Please write a new code as i need mines to be written differently than.docx

•Télécharger en tant que DOCX, PDF•

0 j'aime•3 vues

H

Please write a new code as i need mines to be written differently than the one ALREADY answered here. Thanks client and output provided Here is the client program that you must use to test your classes. Here is the correct output. Your output should match this exactly except where random numbers are used. Solution class creature { private : int type; int strength; int hitpoints; string getspecies() const; public: creature(); creature (int newtype, int newstrength, int newhitpoints); int getDamage() const; }; string creature :: getspecies() const{ switch(type); { case 0: return \"Human\"; case 1: retrun \"Cyberdemon\"; case 2: return \"balrog\"; case 3: return \"Elf\"; } return unkown; } int creature :: getDamage(){ int damage; damage=(rand()%strength)+1; cout<<getspecies()<<\"attacks for\"<<damage<<\"point\"<<endl; if(type==2 || type==1){ if (rand()%4==0) { damage=damage+50; cout<<\"Denomic attacks inflicts 50 Additional damage point:\"<<endl; } } if(type ==3) { if rand()%2==0) { cout<<\"Magical attacks inflict\"<<damage<<\"Additional damage points:\"<<endl; damage*=2; } } if (type==2) { int damage2=rand()%strength)+1; cout<<\"balrog speed attack inflicts\"<<damage2<<\"Additional damage points:\"<<endl; damage=damage+damage2; } return damage; } .

Please write a new code as i need mines to be written differently than the one ALREADY
answered here.
Thanks
client and output provided
Here is the client program that you must use to test your classes.
Here is the correct output. Your output should match this exactly except where random numbers
are used.
Solution
class creature {
private :
int type;
int strength;
int hitpoints;
string getspecies() const;
public:
creature();
creature (int newtype, int newstrength, int newhitpoints);
int getDamage() const;
};

string creature :: getspecies() const{
switch(type);
{
case 0:
return "Human";
case 1:
retrun "Cyberdemon";
case 2:
return "balrog";
case 3:
return "Elf";
}
return unkown;
}
int creature :: getDamage(){
int damage;
damage=(rand()%strength)+1;
cout<<getspecies()<<"attacks for"<<damage<<"point"<<endl;
if(type==2 || type==1){
if (rand()%4==0)
{
damage=damage+50;
cout<<"Denomic attacks inflicts 50 Additional damage point:"<<endl;

}
}
if(type ==3)
{
if rand()%2==0)
{
cout<<"Magical attacks inflict"<<damage<<"Additional damage points:"<<endl;
damage*=2;
}
}
if (type==2)
{ int damage2=rand()%strength)+1;
cout<<"balrog speed attack inflicts"<<damage2<<"Additional damage points:"<<endl;
damage=damage+damage2;
}
return damage;
}

Contenu connexe

Similaire à Please write a new code as i need mines to be written differently than.docx

Smart Pointer in C++

Smart Pointer in C++

Smart Pointer in C++

Describe the complete pipeline in ML using programming through PyTorch. For this, you need to write code that performs linear regression using PyTorch on simulated data. Make sure you include training, testing and evaluation in your code. { "nbformat": 4, "nbformat_minor": 0, "metadata": { "colab": { "provenance": [] }, "kernelspec": { "name": "python3", "display_name": "Python 3" }, "language_info": { "name": "python" } }, "cells": [ { "cell_type": "code", "execution_count": null, "metadata": { "id": "V0RhNGmBjFWt" }, "outputs": [], "source": [ "import torch\n", "import numpy as np\n", "import matplotlib.pyplot as plt\n", "import seaborn" ] }, { "cell_type": "code", "source": [ "# Creating a function f(X) with a slope of -5\n", "X = torch.arange(-5, 5, 0.2).view(-1, 1)\n", "func = -5 * X" ], "metadata": { "id": "Vq4OWcCNjJFj" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "# Plot the line in red with grids\n", "plt.plot(X.numpy(), func.numpy(), 'r', label='func')\n", "plt.xlabel('x')\n", "plt.ylabel('y')\n", "plt.legend()\n", "plt.grid('True', color='y')\n", "plt.show()" ], "metadata": { "id": "EFDhIKURjPbB" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "# Adding Gaussian noise to the function f(X) and saving it in Y\n", "Y = func + 1.7 * torch.randn(X.size())" ], "metadata": { "id": "c2KRcFl5jRuy" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "# Plot and visualizing the data points in blue\n", "plt.plot(X.numpy(), Y.numpy(), 'b+', label='Y')\n", "plt.plot(X.numpy(), func.numpy(), 'r', label='func')\n", "plt.xlabel('x')\n", "plt.ylabel('y')\n", "plt.legend()\n", "plt.grid('True', color='y')\n", "plt.show()" ], "metadata": { "id": "ahd47p24jgrB" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "# defining the function for forward pass for prediction\n", "def forward(x):\n", " return w * x" ], "metadata": { "id": "T-vtFS9Gjig2" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "# evaluating data points with Mean Square Error.\n", "def criterion(y_pred, y):\n", " return torch.mean( (y_pred - y) ** 2 )" ], "metadata": { "id": "DpPaj2Vvjv5A" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "w = torch.tensor(-10.0, requires_grad=True)" ], "metadata": { "id": "UMXfOHC0jx9G" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "step_size = 0.1\n", "loss_list = []\n", "iter = 20" ], "metadata": { "id": "Ml6UCAqujzvm" }, "execution_count": null, "outputs": [] }, { "cell_type": "code", "source": [ "for i in range (iter):\n", " # making predictions with forward pass\n", " Y_pred = forward(X)\n", "\n", "\n", " # calculating the loss between original and predicted data points\n", " loss = criterion(Y_pred, Y)\n", "\n", "\n", " # storing the calculated loss in a list\n", " loss_list.append(loss.item())\n", "\n", "\n", " # backward pass for .

