de polarité négative. Ces RNA (-) servent ensuite de matrice pour laformation des RNA complémentaires génomiques et subgénomiques. Puis la protéineP14 néosynthétisée à partir du RNA 2sub c pourra stimuler en cis la synthèse denouveau brin moins à partir desquels se fera une synthèse massive de RNA génomiques.Cet effet en cis est assez peu courant et mérite que lon sy attarde un peu plus : commeon peut le voir sur la figure II-7, le RNA de polarité négative sert de matrice à lasynthèse de RNA génomique, mais également à la synthèse de RNA subgénomique.Celui ci pourra être pris en charge, durant sa synthèse par les ribosomes pour initier laproduction de protéine P14. Dans ces conditions, on aura un couplageréplication/traduction. La protéine P14 ainsi synthétisée pourra ensuite reconnaître uneséquence spécifique dans la région 3 terminale du RNA brin plus génomique et stimulerainsi la synthèse de nouveaux brins de RNA de polarité négative. On peut imaginer que,durant sa synthèse, un site cryptique de la protéine P14 reconnaît une séquencespécifique du RNA 2. Le masquage de ce site sur la protéine mature pourrait expliquerpourquoi la protéine P14 apportée en trans reste sans effet sur la réplication du RNA 2. Après avoir stimulé en cis la synthèse de RNA brin moins, la protéine P14 quicommence à saccumuler dans la cellule pourra alors induire en trans la synthèse de laprotéine de coque. Pour mieux comprendre lintérêt dun tel système, il faut se rappeler que laplupart des virus de plante expriment leur protéine de coque à partir dun RNAsubgénomique (TMV, AMV, etc...) ou alors par lintermédiaire dune polyprotéinematurée (CPMV, GFLV, etc ...). Ces 2 systèmes permettent une régulation relativementfacile de la production de la CP. Par contre dans le cas du BNYVV, du BSMV, unhordeivirus ou du TRV, un tobravirus, le cistron codant pour la protéine de coque estlocalisé en 5 dun RNA génomique et sera donc traduit en premier. Si tel est le cas, laprésence de protéine CP dès le début du cycle de réplication devrait favoriser la 59
  63. 63. Résultats______________________________________________________________________réencapsidation des 60
  64. 64. Chapitre 2_____________________________________________________________________ A 10 20 30 40 50 60 70 80 90 100 110 120 Hydrophilicité (KD) Probabilité de surface B ATGGGGATGGTAGATAGTTTGTGCGTGTTTGTTGGTCGAGTCATAACTGAGGGATCTGAA M G M V D S L C V F V G R V I T E G S E AGTGTTGAGGGTGTGGAAAGGTTTTCCATTAAGTTTAGTGAGTGGAAATTGTTCACCATC S V E G V E R F S I K F S E W K L F T I GCGGTGTTTGTTGAATATCGTGAGTTAGGTGAGAAAGAGTGCAGTTTGAAGGATGCTGGT A V F V E Y R E L G E K E C S L K D A G AGATTACACTTTAATGTGTCATGTGTGAAATGCTGTCAAAAACTTAAATGCAAGAAACAA R L H F N V S C V K C C Q K L K C K K Q AATAAAAATCATAGTAAACACGTCCAAAATGGATATTTACGCAAGGTACGTAATTTTTCC N K N H S K H V Q N G Y L R K V R N F S ATTTTAGGTGTTTGCGGTGATTGTTGTGAGTCTTTTACACTCGCGGACGAAAAACCTCAT I L G V C G D C C E S F T L A D E K P H GTTATTGTCGATCCTGAGGTGTAA V I V D P E V * Figure II-8 : Caractéristiques de la protéine P14 codée par lORF VI du RNA 2. A : Profil dhydrophilicité selon Kyte & Doolittle (1982) et probabilité de surface des acides aminés : ces profils ont été obtenus en utilisant le logiciel de prédiction de structure "plotstructure" de UWGCG. B : Séquence nucléotidique de lORF VI du RNA 2 et structure primaire de la protéine P14 correspondante. 61
  65. 65. Résultats______________________________________________________________________ A B K80 K79 C72 C106 Zn C69 C109 E118 K119Figure II-9 : (A) Comparaison de séquence entre lORF 6 du RNA 2 du BNYVV et un certain nombre de papillomavirus (Koonin et al, 1991). HPV 1a, human papilloma virus type 1a ; BPV2, bovine papillomavirus type 2 ; DPV, deer papilloma virus ; CRPV, cottontail rabbit papilloma virus. + correspond à des acides aminés hydrophobes et * désigne des acides aminés du BNYVV faisant partie de la séquence consensus. (B) Structure en doigt de zinc hypothétique de la protéine P14 du BNYVV. Les acides aminés représentés correspondent aux mutants alanines décrits dans le chapitre II, paragraphe III. 62
  66. 66. Chapitre 2_____________________________________________________________________RNA génomiques provenant de linoculum et empêcher ainsi la multiplication du virus.Or, à la lumière des résultats obtenus, le rôle bifonctionnel de la protéine P14permettrait une régulation temporelle du processus dinfection virale : au début delinfection virale, la protéine P14 serait intégralement utilisée pour stimuler laréplication des RNA viraux ; dans un deuxième temps son accumulation stimulerait lasynthèse de protéine capsidaire et donc lencapsidation des RNA viraux néosynthétisés.II-Mise en évidence de limportance des résidus cystéines 69, 72, 106 et 109 danslactivité de la protéine P14. La protéine P14 est un polypeptide de 126 acides aminés très riche en cystéines(8 %) et en lysines (10 %) et dont la séquence est présentée figure II-8-B. Bien que codée par une ORF localisée à lextrémité 3 du RNA 2, la protéine P14présente très peu dhomologies avec dautres protéines riches en cystéines égalementexprimées à partir dORF localisées en 3 de RNA génomiques dautres phytoviruscomme le BSMV ou encore le TRV. Par contre, des comparaisons de séquences(Koonin et al, 1991) (figure II-9) montrent une homologie non négligeable entre cetteprotéine P14 et la protéine E6 des papillomavirus, une protéine impliquée dans latransactivation de la transcription du génome viral grâce à la présence dune structure endoigt de zinc (Lamberti et al, 1990). Avant dinitier une étude fine des acides aminés essentiels à lactivité biologiquede la protéine P14, nous avons effectué des prédictions de structure à laide dunprogramme informatique "plotstructure" de UWGCG et les résultats sont décrits figureII-8-A. Lexamen du profil de probabilité des acides aminés dêtre en surface de laprotéine P14 (figure II-8-A) révèle lexistence de 2 domaines : ces 2 domaines sontsitués au voisinage des acides aminés 80 et 120, le premier domaine très hydrophile estencadré de résidus cystéines conservés chez les papillomavirus. Ces observations ainsique les résultats déjà obtenus par U. Niesbach-Klösgen (1990) et montrant que laprotéine P14 63
  67. 67. Résultats______________________________________________________________________ A B C Figure II-10 : Symptômes induits par le mutant RNA 2 (E118-K119) (A), le mutant RNA 2 (K79-80) (B) et les mutants RNA 2 (C106-109) ou RNA 2 (C69-72) (C) inoculés à des feuilles de C. quinoa. 64

×