SlideShare une entreprise Scribd logo
1  sur  18
Télécharger pour lire hors ligne
Cotton States
R&D and Operations
     June 25, 2004



               Yossi Shapiro, PhD
               Research Manager
               Cotton Technology Team
Key Elements of Cotton States Model
• Research and Development
  – Competitive germplasm and superior technology
  – Variety performance testing
  – Technological edge in breeding

• Operations
  – Cotton seed manufacturing
Competitive Germplasm…
Two Sources:

1) Outside Originators
   In-licensed from private and public sector cotton breeders

2) In-house Breeding Program
   •   Conventional Plant Breeding
   •   Molecular Marker Platform
       •   Marker-Assisted Breeding: variety development
       •   Marker-Assisted Backcrossing: expedited trait conversion
… and Superior Technology
•   Trait Introgression (TI)
        Bollgard II® and Roundup Ready® Flex Cotton
    –
    –   Germplasm must meet criteria for entry into TI
    –   Advanced, through backcrossing, to lines fixed for:
        •   Stacked Bollgard II / Roundup Ready Flex Cotton (“B2RF”)
        •   Roundup Ready Flex Cotton alone (“RF”)
    –   Returned to Originator for variety selection
    –   Rigorous quality control throughout the process
Variety Performance Testing

•     Replicated Yield Trials
     –   Cotton States Conventional Trials
     –   Cotton States Transgenic Lines
•     Gene Equivalency Trials
     –   to ascertain trait performance
•     Demonstration Strip Plots
     –   for potential “Out-licensees”
2004 Cotton States Field Trials
    • Designed to assess performance and geographic
           adaptation of Cotton States varieties
    • 44 tests at more than 20 sites across the Cotton Belt
    • More locations to be added each year




Cotton States Trial
Technological Edge in Breeding
        Molecular Marker Platform
A “Marker”:
• is a unique genetic characteristic, easily classified
• must display detectable variation among individuals
• may, or may not, be a gene itself

To be useful in breeding, a marker should:
• be linked to a gene, or genes, of interest
• demonstrate reproducible results
• be amenable to high through-put and low cost
Simple Sequence Repeats (SSR)
Parents A and B vary for the number of “TC” repeats
       GGCAGGGGAAGTGGTATTGGTGGTCGGGGTACTGGAACGATCCTAACG
       ATAGTACGCATGCGGCGGTGCTCCCTGT TC TC TC TC TC TC
       TC TC TC TC TC. . . .TC CCAATAAAAGAGTTTTCCTGTAAT
       TTTAACCAGCTAGCCGCCGGTGTCTTCCTTGATCTATGTGCATGTAGG
       CAGACGTTACCCA

                            H             B
               A




 Different banding patterns for a given marker are called:
                         “Alleles”
Use of Molecular Markers in Breeding

                  Population development




      Molecular Mapping                Field Tests




  Data analysis to identify statistical association between
marker alleles and field performance for a given characteristic
Simple Sequence Repeats (SSR)
Parents A and B vary for the number of “TC” repeats
       GGCAGGGGAAGTGGTATTGGTGGTCGGGGTACTGGAACGATCCTAACG
       ATAGTACGCATGCGGCGGTGCTCCCTGT TC TC TC TC TC TC
       TC TC TC TC TC. . . .TC CCAATAAAAGAGTTTTCCTGTAAT
       TTTAACCAGCTAGCCGCCGGTGTCTTCCTTGATCTATGTGCATGTAGG
       CAGACGTTACCCA

                            H             B
               A


                                                          Strength
                                                          SSR112
                                                          Boll size
                                                          SSR220
                                                          SSR105
Targets for Genetic Improvement
       • Yield
          –   seed cotton yield
          –   lint yield

       • Fiber quality
          –   length
          –   strength
          –   fineness
          –   uniformity