Describe the complete pipeline in ML using programming through PyTorch.pdf

Describe the complete pipeline in ML using programming through PyTorch.pdf

Describe the complete pipeline in ML using programming through PyTorch.pdf

BorisdFHFraserk

We have successfully created and continue developing PVS-Studio analyzer for C/C++ languages. Over the time, it became clear that many of the diagnostics that we have implemented are not related to a specific programming language, so we decided to apply our experience to another programming language, namely C#. In this article, we are talking about the analysis of Code Contracts project by Microsoft done by our C# analyzer

Analysis of Microsoft Code Contracts

Analysis of Microsoft Code Contracts

Analysis of Microsoft Code Contracts

You will write a multi-interface version of the well-known concentration game: 1. The game displays a grid of upper-case letters, with each letter appearing twice. 2. A player has a few seconds to memorize the letters before they disappear. 3. The player then has to remember where each pair was located. line, then MultiConcentration starts with the text interface. First the new game display will show the user the pairs he/she must guess, in a format similar to the following example for size = 6 D H B C M I H G K K A R C N R E O E Q O A Q L F L F J P B G P D N M I J Memorize the above grid! Note that the new game display uses pairs of distinct single uppercase capital letters distributed at random on a square grid, starting at A and continuing until the grid is full. This new game display shows for 10 seconds, after which it scrolls out of view. (To scroll it just write about 25 newlines.) Then the standard game display appears. The standard game display will look like the following example for size = 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 21 32 33 34 35 36 Enter a pair of numbers, or \"R\" to reset, or \"Q\" to quit: reset, or \"Q\" to quit: If the player makes an invalid entry (e.g. numbers out of range, number already guessed, no blank separator, etc.) then a \"please reenter\" message is printed and the same display is shown again. If the player makes a bad guess, then a \"Sorry...\" message is printed and the same display is shown again. If the player enters an \"R\" for reset, then we start over, that is, the computer calculates a new set of pairs and shows the new game display again. If the player enters a \"Q\" for quit, then the game prints a \"Game Over\" message and ends. 3.4 Graphic Game Interface If the player used the \"-g\" flag on the startup command line then MultiConcentration starts up with the graphic interface. You may design the graphic interface as you choose, as long as you use Swing and preserve the steps in the game as described in the previous section. One possible graphic interface is shown in Figure 1. In this design the new game display and the standard game display have been replaced by a grid of buttons. Instead of entering pairs of numbers, the player clicks on two of the buttons. The \"reset\" and \"quit\" commands are given using a menu. Letters that have been correctly guessed are shown with a pink background color. Messages to the player are shown in a text area under the grid. 4 GENERAL REQUIREMENTS 4.1 Design Requirements Design your program with GUI classes, a main class, and Application Logic / Data classes as described in my overheads on Design for Testability. Do not use a package statement; name the main class MultiConcentration. (Otherwise the startup command given in 3.1 would not work.) You should have at least 5 classes, and not one of them should have more than 40% of the code. Solution import java.io.OutputStream; import java.io.PrintStream; public cl.

You will write a multi-interface version of the well-known concentra.pdf

You will write a multi-interface version of the well-known concentra.pdf

You will write a multi-interface version of the well-known concentra.pdf

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

Erythrocyte Protoporphyrin Erythrocyte Protoporphyrin ( hemoglobin precursor) begin to accumulate as hemoglobin as hematocrit declineduring the 3rd stage of iron deficiency occurs when their is lack of iron limits hemoglobin production. World wide,how many people are estimated to have iron deficiency anemia Ans; 2.0 to 2.5billion ( over 30% 0f world population according to WHO) Solution Erythrocyte Protoporphyrin Erythrocyte Protoporphyrin ( hemoglobin precursor) begin to accumulate as hemoglobin as hematocrit declineduring the 3rd stage of iron deficiency occurs when their is lack of iron limits hemoglobin production. World wide,how many people are estimated to have iron deficiency anemia Ans; 2.0 to 2.5billion ( over 30% 0f world population according to WHO).

