Recommandé
Recommandé
Contenu connexe
En vedette
En vedette (13)
Similaire à Primary analysis tutorial depracated
Similaire à Primary analysis tutorial depracated (20)
Dernier
Dernier (20)
Primary analysis tutorial depracated
- 1. Bioinforma)cs Primary Analysis Tutorial Phil Richmond, PRA Dowell Lab University of Colorado, Biofron)ers Ins)tute
- 2. Outline • Intro – Things that will be covered – Things that won’t be covered • Workflow • Mapping with Bow)e • File Conversion with Samtools • Visualiza)on with IGV • Extras
- 3. Sequencing • There are many different types of sequencing including 454, Illumina, SOLiD, IonTorrent, and more. • If you are interested in each type of sequencing…
- 4. Things that will be covered • The primary analysis that I will walk through is a “bare bones” analysis, meant to take your reads from Illumina sequencer to visualizer, as well as some organiza)onal prac)ces – Mapping (Bow)e/BWA) – File format conversion – Visualiza)on
- 5. Things that won’t be covered • Post/preprocessing steps that I’m leaving out include: – FastX analysis of raw reads and adapter clipping, etc. – PCR duplicate marking (Illumina) on raw reads – Base Quality Score Recalibra)on (GATK) on mapped reads – Local Realignment around indels on mapped reads • Any Secondary or Ter)ary analysis or scrip)ng techniques – Secondary analysis by personal appt. – Scrip)ng techniques by joining Dave Knox’s python class
- 6. Login to Tuxedo • Login with –X op)on to open X11 viewer. • On a PC…see me for separate instruc)ons to pipe visualiza)on • ssh –X richmonp@tuxedo.colorado.edu
- 7. Working Directory • We will be working in /data/Tutorial/<Student> – cd /data/Tutorial/Phil/ • The necessary files for the tutorial are in /data/ Tutorial/Files/ – Parent113010.fa is the reference (e. coli) genome – Parent120710.gff is the annota)on file – Sample1_single.fastq is the reads file we are working with
- 8. Organiza)on • In your own directory (/data/Tutorial/ <Student>/) create the following sub-‐ directories: – Genome/ • Keep the fasta and gff files here – Bow)e/ • Keep the Bow)e alignments, and post-‐processing of bow)e alignments here – Fastq/ • Keep the raw fastq files here
- 9. Workflow Raw Reads (Fastq) Mapped Reads (SAM) Mapping (Bow)e) Binary Mapped Reads (SORTED.BAM) File Conversion (SAMTOOLS) Visualiza)on (IGV)
- 10. Workflow Raw Reads (Fastq) Mapped Reads (SAM) Mapping (Bow)e) Binary Mapped Reads (SORTED.BAM) File Conversion (SAMTOOLS) Visualiza)on (IGV)
- 11. Fastq file • File extension .fastq or .fq • Example: @Read_iden)fier_and_flowcell_info ACGTCCGGTTNNN… + B$!?NP[%&C… • For more info on ASCII encoding QV scores… go to wikipedia Read ID Read Sequence Read QV ID Read QV Sequence
- 12. Workflow Raw Reads (Fastq) Mapped Reads (SAM) Mapping (Bow)e) Binary Mapped Reads (SORTED.BAM) File Conversion (SAMTOOLS) Visualiza)on (IGV)
- 13. Mapping the Short Reads • Taking each read and mapping it to a reference genome – Bow)e TGCATGCATGCATGCATGCATGCATGCATGCATGCAAAAAGCATGCATGCA TGCATGAATGCAAAAAGCATGCA
- 14. Bow)e-‐Build Command • In order to map the reads to a genome, you must acquire the genome in the .fasta (.fa) format, and then index it. • bow)e-‐build -‐f <in.fasta> <out_prefix> – $bow)e-‐build SGDv4.fasta SGDv4_bow)e
- 15. Bow)e command • Now we map back to the reference we just indexed. • bow)e <reference_in.prefix> -‐q <in.fastq> -‐S <out.SAM> 2> <out.stderr> – $ bow)e /data/Tutorial/Phil/Genome/ Bow)e_index/SGDv3_bow)e –q Sample1.fastq –S Sample1_ bow)e.sam 2> Sample1_bow)e.stderr
- 16. Sam File • Tab Delimited • hup://genome.sph.umich.edu/wiki/SAM • Open Example SAM
- 17. Workflow Raw Reads (Fastq) Mapped Reads (SAM) Mapping (Bow)e) Binary Mapped Reads (SORTED.BAM) File Conversion (SAMTOOLS) Visualiza)on (IGV)
- 18. Samtools Commands • samtools view –bS <in.sam> -‐o <out.bam> – $samtools view –bS Sample1_bow)e.sam –o Sample1_bow)e.bam • samtools sort <in.bam> <out.sorted> – $samtools sort Sample1_bow)e.bam Sample1_bow)e.sorted • samtools index <in.sorted.bam> – $samtools index Sample1_bow)e.sorted.bam
- 19. Workflow Raw Reads (Fastq) Mapped Reads (SAM) Mapping (Bow)e) Binary Mapped Reads (SORTED.BAM) File Conversion (SAMTOOLS) Visualiza)on (IGV)
- 20. IGV • Located at /data2/IGV/ • Several different versions available, recommend either: • /data2/IGV/IGV_2.1.19/igv.jar • /data2/IGV/IGV_1.5.64/igv.jar • To run IGV: – java –Xmx5g –jar <igv.jar> • $java –Xmx5g –jar /data2/IGV/IGV_1.5.64/igv.jar &
- 21. IGV: Crea)ng a genome • Reference Instruc)ons on sheet.
- 22. Bow)e and Bfast IGV Bow$e Bfast Gene
- 23. Advantages to Bfast Gapped Mapping Bow$e Bfast Gene
- 24. Bfast Mapping Loosely Bow$e Bfast Gene
- 25. If you are gexng the hang of it quickly… • Try going through the next few commands
- 26. BWA Paired end • /usr/local/src/bwa-‐0.6.2/bwa index –a is –f <in.fasta> • Map each read in the pair independently • /usr/local/src/bwa-‐0.6.2/bwa aln <reference.prefix> <in_1.fq> > <out.sai> • Finalize the mapping by conver)ng (for both reads) both the .SAI and the .FQ into a final SAM alignment: • /usr/local/src/bwa-‐0.6.2/bwa sampe <reference.prefix> <in_1.sai> <in_2.sai> <in_1.fq> <in_2.fq> > <out_paired.sam>
- 27. Bow)e Unique Mapping • Inves)gate the different Bow)e op)ons: – Look at –m (number of mappings per read), -‐v (number of mismatches per seed)
- 28. TopHat Spliced Mapping • /usr/local/src/tophat-‐2.0.4.Linux_x86_64/ tophat –G <in.gff> -‐o <output_directory> <bow)e_index> <in.fastq>
- 29. The end…for now.