       • Stress tolerance
          –   disease
          –   nematode
          –   insect
          –   abiotic (drought, cold, etc.)
Cotton States R&D Objectives
Excellent execution in lab, field & greenhouse:
• Efficient and cost-effective operations
• High-throughput (“numbers game”)
• Quality data: accurate, consistent, timely
• Emphasis on employee health and environmental safety
• Continual process improvements
Key Elements of Cotton States Model
• Research and Development
  – Unique germplasm and technology
  – Variety performance testing

• Operations
  – Cotton seed manufacturing
Cotton Seed Manufacturing Process

• Crop Production
• Harvest of seed cotton
• Processing:
  – Ginning – to separate fiber from seed (“fuzzy seed”)
  – Delinting – to clean seed of residual fibers (“linters”)
• Packaging (cleaning, treatment, bagging)
• Storage / Shipping
Status of 1st Cotton States B2/RF Varieties
• Initiation: Breeder Seed Increase
   – Winter season production, 2003-04
   – New seed processing facility in Puerto Rico

• “Product”: Foundation Seed Increase
   – US field season production, 2004

• Final: Commercial Planting Seed Increase
   – Responsibility of Out-licensees / Distributors
   – US field season production, 2005
   – For commercialization in 2006
Cotton States Breeder Seed Gin – Puerto Rico
Cotton States Breeder Seed Delinter – Puerto Rico
Where Are We Today?

• Commitment to excellent execution
• Experience with leading edge technology
• Technology succession plan
• Robust product pipeline
• Formidable infrastructure and competency
• Clear path to market
• Ahead of the pack

Contenu connexe

Similaire à monsanto MON_06/25/04d

Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...ICRISAT
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...ICRISAT
 
Targeted Breeding Applications of CRISPR-Cas
Targeted Breeding Applications of CRISPR-CasTargeted Breeding Applications of CRISPR-Cas
Targeted Breeding Applications of CRISPR-CasKate Barlow
 
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®sathish_p
 
Dr. malvika dadlani
Dr. malvika dadlaniDr. malvika dadlani
Dr. malvika dadlanitulika101
 
Graver catalog min
Graver catalog minGraver catalog min
Graver catalog minmaxibarrios
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...Merck Life Sciences
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...MilliporeSigma
 
monsanto 08-23-05a
monsanto 08-23-05amonsanto 08-23-05a
monsanto 08-23-05afinance28
 
Dr. malvika dadlani
Dr. malvika dadlaniDr. malvika dadlani
Dr. malvika dadlaniTulika Singh
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technologyDr. Armaan Singh
 
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNABeyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNAIntegrated DNA Technologies
 
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET Journal
 
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...CIMMYT
 
monsanto 08-23-05
monsanto 08-23-05monsanto 08-23-05
monsanto 08-23-05finance28
 

Similaire à monsanto MON_06/25/04d (20)

CRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in riceCRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in rice
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
 
13. Malting Barley - Duane Falk
13. Malting Barley - Duane Falk 13. Malting Barley - Duane Falk
13. Malting Barley - Duane Falk
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Current status and...
 
Targeted Breeding Applications of CRISPR-Cas
Targeted Breeding Applications of CRISPR-CasTargeted Breeding Applications of CRISPR-Cas
Targeted Breeding Applications of CRISPR-Cas
 
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
 
Dario Lijtmaer - PCR Amplification
Dario Lijtmaer - PCR AmplificationDario Lijtmaer - PCR Amplification
Dario Lijtmaer - PCR Amplification
 
Dr. malvika dadlani
Dr. malvika dadlaniDr. malvika dadlani
Dr. malvika dadlani
 
Graver catalog min
Graver catalog minGraver catalog min
Graver catalog min
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
 
monsanto 08-23-05a
monsanto 08-23-05amonsanto 08-23-05a
monsanto 08-23-05a
 
Dr. malvika dadlani
Dr. malvika dadlaniDr. malvika dadlani
Dr. malvika dadlani
 
Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technology
 
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNABeyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA
 