Please follow the code and comments for description and outputs C.pdf

Please follow the code and comments for description and outputs C.pdf

Please follow the code and comments for description and outputs C.pdf

Import java

Answer: Note: Provided code shows several bugs, hence I implemented a separate code as per the given program specifications Program code: import java.util.Scanner; //declares fraction class class Fraction { //private data members for the class private int numerators,denominators; //default constructor public Fraction() { } //parameterised constructor for the class public Fraction(int numerators, int denominators) { //assigns numerator this.numerators = numerators; //checks the denominator if(denominators == 0) { System.out.println(\"denominator Shouldn\'t be ZERO \"); System.out.println(\"Program Exiting.....\"); System.exit(0); } this.denominators = denominators; } //parameterised constructor public Fraction(int numerators) { this.numerators = numerators; } //method TO string public String toString() { return \"\"+numerators+\" / \"+denominators; } //methods Equals() @Override public boolean equals(Object obj) { if (obj == null) { return false; } if (getClass() != obj.getClass()) { return false; } final Fraction other = (Fraction) obj; if (this.numerators != other.numerators) { return false; } if (this.denominators != other.denominators) { return false; } return true; } //method GCD declaration public int GCD(int a, int b) { //declares local variables int x = 0, GCD = 0; int max = a > b ? a : b; int min = a < b ? a : b; for(int i = 1; i <= min; i++) { x = max * i; if(x % min == 0) { GCD = x; break; } } //returns GCD return GCD; } //Method to read public static Fraction read() { Scanner sc1 = new Scanner(System.in); System.out.print(\"Enter Fraction numerators : \"); int num1 = sc1.nextInt(); System.out.print(\"Enter Fraction denominators : \"); int den1 = sc1.nextInt(); System.out.println(); Fraction f1 = new Fraction(num1,den1); return f1; } //Method definition to add() public Fraction add(Fraction other1) { int GCD = GCD(this.denominators,other.denominators); int numb1 = this.numerators * (GCD/this.denominators); int numb2 = other1.numerators *(GCD/other.denominators); int num1 = 0, den1 = 0; num1 = numb1 + numb2; den1 = GCD; return new Fraction(num1,den1); } //method definition to add() public Fraction add(int temp1) { //defines the number variable int num1 = this.denominators * temp1 + this.numerators; return new Fraction(num1,this.denominators); } //method definition to subract public Fraction subtract(Fraction other1) { int GCD = GCD(this.denominators,other.denominators); int numb1 = this.numerators *(GCD/this.denominators); int numb2 = other1.numerators *(GCD/other1.denominators); int num1 = 0, den1 = 0; num1 = numb1 - numb2; den1 = GCD; return new Fraction(num1,den1); } //Method definition to multiply public Fraction multiply(Fraction other1) { int num1 = 0, den1 = 0; num1 = this.numerators * other1.numerators; den1 = this.denominators * other1.denominators; return new Fraction(num1,den1); } //method definition to Multiply public Fraction multiply(int temp1) { int num 1= this.numerators * temp1; return new Fraction(num1,this.denomina.

AnswerNote Provided code shows several bugs, hence I implemented.pdf

AnswerNote Provided code shows several bugs, hence I implemented.pdf

AnswerNote Provided code shows several bugs, hence I implemented.pdf

C++ Assignment Please read all the requirements and the overloading requiremets. Here is what i have so far, #include using namespace std; class ComplexNumbers { private: double real; double imaginary; public: void input (); void output(); void setReal ( int ); int getReal (); void setImaginary ( int ); int getImaginary(); ComplexNumbers(); ComplexNumbers(int); ComplexNumbers(int, int); friend bool operator == (ComplexNumbers , ComplexNumbers); friend ComplexNumbers operator + (ComplexNumbers , ComplexNumbers); friend ComplexNumbers operator - (ComplexNumbers , ComplexNumbers); friend ComplexNumbers operator * (ComplexNumbers , ComplexNumbers); friend ComplexNumbers operator - (ComplexNumbers); }; void ComplexNumbers::setReal(int x) { real=x; } void ComplexNumbers::setImaginary(int y) { imaginary=y; } int ComplexNumbers::getReal() { return real; } int ComplexNumbers::getImaginary() { return imaginary; } //default constructor ComplexNumbers::ComplexNumbers() { real=0; imaginary=0; } //single parameterized constructor ComplexNumbers:: ComplexNumbers(int z) { real=z; } //two parameterized constructor ComplexNumbers::ComplexNumbers(int r,int u) { real = r; imaginary= u; } void ComplexNumbers::input () { int aReal(0),bImaginary(0); cout<<\"enter real no\"<>aReal; cout<<\"enter imaginary\"<>bImaginary; real = aReal; imaginary = bImaginary; } /* int real,imaginary; cout<<\"enter real no\"<>real; cout<<\"enter imaginary\"<>imaginary;*/ void ComplexNumbers::output() { cout<<\"the complex no is\"< Solution Your program is well-written. Apart from overloading the binary and unary operators. I have modified your code and changed \"int\" to \"double\" in Constructors, and some methods. FYI. Accessors are nothing but \"get\" methods in a class Mutators are overloaded operators +,-,*. Means these operators are mutated over your \"ComplexNumbers\" class. The following is the modified program: #include using namespace std; class ComplexNumbers { private: double real; double imaginary; public: void input (); void output(); void setReal ( double ); double getReal (); void setImaginary ( double ); double getImaginary(); ComplexNumbers(); ComplexNumbers(double); ComplexNumbers(double,double); bool operator == (ComplexNumbers&); ComplexNumbers operator + (ComplexNumbers&); ComplexNumbers operator - (ComplexNumbers&); ComplexNumbers operator * (ComplexNumbers&); ComplexNumbers operator - ();//unary minus }; void ComplexNumbers::setReal(double x) { real=x; } void ComplexNumbers::setImaginary(double y) { imaginary=y; } double ComplexNumbers::getReal() { return real; } double ComplexNumbers::getImaginary() { return imaginary; } //default constructor ComplexNumbers::ComplexNumbers() { real=0; imaginary=0; } //single parameterized constructor ComplexNumbers:: ComplexNumbers(double z) { real=z; } //two parameterized constructor ComplexNumbers::ComplexNumbers(double r,double u) { real = r; imaginary= u; } void ComplexNumbers::input () { int aReal(0),bImaginary(0); cout<<\.

