SlideShare une entreprise Scribd logo
1  sur  27
A Genome Sequence Analysis System Built with Hypertable Doug Judd CEO, Hypertable, Inc.
Application Development Team ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
What is Hypertable? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Hypertable Deployments
Why NoSQL?
Source:  Nature 458, 719-724 (2009)
Source: wired.com, February 2011
Genomics 101
Base Pair (aka “base”) ,[object Object],[object Object],[object Object],[object Object],[object Object]
Gene ,[object Object],[object Object],[object Object],[object Object],[object Object]
Biological Samples ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Example Reads File GTGGATAGGGGGAGACTAATGTAGTATGATTATCATCATCAACAGAAGCTATGACACCAGGATAAA CATTTCTTATTGCTGAAAGTATTCTATTGTAGAGATGTACCACAATTTGGTTTCTGGTTTTGTATT GGGAGGATACTAGGGATTACTGAAGCCAACTTTGCAGACTCATACATTTGACTAGACACAGCC ACATTACAGTTTTCTGAGGAAAATTCTTAAGATGTTACCCCAAAACATAGCATTTTAAATTAAAAC GGACCGGCTGAAGCCATGGCAGAAGAACATAAATTGTGAAGATTTCATGGGCATTTATTAGTT GGAAGTGATAAGTGTCCATGAAATCTTCACAATTTATGTTCAGAGATTGCAGTAAAGACAGGTGTA AAGACACAGCAAAGCTAAGAGGACCCAACACACGGTAGGGTCGGGGACCTTGGAGAAACATGG TGGCTTCTTCCTACATGCTTGTGATAGATGACCAAAAAACATTTGTTGAGTTGATGAATAGTACAA AAAAGGGGCGGATAATAAATGAAAAGGGAATGTGCTGTTATTTCCTACTAAGATCAGAAAGAG ATATAAACAAAAGCTGTCATCACTTAGGGACTTCAGCCACATAAAACAATGTCAGGCTAGTCACTT AGAGCTTTGGGACTAGTTGAGTGGCAGCTTAACAAAGCAACGCAATATCCATAGGGATTGGGG ATATTTACATCTAGTGGATTCTACCAGTATGGTGGTCTTATGTGGACTGCACGTGGTTTTCTAGTA AGATAGCAGCTCTTCCCAAATTTATTTATAATTGTGGCATTATTTATAATATCAAAATATTAT GTTGCCAAAGGAGATTAACATTTGAGTCAGTGGGCGGGGTAAGGCCGACCTACCCTTAATCTGGTG GAGAAAGAAGCTGCTAATGGAGTTTAAAAGGTTACTGTCATTAATGAAAAATAAATTTACAGC CAGACATTTATGAACAGAAATGGGAAAAACACACTAGGAAAGCACTGCAAAGACTAATCTGTCTTT AAAGGAGATAGAGTGACTCCAGGCCCCTTAGAAATGACTATACCTGGCAGAGCATGCCAACTG ATGGGCTCGAGTCCTCACAAATATGAATTCCCCCTAAGTCTTGAGAGGTCATTTGTGCATTTGGAA GGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATCGTGAAAATGGTCATACTGCCCA GCGGGGTTTTTTTTTGTTTCATATTAACTTTAAAGTAGTTTTTTTCCATTTTGTGAAGAAAGACAT AAAGAACCAAGGCTAATAGTTGTTTGAGTTGTACTTACCATGTTGTTAAATGTCACCTCACAC CGCTGCCAGCCTATCAGAGCCGGGAATTACACCGTGCTTGGAGTTCTGGCACAGATCCACAGCTAC AGTTCTTCATTGTAAGAAATGGATGCTAACATGTAACAAGAAAACATCTGAAGGTTAAACTCA AATAAATGGGTTAATAGTTTGTCTTTCGGTCTTCATACTTTCAATATAAGTGGTTTACTTAGCCGA
Sequence Alignment ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Taxonomy ,[object Object],[object Object],[object Object],[object Object],[object Object]
GenBank ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Schema Design
Taxa Table ,[object Object],[object Object],CREATE TABLE Taxa (ID, Type, Children, Name); /1 ID 1 /1 ID :fullName /root /1 Type no rank /1 Children 1,10239,12884,12908,28384,131567 /1 Name root /1/10239 ID 10239 /1/10239 ID :fullName /root/Viruses /1/10239 Type superkingdom /1/10239 Children 12333,12429,12877,29258,35237, … /1/10239 Name Viruses /1/10239/12333 ID 12333 /1/10239/12333 ID :fullName /root/Viruses/unclassified phages /1/10239/12333 Type no rank /1/10239/12333 Children 12340,12347,12366,12371,12374, … /1/10239/12333 Name unclassified phages
Reads Table ,[object Object],[object Object],CREATE TABLE Reads (Sequence, Quality, GeneKey, Comments); AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  Sequence   ATCGCACCATTGAACTCCAGTC... AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  Quality   eeaeeeede_Ycc]dcacab... AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  Comments :qualityFilter  11071815... AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  Sequence   GGCTTACGCCTGTAATCCCAGC... AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  Quality   gfee_cgggegggecggggegc... AbCam1_100_ACAGTG,HWI...56#ACAGTG/1  GeneKey :gnl|GNOMON|1320663.m  11... AbCam1_100_ACAGTG,HWI...17#ACAGTG/1  Sequence   AGGATACGGAAGGCCCAAGGAG... AbCam1_100_ACAGTG,HWI...17#ACAGTG/1  Quality   cdd`dffffffgffgggegf^e... AbCam1_100_ACAGTG,HWI...17#ACAGTG/1  GeneKey :chr10  110718151643.1308... AbCam1_100_ACAGTG,HWI...80#ACAGTG/1  Sequence   ACGGAAGAGCACACGTCTGAAC... AbCam1_100_ACAGTG,HWI...80#ACAGTG/1  Quality   cbccb[^WUb]_b`_[bR_]... AbCam1_100_ACAGTG,HWI...80#ACAGTG/1  Comments :qualityFilter  11071815... AbCam1_100_ACAGTG,HWI...88#ACAGTG/1  Sequence   GAACTCCAGTCACACAGTGATC... AbCam1_100_ACAGTG,HWI...88#ACAGTG/1  Quality   eeeeeeeeeeeceeeeeaeeTQ... AbCam1_100_ACAGTG,HWI...88#ACAGTG/1  Comments :qualityFilter  11071815...
Genes Table ,[object Object],[object Object],CREATE TABLE Genes (Sequence, TaxID, ID, ReadID); 1000075  Sequence   GAATTCCATGGCAGTAAAACATCTTCCCTTC… 1000075  TaxID   9606 1000075  ID :name  HSLFBPS6 Human fructose-1,6-biphosphatase  1000075  ReadID :0310.Lane8big,HWI-EAS355:8:91:1231:1315#0/1 … 1000075  ReadID :0908.Mexus2.TATTAT,SCS:1:22:395:324#0/1_TA … 1000075  ReadID :0916.Enceph2,SCS:6:24:1519:513#0/1 1000075  ReadID :0916.Mexus,SCS:1:22:410:248#0/1 1000075  ReadID :0916.MonkeyAdeno,SCS:2:17:811:769#0/1 1000075  ReadID :0916.MonkeyAdeno,SCS:2:21:1132:1067#0/1 1000075  ReadID :0916.MonkeyAdeno,SCS:2:24:1207:492#0/1 1000075  ReadID :0916.MonkeyAdeno,SCS:2:33:1138:547#0/1 1000075  ReadID :0916.Parecho,SCS:3:4:679:1416#0/1|1 1000075  ReadID :HIV.HIV18_Lane7.s_7_sequence.AAA,SCS:7:30:688 … 1000075  ReadID :HIV.HIV18_Lane7.s_7_sequence.AAA,SCS:7:30:688 … 1000075  ReadID :HIV.HIV18_Lane7.s_7_sequence.unbiased,SCS:7:30 …
Monitoring Table Overview
Applications
Novel Virus Discovery ,[object Object],[object Object],[object Object],[object Object],[object Object]
Novel Virus Discovery Algorithm Detail ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Pathogen Discovery  in Cancer Samples ,[object Object],[object Object]
Taxonomic Tree Viewer ,[object Object],[object Object],[object Object]
Depletion Array (future) ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The End Questions?

