Polk and Stoneman is a public accounting firm that offers two primary.docx

•Télécharger en tant que DOCX, PDF•

0 j'aime•20 vues

Polk and Stoneman is a public accounting firm that offers two primary services, auditing and tax-return preparation. A controversy has developed between the partners of the two service lines as to who is contributing the greater amount to the bottom line. The area of contention is the assignment of overhead. The tax partners argue for assigning overhead on the basis of 40% of direct labor dollars, while the audit partners argue for implementing activity-based costing. The partners agree to use next year\'s budgeted data for purposes of analysis and comparison. The following overhead data are collected to develop the comparison. Solution predetermined overhead rate = Overhead /40% of direct labo dollars = 710,000 / [ .40 * 1,775,000] = 710,000 / 710,000 = $ 1 per direct labor dollar .

Formation

Contenu connexe

Similaire à Polk and Stoneman is a public accounting firm that offers two primary.docx

Acc 418 Enhance teaching / snaptutorial.com

Davis106

Acc 418 Education Redefined - snaptutorial.com

DavisMurphyC69

OIC Demo

Abhijit Chakraborty

CBRE is one of the nation's leading providers of cost segregation and consulting services to real estate owners. CBRE works together with CPA firms and their clients to reclassify commercial real estate assets which results in accelerated depreciation, lower taxes and increased cash flow. This specialized engineering practice has literally uncovered millions of dollars in additional tax benefits for constructed, acquired, expanded or remodeled commercial real estate.

CBRE Cost Segregation- Tax Benefits for Commercial Property Owners

bcward

ACC 418 Effective Communication/tutorialrank.com

jonhson247

Chapter 4: Financial Statement Analysis

Nada G.Youssef

CBRE Cost Seg for CPAs

bcward

The Accounting Cycle:Accruals and Deferrals

Muhammad Unaib Aslam

Which of the following is an advantage of corporations relative to partnerships and sole proprietorships? Reduced legal liability for investors. Harder to transfer ownership. Lower taxes. Most common form of organization. The group of users of accounting information charged with achieving the goals of the business is its managers. auditors. investors. creditors. Which of the following financial statements is concerned with the company at a point in time? Retained Earnings statement. Income statement. Statement of cash flows. Balance sheet. An income statement reports the changes in assets, liabilities, and stockholders’ equity over a period of time. presents the revenues and expenses for a specific period of time. reports the assets, liabilities, and stockholders’ equity at a specific date. summarizes the changes in retained earnings for a specific period of time. The most important information needed to determine if companies can pay their current obligations is the relationship between short-term and long-term liabilities. projected net income for next year. net income for this year. relationship between current assets and current liabilities. A liquidity ratio measures the ability of a company to survive over a long period of time. short-term ability of a company to pay its maturing obligations and to meet unexpected needs for cash. percentage of total financing provided by creditors. income or operating success of a company over a period of time. The convention of consistency refers to consistent use of accounting principles within industries. among accounting periods. among firms. throughout the accounting periods. Horizontal analysis is also known as linear analysis. vertical analysis. common size analysis. trend analysis. Horizontal analysis is a technique for evaluating a series of financial statement data over a period of time to determine the amount and/or percentage increase or decrease that has taken place. that has been arranged from the highest number to the lowest number. that has been arranged from the lowest number to the highest number. to determine which items are in error. Vertical analysis is a technique that expresses each item in a financial statement starting with the highest value down to the lowest value. as a percent of the item in the previous year. as a percent of a base amount. in dollars and cents. Process costing is used when production is aimed at filling a specific customer order. dissimilar products are involved. costs are to be assigned to specific jobs. the production process is continuous. An important feature of a job order cost system is that each job has its own distinguishing characteristics. must be completed before a new job is accepted. consists of one unit of output. must be similar to previous jobs completed. In a process cost system, product costs are summarized: on job cost sheets. w.