C++ AssignmentPlease read all the requirements and the overloading.pdf

C++ AssignmentPlease read all the requirements and the overloading.pdf

C++ AssignmentPlease read all the requirements and the overloading.pdf

lakshmijewellery

Welcome to Modern C++

Welcome to Modern C++

Welcome to Modern C++

On March 4 of the current year, Barefoot Bay, Inc. reacquired 5,000 shares of its common stock at $89 per share. On August 7, Barefoot Bay sold 3,500 of the reacquired shares at $100 per share. The remaining 1,500 shares were sold at $88 per share on November 29. 1. Journalize the transactions of March 4, August 7, and November 29. If an amount box does not require an entry, leave it blank or enter \"0\". 2. What is the balance in Paid-in Capital from Sale of Treasury Stock on December 31 of the current year? $Mar. 4Aug. 7Nov. 29 Solution 4-Mar Treasury stock 445000 =5000*89 Cash 445000 7-Aug Cash 350000 =3500*100 Treasury stock 311500 =3500*89 Paid in capital-Treasury stock 38500 29-Nov Cash 132000 =1500*88 Paid in capital-Treasury stock 1500 Treasury stock 133500 =1500*89 2 Balance in Paid-in Capital from Sale of Treasury Stock = 38500-1500 = $37000.

OverviewWe will be adding some validation to our Contact classes t.pdf

OverviewWe will be adding some validation to our Contact classes t.pdf

OverviewWe will be adding some validation to our Contact classes t.pdf

I have tried running this code below, and it is working, but the accuracy is less than expected. import os import numpy as np import pandas as pd import keras import tensorflow as tf from keras.preprocessing.image import ImageDataGenerator from keras.utils import load_img from keras.utils import to_categorical from sklearn.model_selection import train_test_split import matplotlib.pyplot as plt import random from keras.models import Sequential from keras.layers import Conv2D, MaxPooling2D, MaxPool2D , Dropout, Flatten, Dense, Activation, BatchNormalization from keras.callbacks import EarlyStopping, ReduceLROnPlateau from sklearn.utils import class_weight import keras,os from keras.models import Sequential from keras.layers import Dense, Conv2D, MaxPool2D , Flatten from keras.preprocessing.image import ImageDataGenerator import numpy as np from keras.optimizers import Adam from keras.callbacks import ModelCheckpoint, EarlyStopping from sklearn.metrics import accuracy_score, f1_score, precision_score, recall_score, cohen_kappa_score, roc_auc_score print(os.listdir("D:\RansomSecondApproach\Ransomware_Detection_using _CNN\MixImages")) # Define Constants FAST_RUN = False IMAGE_WIDTH=256 # 150 accept maybe 256 IMAGE_HEIGHT=256 # maybe 256 IMAGE_SIZE=(IMAGE_WIDTH, IMAGE_HEIGHT) IMAGE_CHANNELS=3 # maybe not need physical_devices = tf.config.experimental.list_physical_devices('GPU') print(physical_devices) if physical_devices: tf.config.experimental.set_memory_growth(physical_devices[0], True) # Prepare Traning Data filenames = os.listdir("D:\RansomSecondApproach\Ransomware_Detection_using _CNN\MixImages") categories = [] for filename in filenames: category = filename.split('l')[0] if category == 'image_benign_': categories.append(0) else: categories.append(1) df = pd.DataFrame({ 'filename': filenames, 'category': categories }) print(df.head()) print(df.tail()) # in collab it will work df['category'].value_counts().plot.bar() model = Sequential() model.add(Conv2D(16, (3, 3), activation='relu', input_shape=(IMAGE_WIDTH, IMAGE_HEIGHT, IMAGE_CHANNELS))) model.add(BatchNormalization()) model.add(MaxPooling2D(pool_size=(2, 2))) model.add(Dropout(0.25)) model.add(Conv2D(32, (3, 3), activation='relu')) model.add(BatchNormalization()) model.add(MaxPooling2D(pool_size=(2, 2))) model.add(Dropout(0.25)) model.add(Conv2D(64, (3, 3), activation='relu')) model.add(BatchNormalization()) model.add(MaxPooling2D(pool_size=(2, 2))) model.add(Dropout(0.25)) model.add(Flatten()) model.add(Dense(512, activation='relu')) model.add(BatchNormalization()) model.add(Dropout(0.5)) model.add(Dense(2, activation='softmax')) # 2 because we have cat and dog classes model.compile(loss='categorical_crossentropy', optimizer='adam', metrics=['accuracy']) # Callbacks ## Early Stop To prevent over fitting we will stop the learning after 10 epochs and val_loss value not decreased earlystop = EarlyStopping(patience=10) # Learning Rate Reduction learning_rate_reduction = ReduceLROnPlateau(mon.