36 evans
36 evans36 evans
36 evans
 
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
 
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...
Assessment of pasta making quality parameters in Ethiopian durum wheat (Triti...
 
monsanto 08-23-05
monsanto 08-23-05monsanto 08-23-05
monsanto 08-23-05
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 

Plus de finance28

virgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDvirgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDfinance28
 
virgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDvirgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDfinance28
 
virgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALvirgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALfinance28
 
virgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALvirgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALfinance28
 
virgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationvirgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationfinance28
 
virgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationvirgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationfinance28
 
virgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationvirgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationfinance28
 
virgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationvirgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationfinance28
 
virgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALvirgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALfinance28
 
virgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALvirgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALfinance28
 
virgin media._Q12008_presentation
virgin media._Q12008_presentationvirgin media._Q12008_presentation
virgin media._Q12008_presentationfinance28
 
virgin media.VMED_Q12008_presentation
virgin media.VMED_Q12008_presentationvirgin media.VMED_Q12008_presentation
virgin media.VMED_Q12008_presentationfinance28
 
virgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationvirgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationfinance28
 
virgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationvirgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationfinance28
 
virgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationvirgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationfinance28
 
virgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationvirgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationfinance28
 
virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008finance28
 
virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008finance28
 
virgin media.london_nov132008
virgin media.london_nov132008virgin media.london_nov132008
virgin media.london_nov132008finance28
 
virgin media.london_nov132008
virgin media.london_nov132008virgin media.london_nov132008
virgin media.london_nov132008finance28
 

Plus de finance28 (20)

virgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDvirgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMED
 
virgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMEDvirgin media.FINAL_Q4_06_Presentation_VMED
virgin media.FINAL_Q4_06_Presentation_VMED
 
virgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALvirgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINAL
 
virgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINALvirgin media.Q1_07_Analyst_presentation_FINAL
virgin media.Q1_07_Analyst_presentation_FINAL
 
virgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationvirgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentation
 
virgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentationvirgin media.Q2-07_Analyst_presentation
virgin media.Q2-07_Analyst_presentation
 
virgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationvirgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentation
 
virgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentationvirgin media.Q3_07_AnalystPresentation
virgin media.Q3_07_AnalystPresentation
 
virgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALvirgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINAL
 
virgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINALvirgin media.UBS_vmed_December07_FINAL
virgin media.UBS_vmed_December07_FINAL
 
virgin media._Q12008_presentation
virgin media._Q12008_presentationvirgin media._Q12008_presentation
virgin media._Q12008_presentation
 
virgin media.VMED_Q12008_presentation
virgin media.VMED_Q12008_presentationvirgin media.VMED_Q12008_presentation
virgin media.VMED_Q12008_presentation
 
virgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationvirgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentation
 
virgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentationvirgin media.FINAL_Q208_Presentation
virgin media.FINAL_Q208_Presentation
 
virgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationvirgin media.Q3_08_Presentation
virgin media.Q3_08_Presentation
 
virgin media.Q3_08_Presentation
virgin media.Q3_08_Presentationvirgin media.Q3_08_Presentation
virgin media.Q3_08_Presentation
 
virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008
 
virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008virgin media.Analyst_day_november112008
virgin media.Analyst_day_november112008
 
virgin media.london_nov132008
virgin media.london_nov132008virgin media.london_nov132008
virgin media.london_nov132008
 
virgin media.london_nov132008
virgin media.london_nov132008virgin media.london_nov132008
virgin media.london_nov132008
 

Dernier

Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance BookingCall Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Bookingroncy bisnoi
 
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...priyasharma62062
 
Booking open Available Pune Call Girls Wadgaon Sheri 6297143586 Call Hot Ind...
Booking open Available Pune Call Girls Wadgaon Sheri  6297143586 Call Hot Ind...Booking open Available Pune Call Girls Wadgaon Sheri  6297143586 Call Hot Ind...
Booking open Available Pune Call Girls Wadgaon Sheri 6297143586 Call Hot Ind...Call Girls in Nagpur High Profile
 