Contenu connexe

Similaire à A Genome Sequence Analysis System Built With Hypertable

Bioinformatics MiRON
Bioinformatics MiRONBioinformatics MiRON
Bioinformatics MiRONPrabin Shakya
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshopc.titus.brown
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012Dan Gaston
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchDavid Ruau
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsDelaina Hawkins
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsGolden Helix Inc
 
Biomart Update
Biomart UpdateBiomart Update
Biomart Updatebosc
 
Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5Osama Barayan
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...Torsten Seemann
 
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLERHPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLERcscpconf
 
B Chapman - Toolkit for variation comparison and analysis
B Chapman - Toolkit for variation comparison and analysisB Chapman - Toolkit for variation comparison and analysis
B Chapman - Toolkit for variation comparison and analysisJan Aerts
 
Long vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is po.pdfLong vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is po.pdfbalrajashok
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchAnshika Bansal
 

Similaire à A Genome Sequence Analysis System Built With Hypertable (20)

Bioinformatics MiRON
Bioinformatics MiRONBioinformatics MiRON
Bioinformatics MiRON
 
poster
posterposter
poster
 
NCBI
NCBINCBI
NCBI
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
 
Biomart Update
Biomart UpdateBiomart Update
Biomart Update
 
MutaDATABASE
MutaDATABASEMutaDATABASE
MutaDATABASE
 
Bioinformatics t2-databases v2014
Bioinformatics t2-databases v2014Bioinformatics t2-databases v2014
Bioinformatics t2-databases v2014
 
Bioinformatica t2-databases
Bioinformatica t2-databasesBioinformatica t2-databases
Bioinformatica t2-databases
 
Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5
 
2012 03 01_bioinformatics_ii_les1
2012 03 01_bioinformatics_ii_les12012 03 01_bioinformatics_ii_les1
2012 03 01_bioinformatics_ii_les1
 
Ashg2014 grc workshop_schneider
Ashg2014 grc workshop_schneiderAshg2014 grc workshop_schneider
Ashg2014 grc workshop_schneider
 
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...Bioinformatics tools for the diagnostic laboratory -  T.Seemann - Antimicrobi...
Bioinformatics tools for the diagnostic laboratory - T.Seemann - Antimicrobi...
 
