Kestelman Valentin M2 SVS :Biologie des interactions du gène aux populationsEncadrantsDr. Lorraine Bottin; Dr. Thierry Thi...
Algues structurantesStructurent l’habitat : ingénieur de l’écosystème(sensu Jones et al. 1994)Disparition de l’algue  P...
Cystoseira en MéditerranéeGenre Cystoseira : 28 taxons dont 20endémiquesDepuis la surface jusqu’à 80 m deprofondeurEn f...
Cystoseira amentacea var. strictaDiploïde, cycle monogénétique(Gomez-Garreta et al., 2000)Zygotes 100 µm, membranecollan...
Etat des connaissancesEtudes préliminaires :RAPDs, marqueurs dominants, difficilement reproductibles(Susini et al., 2007...
Matériel et méthodesTerrainLocalisation des populationsP1n = 43P2n = 45nP1n = 45nP2n = 45ÉchantillonnagePerturbation Popul...
7P1P2nP1nP2xyxyxyxy(Diagrammes : A. Blanfuné)
Matériel et méthodesLaboratoireExtraction d’ADNPCR microsatellitesAnalyse des génotypesTraitement des données 8Génotypage
Hypothèses testéesEn panmixie (reproductionaléatoire)Equilibre de Hardy-Weinberg (HW) : He = HoEcart à HW : He ≠ HoEca...
Résultats :Richesse, Fis et DifférentiationP1 P2 nP1 nP2Richesse allélique 3,252 3,097 3,645 2,880Fis 0,112 *** 0,092 *** ...
Autocorrélation spatialePanmixie Isolement par la distanceHamilton 200911I de moranDistance entre paires d’individus
Résultats : autocorrélation spatiale Absence de structuregénétique spatiale Pas d’isolement parla distance à cetteéchell...
Résultats : autocorrélation spatialeStructuregénétique spatiale< 30 cmStructure liée à lataille des patchs ?Pairwise kin...
Pollution et structuregénétiqueHypothèses :Fragmentation depuis la perturbation,bottleneck (goulot d’étranglement)Dispar...
ConclusionPopulations non perturbées : non fragmentéesFis nul ou faiblePas d’isolement par la distancePopulations pert...
PerspectivesLien entre génétiqueet environnementPente / VaguesDispersion des zygotes / gamètesTransplantationAugmente...
Merci de votre attention17(Photos: P.Robvieux)
18nP1 : St-Jean-Cap-Ferrat(Diagrammes : A. Blanfuné)
19nP2 : Cap Martin(Diagrammes : A. Blanfuné)
20P1 : Cap Sicié A(Diagrammes : A. Blanfuné)
21P2 : Cap Sicié B(Diagrammes : A. Blanfuné)
22680 km680 kmProvence Alpes Côte d’Azur RegionCorsicaC. amentacea : distribution of the species in France(Cartes fournis ...
CSA CSB SJCF CM24 « monomorphe » : 154Par populationPar locus23
24PATCHINESSAnalysis of Variance TableResponse: ArDf Sum Sq Mean Sq F value Pr(>F)Pop 7 0.3449 0.04928 0.1530 0.99276Locus...
 PCR product from: 9 to 168.Length: 160 bp.The sequence of the PCR primers replaces the templatesequence. GTGTGGTCCTTGCT...
263 Pics CSAImpair CSB??? SJCFPresque OK CM
 Uniquement population CSB (Locus 27)27En bleu sur le graphe…
Potentiellementcontaminés15 15Perdus7 0281 témoin pour 15 echantillons1 contamination : Mix2 (Locus 20 et 35)Témoin 3 : Lo...
29J.M. Butler (2005) Forensic DNA Typing, 2ndEdition ©2005 Elsevier Academic PressStuttering : Petits signal à 1 répétitio...
30Tiré du manuel de micro-checkerMicro-checker
Connus : pour le pollen dispersion de type « Leptokurtique »,la grande majorité proche de la source mais aussi rares évène...