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...dipikadinghjn ( Why You Choose Us? ) Escorts
 
Booking open Available Pune Call Girls Talegaon Dabhade 6297143586 Call Hot ...
Booking open Available Pune Call Girls Talegaon Dabhade  6297143586 Call Hot ...Booking open Available Pune Call Girls Talegaon Dabhade  6297143586 Call Hot ...
Booking open Available Pune Call Girls Talegaon Dabhade 6297143586 Call Hot ...Call Girls in Nagpur High Profile
 
Top Rated Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...
Top Rated  Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...Top Rated  Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...
Top Rated Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...Call Girls in Nagpur High Profile
 
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )Pooja Nehwal
 
Stock Market Brief Deck (Under Pressure).pdf
Stock Market Brief Deck (Under Pressure).pdfStock Market Brief Deck (Under Pressure).pdf
Stock Market Brief Deck (Under Pressure).pdfMichael Silva
 
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...dipikadinghjn ( Why You Choose Us? ) Escorts
 
falcon-invoice-discounting-unlocking-prime-investment-opportunities
falcon-invoice-discounting-unlocking-prime-investment-opportunitiesfalcon-invoice-discounting-unlocking-prime-investment-opportunities
falcon-invoice-discounting-unlocking-prime-investment-opportunitiesFalcon Invoice Discounting
 
7 tips trading Deriv Accumulator Options
7 tips trading Deriv Accumulator Options7 tips trading Deriv Accumulator Options
7 tips trading Deriv Accumulator OptionsVince Stanzione
 
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...dipikadinghjn ( Why You Choose Us? ) Escorts
 
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7jayawati511
 
Booking open Available Pune Call Girls Shivane 6297143586 Call Hot Indian Gi...
Booking open Available Pune Call Girls Shivane  6297143586 Call Hot Indian Gi...Booking open Available Pune Call Girls Shivane  6297143586 Call Hot Indian Gi...
Booking open Available Pune Call Girls Shivane 6297143586 Call Hot Indian Gi...Call Girls in Nagpur High Profile
 
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...amitlee9823
 
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...dipikadinghjn ( Why You Choose Us? ) Escorts
 

Dernier (20)

Call Girls in New Ashok Nagar, (delhi) call me [9953056974] escort service 24X7
Call Girls in New Ashok Nagar, (delhi) call me [9953056974] escort service 24X7Call Girls in New Ashok Nagar, (delhi) call me [9953056974] escort service 24X7
Call Girls in New Ashok Nagar, (delhi) call me [9953056974] escort service 24X7
 
Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance BookingCall Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Booking
Call Girls Rajgurunagar Call Me 7737669865 Budget Friendly No Advance Booking
 
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...
Diva-Thane European Call Girls Number-9833754194-Diva Busty Professional Call...
 
Booking open Available Pune Call Girls Wadgaon Sheri 6297143586 Call Hot Ind...
Booking open Available Pune Call Girls Wadgaon Sheri  6297143586 Call Hot Ind...Booking open Available Pune Call Girls Wadgaon Sheri  6297143586 Call Hot Ind...
Booking open Available Pune Call Girls Wadgaon Sheri 6297143586 Call Hot Ind...
 
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...
VIP Call Girl in Mira Road 💧 9920725232 ( Call Me ) Get A New Crush Everyday ...
 
Booking open Available Pune Call Girls Talegaon Dabhade 6297143586 Call Hot ...
Booking open Available Pune Call Girls Talegaon Dabhade  6297143586 Call Hot ...Booking open Available Pune Call Girls Talegaon Dabhade  6297143586 Call Hot ...
Booking open Available Pune Call Girls Talegaon Dabhade 6297143586 Call Hot ...
 
Top Rated Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...
Top Rated  Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...Top Rated  Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...
Top Rated Pune Call Girls Sinhagad Road ⟟ 6297143586 ⟟ Call Me For Genuine S...
 
