1. Funding for RosBREED: Combining disease resistance with horticultural quality in new rosaceous cultivars is provided by the Specialty Crop Research Initiative Competitive Grant 2014-51181-22378 of the USDA’s National Institute of Food and Agriculture.
Development of the Simple Sequence Repeat Marker PruG4RS for the Differentiation of Cherry Rootstocks
Kristen Andersen, Audrey Sebolt, Travis Stegmeir, Amy Iezzoni Michigan State University
Summary
The use of clonally propagated Prunus sp. rootstocks in sweet cherry production is increasing as these rootstocks provide reduced tree size and precocity. Numerous clonally propagated cherry rootstocks are in
commercial production, such as the GiSelA® series, or under test, such as the Michigan State University (MSU) series (Fig. 1). Many of these dwarfing cherry rootstocks are difficult to differentiate based on morphology
alone, therefore DNA markers that differentiate rootstocks are an important tool to verify identity and prevent mix-ups among these rootstocks during the vegetative propagation stage. The simple sequence repeat (SSR)
marker PceGA59 was previously determined to uniquely distinguish the commercially available GiSelA® rootstocks (Struss et al. 2002)1 (Table 1, Fig. 2).
A targeted approach was used to develop a second SSR that was capable of providing differentiation of the MSU rootstock selections. The approach used was based on the ability to obtain genome-wide SNP (Single
Nucleotide Polymorphism) data using the Illumina Infinium® cherry SNP array (Peace et al. 2012)2. An analysis of genome-wide SNP data for the rootstocks resulted in the identification of a genomic region on linkage group
4 that was likely to differ among the MSU rootstocks (Fig. 4). Using the peach genome sequence, two SSR markers were designed to target this region (Fig. 5). One of these SSR markers, termed PruG4RS, successfully
differentiated the MSU rootstocks (Table 2, Fig. 3). The development of PruG4RS and its combined use with PceGA59 has successfully circumvented the limitations of each individual marker and proven effective for use as
a “quality control” DNA diagnostic tool for the commercial GiSelA® rootstocks as well as the MSU breeding program rootstock selections. The efficient generation of this informative SSR marker illustrates the successful use
of genome-wide SNP data to predict genomic regions most likely to differentiate specific plant materials.
SSR marker Primer Sequence (5’ - 3’)
PceGA59_F TGAACCCCTCTACAAATTTTCC
PceGA59_R GACTGTAGAACCCAAAAGAACG
PruG4RS_F TCAGAAAAGAAATTGCAACGGG
PruG4RS_R CTTAGTGGTCTAGTCTGCATGC
Figure 2. Visualization of the SSR marker PceGA59
on silver-stained polyacrylamide gels.
Figure 3. Visualization of the SSR marker PruG4RS
on a silver-stained polyacrylamide gel.
1Struss D, Boritzki M, Karle R, Iezzoni AF. 2002. Microsatellite markers differentiate eight Giessen cherry rootstocks. HortScience 37(1):191-193.
2Peace C, Bassil N, Main D, Ficklin S, Rosyara UR, Stegmeir T, Sebolt A, Gilmore B, Lawley C, Mockler TC, Bryant DW, Iezzoni A. 2012. Development and evaluation of a genome-wide 6K SNP array for diploid sweet cherry and tetraploid sour cherry. PLoS ONE 7(12): e48305.
3Verde I, Abbott AG, Scalabrin S, Jung S, Shu S, Marroni F, Zhebentyayeva T, Dettori MT, Grimwood J, Cattonaro F, Zuccolo A, Rossini L, Jenkins J, Vendramin E, Meisel LA, Decroocq V, Sosinski B, Prochnik S, Mitros T, Policriti A, Cipriani G, Dondini L, Ficklin S, Goodstein
DM, Xuan P, Del Fabbro C, Aramini V, Copetti D, Gonzalez S, Horner DS, Falchi R, Lucas S, Mica E, Maldonado J, Lazzari B, Bielenberg D, Pirona R, Miculan M, Barakat A, Testolin R, Stella A, Tartarini S, Tonutti P, Aru´s P, Orellana A,Wells C, Main D, Vizzotto G, Silva H,
Salamini F, Schmutz J, Morgante M, Rokhsar DS (2013) The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nat Genet 45:487–494.
4Edge-Garza D, Rowland T, Haendiges S, Peace C. 2014. A high-throughput and cost-efficient DNA extraction protocol for the tree fruit crops apple, sweet cherry, and peach relying on silica beads during tissue sampling. Molecular Breeding 34:2225-2228.
Implementing PruG4RS in Applied DNA Diagnostics
The availability of genome-wide genetic data enables the development of diagnostic markers, like
PruG4RS, which significantly increases the efficiency of rootstock production as well as providing growers
with confidence that their plant materials are genetically verified. The development of custom SSR markers
through the analysis of genome-wide data provides a practical approach to meeting specified needs within a
breeding program or commercial production, be it DNA diagnostics or other characteristics of importance.