(Gomez-garreta et al., 2000)n : Noyaufa : Flagelle antérieurefp : Flagelle postérieurem : mastigonemes(Clayton et al., 199...
33Gomez-Garreta et al., 2000
Sites échantillonnésEtude des courants (Ifremer)34
Song et al., 1996FluorescencePhosphorescence35
36
gabpq =1 - paa : p²ab : p*q + p*q = Hebb : q²Multi-allèleHomozygoteHe : 1 - Q(Hamilton, 2009)37
 Le nombre d’alléles observés dépend fortementde la taille de l’échantillon Méthode de raréfaction pour « lisser » lesdi...
39
Le dénominateur du premier terme « pondère» la contribution des allèles etpermet à cet estimateur de ne pas souffrir de bi...
Prochain SlideShare
Chargement dans…5
×

Kestelman oral

540 vues

Publié le

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
540
Sur SlideShare
0
Issues des intégrations
0
Intégrations
5
Actions
Partages
0
Téléchargements
3
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive
  • Mettre les notes
  • Kestelman oral

    1. 1. Kestelman Valentin M2 SVS :Biologie des interactions du gène aux populationsEncadrantsDr. Lorraine Bottin; Dr. Thierry Thibaut & Doctorante Pauline RobvieuxEA 4228 Ecomers1
    2. 2. Algues structurantesStructurent l’habitat : ingénieur de l’écosystème(sensu Jones et al. 1994)Disparition de l’algue  Perte de la biodiversité(Benedetti-Cecchi, 2001)Pacifique : KelpsAtlantique : Laminaria ou FucusMéditerranée : Cystoseira(Mann, 1973)(Steneck et al., 2003)2(Photo : T.Thibaut)
    3. 3. Cystoseira en MéditerranéeGenre Cystoseira : 28 taxons dont 20endémiquesDepuis la surface jusqu’à 80 m deprofondeurEn forte régression (Thibaut et al., 2005)causes anthropiques :SurpâturageRejet d’eaux usées, eutrophisationSensibles aux perturbations : mesurela qualité de l’environnement littoralmarin (Ballesteros et al., 2007)3La saupe, un herbivorePopulation impactée(Photos: T.Thibaut)
    4. 4. Cystoseira amentacea var. strictaDiploïde, cycle monogénétique(Gomez-Garreta et al., 2000)Zygotes 100 µm, membranecollante (Susini, 2006)Dispersion estimée très faible40 cm max (Mangialajo et al., 2012)Isolement par la distance attenduSource : Gomez-Garreta et al., 2000Animation : Amber Rais4Cartographie Ceinture dense(Photo: P. Robvieux)
    5. 5. Etat des connaissancesEtudes préliminaires :RAPDs, marqueurs dominants, difficilement reproductibles(Susini et al., 2007)Microsatellites neutres, codominants, polymorphes8 marqueurs disponibles  Structuration inter-population(Robvieux et al., 2012)Existe-t-il une structuration intra-population ?Objectifs de l’étudeDécrire la structure génétiqueClarifier la distance de dispersion des recruesEffet de perturbations anthropiques sur la structuregénétique5
    6. 6. Matériel et méthodesTerrainLocalisation des populationsP1n = 43P2n = 45nP1n = 45nP2n = 45ÉchantillonnagePerturbation Population fragmentée 6(Photos: T.Thibaut & A. Blanfuné)
    7. 7. 7P1P2nP1nP2xyxyxyxy(Diagrammes : A. Blanfuné)
    8. 8. Matériel et méthodesLaboratoireExtraction d’ADNPCR microsatellitesAnalyse des génotypesTraitement des données 8Génotypage