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )
Vip Call US 📞 7738631006 ✅Call Girls In Sakinaka ( Mumbai )
 
W.D. Gann Theory Complete Information.pdf
W.D. Gann Theory Complete Information.pdfW.D. Gann Theory Complete Information.pdf
W.D. Gann Theory Complete Information.pdf
 
Stock Market Brief Deck (Under Pressure).pdf
Stock Market Brief Deck (Under Pressure).pdfStock Market Brief Deck (Under Pressure).pdf
Stock Market Brief Deck (Under Pressure).pdf
 
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...
VIP Call Girl in Mumbai Central 💧 9920725232 ( Call Me ) Get A New Crush Ever...
 
falcon-invoice-discounting-unlocking-prime-investment-opportunities
falcon-invoice-discounting-unlocking-prime-investment-opportunitiesfalcon-invoice-discounting-unlocking-prime-investment-opportunities
falcon-invoice-discounting-unlocking-prime-investment-opportunities
 
7 tips trading Deriv Accumulator Options
7 tips trading Deriv Accumulator Options7 tips trading Deriv Accumulator Options
7 tips trading Deriv Accumulator Options
 
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...
VIP Call Girl in Mumbai 💧 9920725232 ( Call Me ) Get A New Crush Everyday Wit...
 
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7
(Sexy Sheela) Call Girl Mumbai Call Now 👉9920725232👈 Mumbai Escorts 24x7
 
Booking open Available Pune Call Girls Shivane 6297143586 Call Hot Indian Gi...
Booking open Available Pune Call Girls Shivane  6297143586 Call Hot Indian Gi...Booking open Available Pune Call Girls Shivane  6297143586 Call Hot Indian Gi...
Booking open Available Pune Call Girls Shivane 6297143586 Call Hot Indian Gi...
 
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...
Call Girls Banaswadi Just Call 👗 7737669865 👗 Top Class Call Girl Service Ban...
 
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...
( Jasmin ) Top VIP Escorts Service Dindigul 💧 7737669865 💧 by Dindigul Call G...
 
(INDIRA) Call Girl Mumbai Call Now 8250077686 Mumbai Escorts 24x7
(INDIRA) Call Girl Mumbai Call Now 8250077686 Mumbai Escorts 24x7(INDIRA) Call Girl Mumbai Call Now 8250077686 Mumbai Escorts 24x7
(INDIRA) Call Girl Mumbai Call Now 8250077686 Mumbai Escorts 24x7
 
(Vedika) Low Rate Call Girls in Pune Call Now 8250077686 Pune Escorts 24x7
(Vedika) Low Rate Call Girls in Pune Call Now 8250077686 Pune Escorts 24x7(Vedika) Low Rate Call Girls in Pune Call Now 8250077686 Pune Escorts 24x7
(Vedika) Low Rate Call Girls in Pune Call Now 8250077686 Pune Escorts 24x7
 