Which of the following is an advantage of corporations relative to.docx

alanfhall8953

ACC 418 Enhance teaching - tutorialrank.com

LeoTolstoy04

Which of the following is an advantage of corporations relative to partnerships and sole proprietorships? Lower taxes. Most common form of organization. Reduced legal liability for investors. Harder to transfer ownership. The group of users of accounting information charged with achieving the goals of the business is its auditors. investors. creditors. managers. Which of the following financial statements is concerned with the company at a point in time? Statement of cash flows. Retained Earnings statement. Balance sheet. Income statement. An income statement presents the revenues and expenses for a specific period of time. reports the changes in assets, liabilities, and stockholders’ equity over a period of time. reports the assets, liabilities, and stockholders’ equity at a specific date. summarizes the changes in retained earnings for a specific period of time. The most important information needed to determine if companies can pay their current obligations is the projected net income for next year. relationship between current assets and current liabilities. relationship between short-term and long-term liabilities. net income for this year. A liquidity ratio measures the income or operating success of a company over a period of time. ability of a company to survive over a long period of time. percentage of total financing provided by creditors. short-term ability of a company to pay its maturing obligations and to meet unexpected needs for cash. The convention of consistency refers to consistent use of accounting principles among firms. among accounting periods. throughout the accounting periods. within industries. Horizontal analysis is also known as vertical analysis. trend analysis. linear analysis. common size analysis. Horizontal analysis is a technique for evaluating a series of financial statement data over a period of time to determine the amount and/or percentage increase or decrease that has taken place. that has been arranged from the lowest number to the highest number. that has been arranged from the highest number to the lowest number. to determine which items are in error. Vertical analysis is a technique that expresses each item in a financial statement starting with the highest value down to the lowest value. in dollars and cents. as a percent of the item in the previous year. as a percent of a base amount. Process costing is used when production is aimed at filling a specific customer order. dissimilar products are involved. the production process is continuous. costs are to be assigned to specific jobs. An important feature of a job order cost system is that each job has its own distinguishing characteristics. must be completed before a new job is accepted. consists of one unit of output. must be similar to previous jobs completed. In a process cost system, product costs are summarized: after each unit is produced..

Which of the following is an advantage of corporations relative to.docx

philipnelson29183

Resume with 4 Excel Attachments 2-1-16

Victoria McGeehan

ARR,Cash payback,NPV,IRR.pptx

maishatasnimas

Measuring corporate performance

Algoix Technologies LLP

Ethics Case 11–10 Asset impairment • LO11–8 At the beginning of 2011, the Healthy Life Food Company purchased equipment for $42 million to be used in the manufacture of a new line of gourmet frozen foods. The equipment was estimated to have a 10-year service life and no residual value. The straight-line depreciation method was used to measure depreciation for 2011 and 2012. Late in 2013, it became apparent that sales of the new frozen food line were significantly below expectations. The company decided to continue production for two more years (2014 and 2015) and then discontinue the line. At that time, the equipment will be sold for minimal scrap values. The controller, Heather Meyer, was asked by Harvey Dent, the company's chief executive officer (CEO), to determine the appropriate treatment of the change in service life of the equipment. Heather determined that there has been an impairment of value requiring an immediate write-down of the equipment of $12,900,000. The remaining book value would then be depreciated over the equipment's revised service life. The CEO does not like Heather's conclusion because of the effect it would have on 2013 income. “Looks like a simple revision in service life from 10 years to 5 years to me,” Dent concluded. “Let's go with it that way, Heather.” Required: 1. What is the difference in before-tax income between the CEO's and Heather's treatment of the situation? 2. Discuss Heather Meyer's ethical dilemma. Ethics Case 11–10 Requirement 1 2013 expense using CEO's approach: $42,000,000 Cost $4,200,000 Previous annual depreciation ($42,000,000 ÷ 10 years) x 2 years 8,400,000 Depreciation to date (2011–2012) 33,600,000 Book value ÷ 3 Estimated remaining life (2013–2015) $11,200,000 New annual depreciation 2013 income would include only depreciation expense of $11,200,000. 2013 expense using Heather's approach: $42,000,000 Cost $4,200,000 Previous annual depreciation ($42,000,000 ÷ 10 years) x 2 years 8,400,000 Depreciation to date (2011–2012) 33,600,000 Book value 12,900,000 Write-down 20,700,000 New depreciable base ÷ 3 Estimated remaining life (2013–2015) $ 6,900,000 New annual depreciation 2013 income would include depreciation expense of $6,900,000 and an asset writedown of $12,900,000 for a total income reduction of $19,800,000. Using Heather's approach, 2013's before tax income would be lower by $8,600,000 ($19,800,000 – 11,200,000). Case 11–10 (concluded) Requirement 2 Discussion should include these elements. Facts: GAAP provides guidance for recording impairment losses on partial write-downs of property, plant, and equipment and intangible assets remaining in use. Assets should be written down if there has been a significant impairment of value such as in decreased product demand and full recovery of book value through use or resale is not expected. Although the decision and computa ...