    9. 9. Hypothèses testéesEn panmixie (reproductionaléatoire)Equilibre de Hardy-Weinberg (HW) : He = HoEcart à HW : He ≠ HoEcart à la panmixie(Consanguinité, EffetWahlund)F (Fis et Fst)Déficit en hétérozygoteAutocorrélation spatialeDétecter une structuregénétique dans l’espace9Effet WahlundStructure génétique spatiale(Hamilton, 2009)
    10. 10. Résultats :Richesse, Fis et DifférentiationP1 P2 nP1 nP2Richesse allélique 3,252 3,097 3,645 2,880Fis 0,112 *** 0,092 *** 0,077 *** 0,004 nsP1 P2 nP1 nP2P1 -P2 0,372 *** -nP1 0,419 *** 0,304 *** -nP2 0,500 *** 0,479 *** 0,415 *** -Richesse allélique et écart à la panmixieFst par paires de populations10P : PerturbénP : Non perturbé
    11. 11. Autocorrélation spatialePanmixie Isolement par la distanceHamilton 200911I de moranDistance entre paires d’individus
    12. 12. Résultats : autocorrélation spatiale Absence de structuregénétique spatiale Pas d’isolement parla distance à cetteéchelle Pourtant déficit en Hopour nP1 Consanguinité à nP1et pas nP2 ?Distance en cmPairwise kinship coefficientErreur StandardIC 95 %12
    13. 13. Résultats : autocorrélation spatialeStructuregénétique spatiale< 30 cmStructure liée à lataille des patchs ?Pairwise kinship coefficient13Erreur StandardIC 95 %Distance en cm
    14. 14. Pollution et structuregénétiqueHypothèses :Fragmentation depuis la perturbation,bottleneck (goulot d’étranglement)Disparition locale, puis recolonisation Pas à pas De manière aléatoire1952 1997 2012Rejets des eaux usées deToulon sans traitementUsine de traitementdes eaux opérationnelle Structure génétiquespatiale observée14(Photos: T.Thibaut)
    15. 15. ConclusionPopulations non perturbées : non fragmentéesFis nul ou faiblePas d’isolement par la distancePopulations perturbées, fragmentéesStructure génétique, effet WahlundPatch d’individus apparentés Effet des perturbations15
    16. 16. PerspectivesLien entre génétiqueet environnementPente / VaguesDispersion des zygotes / gamètesTransplantationAugmenter le nombre de sites àéchantillonnerRelargage et survie des gamètesGamètes in vitroStimulus  Relargage gamètes ?Influence des vagues ?16(Photo: P.Robvieux)
    17. 17. Merci de votre attention17(Photos: P.Robvieux)
    18. 18. 18nP1 : St-Jean-Cap-Ferrat(Diagrammes : A. Blanfuné)
    19. 19. 19nP2 : Cap Martin(Diagrammes : A. Blanfuné)
    20. 20. 20P1 : Cap Sicié A(Diagrammes : A. Blanfuné)
    21. 21. 21P2 : Cap Sicié B(Diagrammes : A. Blanfuné)
    22. 22. 22680 km680 kmProvence Alpes Côte d’Azur RegionCorsicaC. amentacea : distribution of the species in France(Cartes fournis par P. Robvieux)
    23. 23. CSA CSB SJCF CM24 « monomorphe » : 154Par populationPar locus23
    24. 24. 24PATCHINESSAnalysis of Variance TableResponse: ArDf Sum Sq Mean Sq F value Pr(>F)Pop 7 0.3449 0.04928 0.1530 0.99276Locus 1 0.9963 0.99633 3.0943 0.08507 .Residuals 47 15.1333 0.32198---Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1> anova(glm(patchm,family=quasipoisson),test="Chisq")Analysis of Deviance TableModel: quasipoisson, link: logResponse: ArTerms added sequentially (first to last)Df Deviance Resid. Df Resid. Dev Pr(>Chi)NULL 55 9.9784Pop 7 0.21106 48 9.7673 0.9936Locus 1 0.59654 47 9.1708 0.0822 .---Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘ ’ 1Pas de variation détectableTrop peu d’individus…