I have tried running this code below- and it is working- but the accur.pdf

I have tried running this code below- and it is working- but the accur.pdf

I have tried running this code below- and it is working- but the accur.pdf

GordonF2XPatersonh

Complete the following code segment to handle potential zero denominators. When there is a zero denominator, use "zero denominator" as the message to pass to the exception object. You may get the message from an exception object by using e.getMessage(). Sample run Input: Output: Test import java.util.Scanner; import chapter11.fraction.Fraction; import chapter11.fraction.exception.ZeroDenominatorException; public class Test { public static void main(String[] args) { Scanner stdin = new Scanner(System.in); try { Fraction fraction = new Fraction(stdin.nextInt(), stdin.nextInt()); fraction.print(); fraction = new Fraction(stdin.nextInt(), stdin.nextInt()); fraction.print(); fraction = new Fraction(stdin.nextInt(), stdin.nextInt()); fraction.print(); fraction = new Fraction(stdin.nextInt(), stdin.nextInt()); fraction.print(); } // code starts here /code ends here } } ZeroDenominatorException package chapter11.fraction.exception; // code starts here // code ends here Fraction package chapter11.fraction; import chapter11.fraction.exception.ZeroDenominatorException; public class Fraction { private int num; private int denom; // code starts here // code ends here public Fraction() throws ZeroDenominatorException { this (1,1); } public Fraction add(Fraction frac) throws ZeroDenominatorException { int n = this.num * frac.denom + this.denom * frac.num; int d = this.denom * frac.denom; return new (n, d); } public Fraction sub(Fraction frac) throws ZeroDenominatorException { int n = this.num * frac.denom - this.denom * frac.num; int d = this.denom * frac.denom; return new (n, d); } public Fraction mult(Fraction frac) throws ZeroDenominatorException { int n = this.num * frac.num; int d = this.denom * frac.denom; return new (n, d); } public Fraction div(Fraction frac) throws ZeroDenominatorException { int n = this.num * frac.num; int d = this.denom * frac.denom; return new (n, d); } public void print() { if (num != 0 && denom != 0) { System.out.println(num + "/" + denom); } else if (num ==0) { System.out.print(0); } else { System.out.println("NaF"); } } public int getNum() { return this.num; } public int getDenom() { return this.denom; } }.

Complete the following code segment to handle potential zero denomin.pdf

Complete the following code segment to handle potential zero denomin.pdf

Complete the following code segment to handle potential zero denomin.pdf

americanopticalscbe

Chainer-Compiler 動かしてみた

Chainer-Compiler 動かしてみた

Chainer-Compiler 動かしてみた

Can someone please explain what the code below is doing and comment on its network performance? Please and thank you. import numpy as np import matplotlib.pyplot as plt import keras from keras.layers import Input, Dense, Reshape, Flatten, Dropout from keras.layers import BatchNormalization, Activation, ZeroPadding2D from keras.layers import LeakyReLU from keras.layers.convolutional import UpSampling2D, Conv2D from keras.models import Sequential, Model from keras.optimizers import Adam,SGD from keras.datasets import cifar10 #Loading the CIFAR10 data (X, y), (_, _) = keras.datasets.cifar10.load_data() #Selecting a single class of images #The number was randomly chosen and any number #between 1 and 10 can be chosen X = X[y.flatten() == 8] #Defining the Input shape image_shape = (32, 32, 3) latent_dimensions = 100 #Define a utility function to build the generator. def build_generator(): model = Sequential() #Building the input layer model.add(Dense(128 * 8 * 8, activation="relu", input_dim=latent_dimensions)) model.add(Reshape((8, 8, 128))) model.add(UpSampling2D()) model.add(Conv2D(128, kernel_size=3, padding="same")) model.add(BatchNormalization(momentum=0.78)) model.add(Activation("relu")) model.add(UpSampling2D()) model.add(Conv2D(64, kernel_size=3, padding="same")) model.add(BatchNormalization(momentum=0.78)) model.add(Activation("relu")) model.add(Conv2D(3, kernel_size=3, padding="same")) model.add(Activation("tanh")) #Generating the output image noise = Input(shape=(latent_dimensions,)) image = model(noise) return Model(noise, image) #Define a utility function to build the discriminator. def build_discriminator(): #Building the convolutional layers #to classify whether an image is real or fake model = Sequential() model.add(Conv2D(32, kernel_size=3, strides=2, input_shape=image_shape, padding="same")) model.add(LeakyReLU(alpha=0.2)) model.add(Dropout(0.25)) model.add(Conv2D(64, kernel_size=3, strides=2, padding="same")) model.add(ZeroPadding2D(padding=((0,1),(0,1)))) model.add(BatchNormalization(momentum=0.82)) model.add(LeakyReLU(alpha=0.25)) model.add(Dropout(0.25)) model.add(Conv2D(128, kernel_size=3, strides=2, padding="same")) model.add(BatchNormalization(momentum=0.82)) model.add(LeakyReLU(alpha=0.2)) model.add(Dropout(0.25)) model.add(Conv2D(256, kernel_size=3, strides=1, padding="same")) model.add(BatchNormalization(momentum=0.8)) model.add(LeakyReLU(alpha=0.25)) model.add(Dropout(0.25)) #Building the output layer model.add(Flatten()) model.add(Dense(1, activation='sigmoid')) image = Input(shape=image_shape) validity = model(image) return Model(image, validity) #Step 6: Define a utility function to display the generated images. def display_images(): r, c = 4,4 noise = np.random.normal(0, 1, (r * c,latent_dimensions)) generated_images = generator.predict(noise) #Scaling the generated images generated_images = 0.5 * generated_images + 0.5 fig, axs = plt.subplots(r, c) count = 0 for i in range(r): for j in range(c): axs[i,j].imshow(ge.