Ethics Case 11–10 Asset impairment • LO11–8 At the.docx

gitagrimston

ACC 418 Exceptional Education / snaptutorial.com

donaldzs89

Acc 418 Extraordinary Success/newtonhelp.com

amaranthbeg135

BCC Case Study on Compliance

Jon Hansen

Acc 418 Education Specialist-snaptutorial.com

robertlesew44

Benchmarking Your Retirement Plan

bwalker648

Similaire à Polk and Stoneman is a public accounting firm that offers two primary.docx (20)

Acc 418 Enhance teaching / snaptutorial.com

Acc 418 Education Redefined - snaptutorial.com

OIC Demo

CBRE Cost Segregation- Tax Benefits for Commercial Property Owners

ACC 418 Effective Communication/tutorialrank.com

Chapter 4: Financial Statement Analysis

CBRE Cost Seg for CPAs

The Accounting Cycle:Accruals and Deferrals

Which of the following is an advantage of corporations relative to.docx

ACC 418 Enhance teaching - tutorialrank.com

Which of the following is an advantage of corporations relative to.docx

Resume with 4 Excel Attachments 2-1-16

ARR,Cash payback,NPV,IRR.pptx

Measuring corporate performance

Ethics Case 11–10 Asset impairment • LO11–8 At the.docx

ACC 418 Exceptional Education / snaptutorial.com

Acc 418 Extraordinary Success/newtonhelp.com

BCC Case Study on Compliance

Acc 418 Education Specialist-snaptutorial.com

Benchmarking Your Retirement Plan

Plus de helenc18

The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m. Solution given P = 3.8*10^26 W r = 5.8*10^10 m A = 5 m^2 Intensity of radiation at the surface of the Mercury, I = Power/Area = P/(4*pi*r^2) = 3.8*10^26/(4*pi*(5.8*10^10)^2) = 8989 W/m^2 Radiation pressure on completely oborbing surface, P = I/c = 8989/(3*10^8) = 2.996*10^-5 N so, Force due to radiation, F = P*A = 2.996*10^-5*5 = 1.50*10^-4 N <<<<<<<<-------Answer .

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

helenc18

The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction. Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Solution 1) Land: fair value $75,000 cash:paid + $17,000 New parcel = $92,000 2) New parcel = $92,000 Gain on exchnage = $43,500 cash = $17,000 land = $31,500 3) New parcel = $48,500 cash = $17,000 land = $31,500 .

The Tinsley Company exchanged land that it had been holding for future.docx

helenc18

The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following: A. What are the duties of the budget office? (Hint: Use the About Us link.) B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function. C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues. D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.) E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) F. What did you learn from reviewing the most recent budget of the State of Rhode Island? Solution E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) .

The State of Rhode Island publishes its budget and the various support.docx

helenc18

The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated. .

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

helenc18

The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____. A. reflection B. refraction C. constructive interference D. destructive interference 14. Sound Waves Choose One â€¢ 5 points Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit. electromagnetic wave electrons magnetic field medium 15. The Doppler Effect Choose One â€¢ 5 points However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound. perpendicular to away from towards at the same speed as bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster Solution 1) Reflection . Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated. 2) Medium Sound waves require matter to transmit them, unlike light waves. 3) Towards The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound. .

The sound strikes the cantina walls and bounces off at the same angle.docx

helenc18

The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking: Solution B > E > C = F > A > D let F is the magnitude of force and L is the total length. A) TA = -F*(L/4) - F*(L/4) = -F*L/2 B) TB = F*(L/2) + F*(L/2) = F*L C) TC = F*(L/4) + F*(L/4) = F*L/2 D) TD = F*(L/2) - F*(L/4) + F0 = F*L/4 E) TE = F*(L/2) + F*(L/2) - F*(L/4) = (3/4)*F*L F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4) = F*L/2 .

The six platforms below are initially at rest in deep space- The indic.docx

helenc18

The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field? How do you anticipate the PR field changing in response to those technologies? Explain your answer carefully, citing specific examples of technology or real-life examples from the news. Solution PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc .

The rise of various digital communication methods in the past decade h.docx

helenc18

The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn\'t actually grow Solution 3. increases in technology and capital raised labor productivity .

The reason that the increase in population growth in the 19th and 20th.docx

helenc18

The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain. Solution The payment of cash dividends to shareholders is classified as a financing activity. FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders. In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section. Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity. Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise). Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders. Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section. NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity. .

The sale of stock and the sale of bonds are reported as financing acti.docx

helenc18

Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves. Solution Following factors influence the precipitation volumetric analysis. 1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation. 2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions. 3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate. 4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph. 5. Temperature is directly proportional to the precipitation. 6. Foreign elements present decrease the stability of product as they can show coprecipitation. 4. .