    25. 25.  PCR product from: 9 to 168.Length: 160 bp.The sequence of the PCR primers replaces the templatesequence. GTGTGGTCCTTGCTTCGTCACGTATACAGCAATAGTTGTATAGCAGCAGCAGCAGCAGCAGCTCATGTGACTGTTTTTTGTCCACTATTTCATCCAAACCCATACACATTACACATCATCTGCCAATACGAACAAACAAAACCAGAGCTGTCAAGCATGC Amplicon attendu : 160 pb, observé (partout) 154 pb25
    26. 26. 263 Pics CSAImpair CSB??? SJCFPresque OK CM
    27. 27.  Uniquement population CSB (Locus 27)27En bleu sur le graphe…
    28. 28. Potentiellementcontaminés15 15Perdus7 0281 témoin pour 15 echantillons1 contamination : Mix2 (Locus 20 et 35)Témoin 3 : Locus 20 – 223/223 – Locus 35 – 188/201Certains individus « liés » au T3présentent un signal223 en hétérozygoteAucun individu « lié » au T3,Ne présente de signal à 201 pb
    29. 29. 29J.M. Butler (2005) Forensic DNA Typing, 2ndEdition ©2005 Elsevier Academic PressStuttering : Petits signal à 1 répétitionLarge allele dropout : Signal réduità plus grande pbQuantité/qualité de l’ADN+/- A à la fin de la séquenceAllèles nuls, pas de signalhttp://www.uvm.edu/~biology/Classes/296D/6_Biology.pdf
    30. 30. 30Tiré du manuel de micro-checkerMicro-checker
    31. 31. Connus : pour le pollen dispersion de type « Leptokurtique »,la grande majorité proche de la source mais aussi rares évènementà longue distanceEx : Centaurea corymbosa (Hardy, et al. 2004)31
    32. 32. (Gomez-garreta et al., 2000)n : Noyaufa : Flagelle antérieurefp : Flagelle postérieurem : mastigonemes(Clayton et al., 1992)D’un µ-envt à un autreGrande dispersion : Large + Courant32
    33. 33. 33Gomez-Garreta et al., 2000
    34. 34. Sites échantillonnésEtude des courants (Ifremer)34
    35. 35. Song et al., 1996FluorescencePhosphorescence35
    36. 36. 36
    37. 37. gabpq =1 - paa : p²ab : p*q + p*q = Hebb : q²Multi-allèleHomozygoteHe : 1 - Q(Hamilton, 2009)37
    38. 38.  Le nombre d’alléles observés dépend fortementde la taille de l’échantillon Méthode de raréfaction pour « lisser » lesdifférentes tailles Estime le nombre attendu d’allèles dans un sous-echantillon de 2n gènes, 2N ayant étéechantillonés. Terme sous la somme : probabilité d’échantillonerl’allèle i au moins une fois dans un echantillon detaille 2n38
    39. 39. 39
    40. 40. Le dénominateur du premier terme « pondère» la contribution des allèles etpermet à cet estimateur de ne pas souffrir de biais particulier en présenced’allèle de faible fréquence.Le second terme ajuste le biais attribuable à la taille d’échantillonnage.(d’après Oddou-Muratorio et al., 2004)Le numérateur est plus grand quand les paires d’individus (populations) ont des fréquencesalléliques qui sont chacune très différentes de la fréquence allélique moyenne. Valeurspossible de -1 à +1 avec une quantité suffisante d’échantillons.Valeur positive, signifie que les fréquences alléliques entre pairs d’individus, sont similaireen moyenne. Négative : les fréquences alléliques entre pairs d’individus diffèrent enmoyenne.Une valeur de zéro indique que les différences ne sont pas liées à la distance, ou que lavariation génétique est aléatoire dans l’espace. (d’après Hamilton, 2009)40

    ×