Table 2. SSR markers were developed as follows: primer pairs were designed using Primer3web
(bioinfo.ut.ee/primer3/) with product size limited to 150-250 bp, and primers selected on either side of the
repeat region with a GC clamp. The primers were then compared to the peach genome v1.0 scaffolds using
NCBI BLAST. Primer sequences which co-located to multiple scaffolds with at least 75% sequence similarity
were no longer considered. Those primer sequences determined to be unique were selected and tested for
their adequacy in clearly distinguishing the rootstock selections of interest. The primer sequence that was
determined to be the most informative and of the highest quality in uniquely identifying the rootstock selections
was selected and named PruG4RS. GC clamps were added to the primer pair sequences of PceGA59.
The forward and reverse primer sequences of the SSR markers PceGA59 and PruG4RS are listed in the
table below. In conducting DNA diagnostic tests of the rootstocks of interest DNA is extracted from fresh,
young leaf tissue using the silica bead method developed by Edge-Garza et al. (2014)4. A touchdown PCR is
used for both primers with the conditions as follows: 94 °C for 5 min followed by 9 cycles of 94 °C for 30 s, 60
°C for 45 s (-1 °C per cycle), 72 °C for 1 min and then 24 cycles of 94°C for 30 s, 55 °C for 45 s, 72 °C for 1
min with an elongation step of 72 °C for 5 min. The PCR fragments are separated in a 6% polyacrylamide gel
and visualized with silver staining.
Primers Gi 3 Gi 5 Gi 6 Gi 12 CASS CLARE CLINTON CRAWFORD LAKE
PceGA59 189 194 226 226 226 226 194 194 226
(Struss, 2002)1
186 186 189 186 194 194 189 189 194
182 182 182 182 186 - 186 182 189
- - - - - - 182 - -
PruG4RS 200 200 200 200 182 198 200 200 196
192 192 192 190 172 182 196 192 190
- - - - - 172 192 172 172
- - - - - - 172 - -
Figure 1. Rooted liners of the five MSU cherry rootstocks CASS, CLARE, CLINTON, CRAWFORD, and LAKE.
Table 1. Fragment sizes (bp) of the amplification products for the SSR markers PceGA59 and PruG4RS
tested on the four GiSelA® (Gi) and five MSU rootstocks.
*The rootstock BENZIE has been included as a representation of the second generation of the rootstock LAKE.
Figure 4. Genome-wide SNP data for the MSU rootstock selections of interest was obtained using the
RosBREED Illumina Infinium® cherry SNP array (Peace et al., 2012)2. Analysis of this data identified a region
of linkage group 4 centered on the SNP ss490546237 that appeared to be exceptionally different among the
rootstocks. This region was chosen as the target for SSR marker development.
The GenomeStudio cluster plot revealed differences in the SNP marker ss490546237 for the MSU
rootstock selections. Genotypes are called for each sample (dot) by their signal intensity (Norm R) and allele
frequency (Norm Theta) relative to canonical cluster positions (dark shading) for the SNP marker (red = AA,
purple = AB, blue = BB. In the below cluster plot CASS, CLARE, CRAWFORD, LAKE, and Gi6 cluster together
in the homozygous class BB; Gi5 and Prunus canescens (the common ancestor of two of the five MSU
rootstock selections) cluster together in the homozygous class AB, and CLINTON is classified as a no-call.
Figure 5. A total of 100,000 base pairs (bp) of DNA sequence located up and down stream of the SNP marker
ss490546237 were obtained from the peach genome v1.0 (Verde, 2013)3, available at the Genome Database
for Rosaceae (www.rosaceae.org). This sequence was then searched for SSRs ranging from 2-5 bp repeat
length and having a minimum of 6 repeats. Multiple SSRs meeting these conditions were identified, so those
with the largest number of tandem repeats were selected.
The below GBrowse image of the peach genome sequence illustrates the position of the cherry SNP
marker ss490546237 and the adjacent sequence used to develop PruG4RS. This alignment is from the
Genome Database for Rosaceae (rosaceae.org).
Gi5
LAKE
CASS
CLARE
BENZIE*
CLINTON
CRAWFORD
Gi6
PceGA59
194
186
226
189
182
BENZIE*
PruG4RS
CASS
CLARE
CLINTON
CRAWFORD
LAKE
Gi5
Gi6
198
200
192
196
182
172
CASS CLARE CLINTON CRAWFORD LAKE
Prunus canescens
Gi 5
Gi 6
CASS
CLINTON
CLARE, LAKE
CRAWFORD
AA BBAB
S-locus
190