Precipitation volumetric analysis involves formation reactions of solu.docx

helenc18

POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand Solution Answer - Similarties - Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine. both have a phosphate groups in their nucleotides. Difference - DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone. DNA contain thymine, while RNA contain uracil. complementary strand - PAIR ATÂ Â ;GC........write pair TACTAACTGTAACTCCTAGGTA .

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

helenc18

Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.) Solution Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have, .

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

helenc18

Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review. Q2. Write a biography paragraph about the scientist: Ohm. Solution Name : George Simon Ohm. He is a German Physicist. Total Life : March 16 th 1789 to July 6 th 1854. ( 65 years 3 months and 20 days ) Studies : he studied the subjects are Maths , Physics , Chemistry , Philosophy. he is a doctorate from Erlangen University. ( October 25 th 1811 ) Teaching carrier : He worked as a Teacher and Professor in various Posistions and in various places. Invention : Ohm\'s Law. V = i R V = voltage i = current R = resistance Famous Law which will be useful in the total electricity concepts. Awards : Copley Medal in the year of 1841. and Scintific career. Area of interests : Physics Especially in Electric fields. .

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

helenc18

please write carefully and explain clearly. Thank you. Solution Ksp of CoCO3 = 1*10^-10 CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq) s s Ksp = [Co^2+][CO3^2-] Ksp = s*s Ksp = s^2 1*10^-10 = s^2 s^2 = 1*10^-10 s = 1*10^-5 mole/L molar mass of CoCO3 = 118.94g/mole solubility of cobalt(II) carbonate = 1*10^-5 mole/L = 1*10^-5 mole/L * 118.94g/mole = 1.1894*10^-3g/L = 1.1894mg/L The solubility of CoCO3 = 1.1894mg/L .

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

helenc18

Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority Solution 1.Waste Prevention:Waste prevention also called â€œsource reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane 2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils. 3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion. .

Prioritize the three themes of integrated solid waste management- 1^st.docx

helenc18

present synchronized savage code while (1) { getServingFromPot (); eat (); } present synchronized cook code here while (1) { refillPot (); } Solution servings = 0 mutex = Semaphore(1) emptyPot = Semaphore(0) fullPot = Semaphore(0) <Cook> while true: emptyPot.wait() putServingsInPot(M) fullPot.signal() <Savage> while true: mutex.wait() if servings == 0: emptyPot.signal() fullPot.wait() servings = M servings -= 1 getServingFromPot() mutex.signal() eat() .

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

helenc18

Prepare general journal entries to record the following transactions for the Harris Company. (The company uses the balance sheet approach for recording bad debts expense.) 2010 Dec. 31 Recorded Bad Debts Expense, $800 2011 Jan. 3 Wrote off Jalâ€™s account as uncollectible, $60 Mar. 4 Wrote off Hallâ€™s account as uncollectible, $75 Jul. 5 Recovered $45 from Hall Aug. 19 Wrote off M. Wilsonâ€™s account as uncollectible, $100 Nov. 7 Recovered $25 from Jal Solution (1) Dec 31, 2010 DR Bad Debt Expense $800 Accounts Receivable $800 (To record bad debt expense) (2) Jan 3, 2011 DR Allowance for uncollectible receivable $60 Accounts receivable $60 (To record write-off of Jal\'s account as uncollectible) (3) Mar 4, 2011 DR Allowance for uncollectible receivable $75 Accounts receivable $75 (To record write-off of Hall\'s account as uncollectible) (4) Jul 5, 2011 DR Cash $45 Bad debt recovered (Income) $45 (To record partial recovery of bad debt from Hall) (5) Aug 19, 2011 DR Allowance for uncollectible receivable $100 Accounts receivable $100 (To record write-off of M. Wilson\'s account as uncollectible) (6) Nov 7, 2011 DR Cash $25 Bad debt recovered (Income) $25 (To record partial recovery of bad debt from Jal) .

Prepare general journal entries to record the following transactions f.docx

helenc18

Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)? Solution Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc. Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively. Different technological specifications important to be implemented in a website design are mentioned below: Technological specification varies on the basis of website or system being designed. .

Prepare functional specifications for the company-'s use of the Web an.docx

helenc18

Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting. Solution Reason One The increasing use of Internet of Thing In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws. Since these devices werenâ€™t originally registered on network, they may not have enough cybersecurity protections. so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization. Reason 2 The Breaches are a financial burden Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization. Reason 3 the real threats are insider threats The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes. Reason 4 Without cybersecurity the reputation of the organization is at risk. If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization .

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

helenc18

Plus de helenc18 (19)