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLERHPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
 
B Chapman - Toolkit for variation comparison and analysis
B Chapman - Toolkit for variation comparison and analysisB Chapman - Toolkit for variation comparison and analysis
B Chapman - Toolkit for variation comparison and analysis
 
Long vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is po.pdfLong vs short read sequencing. Long read sequencing technology is po.pdf
Long vs short read sequencing. Long read sequencing technology is po.pdf
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences research
 

Dernier

What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?Antenna Manufacturer Coco
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxKatpro Technologies
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking MenDelhi Call girls
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessPixlogix Infotech
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slidevu2urc
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfThe Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfEnterprise Knowledge
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking MenDelhi Call girls
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 

Dernier (20)

What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your Business
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfThe Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 

A Genome Sequence Analysis System Built With Hypertable

  • 1. A Genome Sequence Analysis System Built with Hypertable Doug Judd CEO, Hypertable, Inc.
  • 2.
  • 3.
  • 6. Source: Nature 458, 719-724 (2009)
  • 9.
  • 10.
  • 11.
  • 12. Example Reads File GTGGATAGGGGGAGACTAATGTAGTATGATTATCATCATCAACAGAAGCTATGACACCAGGATAAA CATTTCTTATTGCTGAAAGTATTCTATTGTAGAGATGTACCACAATTTGGTTTCTGGTTTTGTATT GGGAGGATACTAGGGATTACTGAAGCCAACTTTGCAGACTCATACATTTGACTAGACACAGCC ACATTACAGTTTTCTGAGGAAAATTCTTAAGATGTTACCCCAAAACATAGCATTTTAAATTAAAAC GGACCGGCTGAAGCCATGGCAGAAGAACATAAATTGTGAAGATTTCATGGGCATTTATTAGTT GGAAGTGATAAGTGTCCATGAAATCTTCACAATTTATGTTCAGAGATTGCAGTAAAGACAGGTGTA AAGACACAGCAAAGCTAAGAGGACCCAACACACGGTAGGGTCGGGGACCTTGGAGAAACATGG TGGCTTCTTCCTACATGCTTGTGATAGATGACCAAAAAACATTTGTTGAGTTGATGAATAGTACAA AAAAGGGGCGGATAATAAATGAAAAGGGAATGTGCTGTTATTTCCTACTAAGATCAGAAAGAG ATATAAACAAAAGCTGTCATCACTTAGGGACTTCAGCCACATAAAACAATGTCAGGCTAGTCACTT AGAGCTTTGGGACTAGTTGAGTGGCAGCTTAACAAAGCAACGCAATATCCATAGGGATTGGGG ATATTTACATCTAGTGGATTCTACCAGTATGGTGGTCTTATGTGGACTGCACGTGGTTTTCTAGTA AGATAGCAGCTCTTCCCAAATTTATTTATAATTGTGGCATTATTTATAATATCAAAATATTAT GTTGCCAAAGGAGATTAACATTTGAGTCAGTGGGCGGGGTAAGGCCGACCTACCCTTAATCTGGTG GAGAAAGAAGCTGCTAATGGAGTTTAAAAGGTTACTGTCATTAATGAAAAATAAATTTACAGC CAGACATTTATGAACAGAAATGGGAAAAACACACTAGGAAAGCACTGCAAAGACTAATCTGTCTTT AAAGGAGATAGAGTGACTCCAGGCCCCTTAGAAATGACTATACCTGGCAGAGCATGCCAACTG ATGGGCTCGAGTCCTCACAAATATGAATTCCCCCTAAGTCTTGAGAGGTCATTTGTGCATTTGGAA GGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATCGTGAAAATGGTCATACTGCCCA GCGGGGTTTTTTTTTGTTTCATATTAACTTTAAAGTAGTTTTTTTCCATTTTGTGAAGAAAGACAT AAAGAACCAAGGCTAATAGTTGTTTGAGTTGTACTTACCATGTTGTTAAATGTCACCTCACAC CGCTGCCAGCCTATCAGAGCCGGGAATTACACCGTGCTTGGAGTTCTGGCACAGATCCACAGCTAC AGTTCTTCATTGTAAGAAATGGATGCTAACATGTAACAAGAAAACATCTGAAGGTTAAACTCA AATAAATGGGTTAATAGTTTGTCTTTCGGTCTTCATACTTTCAATATAAGTGGTTTACTTAGCCGA
  • 13.
  • 14.
  • 15.
  • 17.
  • 18.
  • 19.
  • 22.
  • 23.
  • 24.
  • 25.
  • 26.

Notes de l'éditeur

  1. Improvements in the rate of DNA sequencing over the past 30 years and into the future