Can someone please explain what the code below is doing and comment on.pdf

Can someone please explain what the code below is doing and comment on.pdf

Can someone please explain what the code below is doing and comment on.pdf

kuldeepkumarapgsi

Practice

C# 6 Write a program that creates a Calculation Class Use the following Code and Implement as a class. using System.IO; using System; class Program { static void Main() { int first, second; Console.WriteLine(\"Enter first number: \"); first=Convert.ToInt32(Console.ReadLine()); Console.WriteLine(\"Enter second number: \"); second=Convert.ToInt32(Console.ReadLine()); int sum = add(first, second); Console.WriteLine(\"The sum is \"+sum); } static int add(int a, int b){ int sum = 0; sum = a + b; return sum; } } The class will have properties for the two numbers the user inputs The class will have methods to: Prompt the user to input two numbers Output results YOU WILL NEED TO IMPLEMENT ERROR HANDLING IN CASE OF BAD INPUT! Solution # include using namespace std; int main() { char o; float num1,num2; cout << \"Enter operator either + or - or * or /: \"; cin >> o; cout << \"Enter two operands: \"; cin >> num1 >> num2; switch(o) { case \'+\': cout << num1+num2; break; case \'-\': cout << num1-num2; break; case \'*\': cout << num1*num2; break; case \'/\': cout << num1/num2; break; default: /* If operator is other than +, -, * or /, error message is shown */ cout << \"Error! operator is not correct\"; break; } return 0; }.

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

Similaire à Please write a new code as i need mines to be written differently than.docx (17)

Smart Pointer in C++

Smart Pointer in C++

Smart Pointer in C++

Describe the complete pipeline in ML using programming through PyTorch.pdf

Describe the complete pipeline in ML using programming through PyTorch.pdf

Describe the complete pipeline in ML using programming through PyTorch.pdf

Analysis of Microsoft Code Contracts

Analysis of Microsoft Code Contracts

Analysis of Microsoft Code Contracts

You will write a multi-interface version of the well-known concentra.pdf

You will write a multi-interface version of the well-known concentra.pdf

You will write a multi-interface version of the well-known concentra.pdf

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

WINSEM2016-17_CSE1002_LO_1336_24-JAN-2017_RM003_session 10.pptx

Please follow the code and comments for description and outputs C.pdf

Please follow the code and comments for description and outputs C.pdf

Please follow the code and comments for description and outputs C.pdf

Import java

AnswerNote Provided code shows several bugs, hence I implemented.pdf

AnswerNote Provided code shows several bugs, hence I implemented.pdf

AnswerNote Provided code shows several bugs, hence I implemented.pdf

C++ AssignmentPlease read all the requirements and the overloading.pdf

C++ AssignmentPlease read all the requirements and the overloading.pdf

C++ AssignmentPlease read all the requirements and the overloading.pdf

Welcome to Modern C++

Welcome to Modern C++

Welcome to Modern C++

OverviewWe will be adding some validation to our Contact classes t.pdf

OverviewWe will be adding some validation to our Contact classes t.pdf

OverviewWe will be adding some validation to our Contact classes t.pdf

I have tried running this code below- and it is working- but the accur.pdf

I have tried running this code below- and it is working- but the accur.pdf

I have tried running this code below- and it is working- but the accur.pdf

Complete the following code segment to handle potential zero denomin.pdf

Complete the following code segment to handle potential zero denomin.pdf

Complete the following code segment to handle potential zero denomin.pdf

Chainer-Compiler 動かしてみた

Chainer-Compiler 動かしてみた

Chainer-Compiler 動かしてみた

Can someone please explain what the code below is doing and comment on.pdf

Can someone please explain what the code below is doing and comment on.pdf

Can someone please explain what the code below is doing and comment on.pdf

Practice

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

C# 6Write a program that creates a Calculation ClassUse the foll.pdf

Plus de helenc18

The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m. Solution given P = 3.8*10^26 W r = 5.8*10^10 m A = 5 m^2 Intensity of radiation at the surface of the Mercury, I = Power/Area = P/(4*pi*r^2) = 3.8*10^26/(4*pi*(5.8*10^10)^2) = 8989 W/m^2 Radiation pressure on completely oborbing surface, P = I/c = 8989/(3*10^8) = 2.996*10^-5 N so, Force due to radiation, F = P*A = 2.996*10^-5*5 = 1.50*10^-4 N <<<<<<<<-------Answer .

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction. Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Solution 1) Land: fair value $75,000 cash:paid + $17,000 New parcel = $92,000 2) New parcel = $92,000 Gain on exchnage = $43,500 cash = $17,000 land = $31,500 3) New parcel = $48,500 cash = $17,000 land = $31,500 .

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following: A. What are the duties of the budget office? (Hint: Use the About Us link.) B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function. C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues. D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.) E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) F. What did you learn from reviewing the most recent budget of the State of Rhode Island? Solution E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) .