monsanto MON_06/25/04d

  • 1. Cotton States R&D and Operations June 25, 2004 Yossi Shapiro, PhD Research Manager Cotton Technology Team
  • 2. Key Elements of Cotton States Model • Research and Development – Competitive germplasm and superior technology – Variety performance testing – Technological edge in breeding • Operations – Cotton seed manufacturing
  • 3. Competitive Germplasm… Two Sources: 1) Outside Originators In-licensed from private and public sector cotton breeders 2) In-house Breeding Program • Conventional Plant Breeding • Molecular Marker Platform • Marker-Assisted Breeding: variety development • Marker-Assisted Backcrossing: expedited trait conversion
  • 4. … and Superior Technology • Trait Introgression (TI) Bollgard II® and Roundup Ready® Flex Cotton – – Germplasm must meet criteria for entry into TI – Advanced, through backcrossing, to lines fixed for: • Stacked Bollgard II / Roundup Ready Flex Cotton (“B2RF”) • Roundup Ready Flex Cotton alone (“RF”) – Returned to Originator for variety selection – Rigorous quality control throughout the process
  • 5. Variety Performance Testing • Replicated Yield Trials – Cotton States Conventional Trials – Cotton States Transgenic Lines • Gene Equivalency Trials – to ascertain trait performance • Demonstration Strip Plots – for potential “Out-licensees”
  • 6. 2004 Cotton States Field Trials • Designed to assess performance and geographic adaptation of Cotton States varieties • 44 tests at more than 20 sites across the Cotton Belt • More locations to be added each year Cotton States Trial
  • 7. Technological Edge in Breeding Molecular Marker Platform A “Marker”: • is a unique genetic characteristic, easily classified • must display detectable variation among individuals • may, or may not, be a gene itself To be useful in breeding, a marker should: • be linked to a gene, or genes, of interest • demonstrate reproducible results • be amenable to high through-put and low cost
  • 8. Simple Sequence Repeats (SSR) Parents A and B vary for the number of “TC” repeats GGCAGGGGAAGTGGTATTGGTGGTCGGGGTACTGGAACGATCCTAACG ATAGTACGCATGCGGCGGTGCTCCCTGT TC TC TC TC TC TC TC TC TC TC TC. . . .TC CCAATAAAAGAGTTTTCCTGTAAT TTTAACCAGCTAGCCGCCGGTGTCTTCCTTGATCTATGTGCATGTAGG CAGACGTTACCCA H B A Different banding patterns for a given marker are called: “Alleles”
  • 9. Use of Molecular Markers in Breeding Population development Molecular Mapping Field Tests Data analysis to identify statistical association between marker alleles and field performance for a given characteristic
  • 10. Simple Sequence Repeats (SSR) Parents A and B vary for the number of “TC” repeats GGCAGGGGAAGTGGTATTGGTGGTCGGGGTACTGGAACGATCCTAACG ATAGTACGCATGCGGCGGTGCTCCCTGT TC TC TC TC TC TC TC TC TC TC TC. . . .TC CCAATAAAAGAGTTTTCCTGTAAT TTTAACCAGCTAGCCGCCGGTGTCTTCCTTGATCTATGTGCATGTAGG CAGACGTTACCCA H B A Strength SSR112 Boll size SSR220 SSR105
  • 11. Targets for Genetic Improvement • Yield – seed cotton yield – lint yield • Fiber quality – length – strength – fineness – uniformity • Stress tolerance – disease – nematode – insect – abiotic (drought, cold, etc.)
  • 12. Cotton States R&D Objectives Excellent execution in lab, field & greenhouse: • Efficient and cost-effective operations • High-throughput (“numbers game”) • Quality data: accurate, consistent, timely • Emphasis on employee health and environmental safety • Continual process improvements
  • 13. Key Elements of Cotton States Model • Research and Development – Unique germplasm and technology – Variety performance testing • Operations – Cotton seed manufacturing
  • 14. Cotton Seed Manufacturing Process • Crop Production • Harvest of seed cotton • Processing: – Ginning – to separate fiber from seed (“fuzzy seed”) – Delinting – to clean seed of residual fibers (“linters”) • Packaging (cleaning, treatment, bagging) • Storage / Shipping
  • 15. Status of 1st Cotton States B2/RF Varieties • Initiation: Breeder Seed Increase – Winter season production, 2003-04 – New seed processing facility in Puerto Rico • “Product”: Foundation Seed Increase – US field season production, 2004 • Final: Commercial Planting Seed Increase – Responsibility of Out-licensees / Distributors – US field season production, 2005 – For commercialization in 2006
  • 16. Cotton States Breeder Seed Gin – Puerto Rico
  • 17. Cotton States Breeder Seed Delinter – Puerto Rico
  • 18. Where Are We Today? • Commitment to excellent execution • Experience with leading edge technology • Technology succession plan • Robust product pipeline • Formidable infrastructure and competency • Clear path to market • Ahead of the pack