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated. .

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____. A. reflection B. refraction C. constructive interference D. destructive interference 14. Sound Waves Choose One â€¢ 5 points Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit. electromagnetic wave electrons magnetic field medium 15. The Doppler Effect Choose One â€¢ 5 points However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound. perpendicular to away from towards at the same speed as bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster Solution 1) Reflection . Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated. 2) Medium Sound waves require matter to transmit them, unlike light waves. 3) Towards The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound. .

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking: Solution B > E > C = F > A > D let F is the magnitude of force and L is the total length. A) TA = -F*(L/4) - F*(L/4) = -F*L/2 B) TB = F*(L/2) + F*(L/2) = F*L C) TC = F*(L/4) + F*(L/4) = F*L/2 D) TD = F*(L/2) - F*(L/4) + F0 = F*L/4 E) TE = F*(L/2) + F*(L/2) - F*(L/4) = (3/4)*F*L F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4) = F*L/2 .

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field? How do you anticipate the PR field changing in response to those technologies? Explain your answer carefully, citing specific examples of technology or real-life examples from the news. Solution PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc .

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn\'t actually grow Solution 3. increases in technology and capital raised labor productivity .

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain. Solution The payment of cash dividends to shareholders is classified as a financing activity. FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders. In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section. Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity. Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise). Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders. Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section. NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity. .

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves. Solution Following factors influence the precipitation volumetric analysis. 1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation. 2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions. 3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate. 4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph. 5. Temperature is directly proportional to the precipitation. 6. Foreign elements present decrease the stability of product as they can show coprecipitation. 4. .

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand Solution Answer - Similarties - Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine. both have a phosphate groups in their nucleotides. Difference - DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone. DNA contain thymine, while RNA contain uracil. complementary strand - PAIR ATÂ Â ;GC........write pair TACTAACTGTAACTCCTAGGTA .

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.) Solution Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have, .

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review. Q2. Write a biography paragraph about the scientist: Ohm. Solution Name : George Simon Ohm. He is a German Physicist. Total Life : March 16 th 1789 to July 6 th 1854. ( 65 years 3 months and 20 days ) Studies : he studied the subjects are Maths , Physics , Chemistry , Philosophy. he is a doctorate from Erlangen University. ( October 25 th 1811 ) Teaching carrier : He worked as a Teacher and Professor in various Posistions and in various places. Invention : Ohm\'s Law. V = i R V = voltage i = current R = resistance Famous Law which will be useful in the total electricity concepts. Awards : Copley Medal in the year of 1841. and Scintific career. Area of interests : Physics Especially in Electric fields. .

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

please write carefully and explain clearly. Thank you. Solution Ksp of CoCO3 = 1*10^-10 CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq) s s Ksp = [Co^2+][CO3^2-] Ksp = s*s Ksp = s^2 1*10^-10 = s^2 s^2 = 1*10^-10 s = 1*10^-5 mole/L molar mass of CoCO3 = 118.94g/mole solubility of cobalt(II) carbonate = 1*10^-5 mole/L = 1*10^-5 mole/L * 118.94g/mole = 1.1894*10^-3g/L = 1.1894mg/L The solubility of CoCO3 = 1.1894mg/L .

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority Solution 1.Waste Prevention:Waste prevention also called â€œsource reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane 2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils. 3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion. .

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

present synchronized savage code while (1) { getServingFromPot (); eat (); } present synchronized cook code here while (1) { refillPot (); } Solution servings = 0 mutex = Semaphore(1) emptyPot = Semaphore(0) fullPot = Semaphore(0) <Cook> while true: emptyPot.wait() putServingsInPot(M) fullPot.signal() <Savage> while true: mutex.wait() if servings == 0: emptyPot.signal() fullPot.wait() servings = M servings -= 1 getServingFromPot() mutex.signal() eat() .

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

Prepare general journal entries to record the following transactions for the Harris Company. (The company uses the balance sheet approach for recording bad debts expense.) 2010 Dec. 31 Recorded Bad Debts Expense, $800 2011 Jan. 3 Wrote off Jalâ€™s account as uncollectible, $60 Mar. 4 Wrote off Hallâ€™s account as uncollectible, $75 Jul. 5 Recovered $45 from Hall Aug. 19 Wrote off M. Wilsonâ€™s account as uncollectible, $100 Nov. 7 Recovered $25 from Jal Solution (1) Dec 31, 2010 DR Bad Debt Expense $800 Accounts Receivable $800 (To record bad debt expense) (2) Jan 3, 2011 DR Allowance for uncollectible receivable $60 Accounts receivable $60 (To record write-off of Jal\'s account as uncollectible) (3) Mar 4, 2011 DR Allowance for uncollectible receivable $75 Accounts receivable $75 (To record write-off of Hall\'s account as uncollectible) (4) Jul 5, 2011 DR Cash $45 Bad debt recovered (Income) $45 (To record partial recovery of bad debt from Hall) (5) Aug 19, 2011 DR Allowance for uncollectible receivable $100 Accounts receivable $100 (To record write-off of M. Wilson\'s account as uncollectible) (6) Nov 7, 2011 DR Cash $25 Bad debt recovered (Income) $25 (To record partial recovery of bad debt from Jal) .

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)? Solution Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc. Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively. Different technological specifications important to be implemented in a website design are mentioned below: Technological specification varies on the basis of website or system being designed. .

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting. Solution Reason One The increasing use of Internet of Thing In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws. Since these devices werenâ€™t originally registered on network, they may not have enough cybersecurity protections. so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization. Reason 2 The Breaches are a financial burden Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization. Reason 3 the real threats are insider threats The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes. Reason 4 Without cybersecurity the reputation of the organization is at risk. If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization .

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Plus de helenc18 (19)

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Dernier

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

Elizabeth Walsh

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

MaritesTamaniVerdade

General Principles of Intellectual Property: Concepts of Intellectual Proper...

General Principles of Intellectual Property: Concepts of Intellectual Proper...

General Principles of Intellectual Property: Concepts of Intellectual Proper...

Poonam Aher Patil

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

dhanjurrannsibayan2

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Basic Civil Engineering notes first year Notes Building notes Selection of site for Building Layout of a Building What is Burjis, Mutam Building Bye laws Basic Concept of sunlight ventilation in building National Building Code of India Set back or building line Types of Buildings Floor Space Index (F.S.I) Institutional Vs Educational Building Components & function Sills, Lintels, Cantilever Doors, Windows and Ventilators Types of Foundation AND THEIR USES Plinth Area Shallow and Deep Foundation Super Built-up & carpet area Floor Area Ratio (F.A.R) RCC Reinforced Cement Concrete RCC VS PCC

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Food safety_Challenges food safety laboratories_.pdf

Food safety_Challenges food safety laboratories_.pdf

Food safety_Challenges food safety laboratories_.pdf

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

Micro-Scholarship, What it is, How can it help me.pdf

Micro-Scholarship, What it is, How can it help me.pdf

Micro-Scholarship, What it is, How can it help me.pdf

𝐋𝐞𝐬𝐬𝐨𝐧 𝐎𝐮𝐭𝐜𝐨𝐦𝐞𝐬: -Discern accommodations and modifications within inclusive classroom environments, distinguishing between their respective roles and applications. -Through critical analysis of hypothetical scenarios, learners will adeptly select appropriate accommodations and modifications, honing their ability to foster an inclusive learning environment for students with disabilities or unique challenges.

Understanding Accommodations and Modifications

Understanding Accommodations and Modifications

Understanding Accommodations and Modifications

Fostering Friendships - Enhancing Social Bonds in the Classroom

Fostering Friendships - Enhancing Social Bonds in the Classroom

Fostering Friendships - Enhancing Social Bonds in the Classroom

Pooky Knightsmith

ICT role in 21st century education and it's challenges.

ICT role in 21st century education and it's challenges.

ICT role in 21st century education and it's challenges.

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

RamjanShidvankar

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Dr. Sarita Anand

Dernier (20)

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

Sensory_Experience_and_Emotional_Resonance_in_Gabriel_Okaras_The_Piano_and_Th...

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

General Principles of Intellectual Property: Concepts of Intellectual Proper...

General Principles of Intellectual Property: Concepts of Intellectual Proper...

General Principles of Intellectual Property: Concepts of Intellectual Proper...

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Food safety_Challenges food safety laboratories_.pdf

Food safety_Challenges food safety laboratories_.pdf

Food safety_Challenges food safety laboratories_.pdf

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

Micro-Scholarship, What it is, How can it help me.pdf

Micro-Scholarship, What it is, How can it help me.pdf

Micro-Scholarship, What it is, How can it help me.pdf

Understanding Accommodations and Modifications

Understanding Accommodations and Modifications

Understanding Accommodations and Modifications

Fostering Friendships - Enhancing Social Bonds in the Classroom

Fostering Friendships - Enhancing Social Bonds in the Classroom

Fostering Friendships - Enhancing Social Bonds in the Classroom

ICT role in 21st century education and it's challenges.

ICT role in 21st century education and it's challenges.

ICT role in 21st century education and it's challenges.

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Interdisciplinary_Insights_Data_Collection_Methods.pptx

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Please write a new code as i need mines to be written differently than.docx

1. Please write a new code as i need mines to be written differently than the one ALREADY answered here. Thanks client and output provided Here is the client program that you must use to test your classes. Here is the correct output. Your output should match this exactly except where random numbers are used. Solution class creature { private : int type; int strength; int hitpoints; string getspecies() const; public: creature(); creature (int newtype, int newstrength, int newhitpoints); int getDamage() const; };

2. string creature :: getspecies() const{ switch(type); { case 0: return "Human"; case 1: retrun "Cyberdemon"; case 2: return "balrog"; case 3: return "Elf"; } return unkown; } int creature :: getDamage(){ int damage; damage=(rand()%strength)+1; cout<<getspecies()<<"attacks for"<<damage<<"point"<<endl; if(type==2 || type==1){ if (rand()%4==0) { damage=damage+50; cout<<"Denomic attacks inflicts 50 Additional damage point:"<<endl;

3. } } if(type ==3) { if rand()%2==0) { cout<<"Magical attacks inflict"<<damage<<"Additional damage points:"<<endl; damage*=2; } } if (type==2) { int damage2=rand()%strength)+1; cout<<"balrog speed attack inflicts"<<damage2<<"Additional damage points:"<<endl; damage=damage+damage2; } return damage; }