Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.

TiReX: Tiled Regular eXpressionsmatching architecture

- Filippo Carloni, M.Sc. student in Computer Science and Engineering

Expressions (REs) are widely used to find patterns among data, like in genomic markers research for DNA analysis, signature-based detection for network intrusion detection systems, or search engines. TiReX is a novel and efficient RE matching architecture for
FPGAs, based on the concept of matching core. RE passes into the compilation and optimization phase to be efficiently translated into sequences of basic matching instructions that a matching core runs on input data, and can be replaced to change the RE to be matched.

  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

TiReX: Tiled Regular eXpressionsmatching architecture

  1. 1. TiReX: Tiled Regular eXpressions matching architecture Virtual NGC - Taverne d’Arbia (SI) July 19, 2020 Filippo Carloni, Davide Conficconi, Alessandro Comodi, Alberto Scolari, Marco Santambrogio {filippo.carloni, alessandro.comodi} @mail.polimi.it, {davide.conficconi, alberto.scolari, marco.santambrogio} @polimi.it
  2. 2. 2 Context Definition
  3. 3. 3 Context Definition Search Engine Web PagesUsers
  4. 4. 4 Context Definition Search Engine Web Pages Packets Analysis Accepted Packets Rejected Packets Entering PacketsUsers
  5. 5. 5 Context Definition Search Engine Web Pages Packets Analysis Accepted Packets Rejected Packets Entering Packets Genetic Market Research Patient DNA Personalized MedicineDNA Analysis Users
  6. 6. 6 Context Definition Regular Expressions (ACGT|AC)*TT
  7. 7. 7 Current Issues Flexibility Performance
  8. 8. 8 Current Issues Flexibility Performance Possible Solution
  9. 9. 9 Related Works NFA Directly implemented Fixed architecture relative to one RE Very fast Too Space for the NFA for large RE One character at time for base implementation
  10. 10. 10 Proposed Solution Customized Instruction Set Architecture (ISA) Custom processor written in VHDL and implemented on a FPGA Multi-core architecture
  11. 11. 11 Flow of RE Regular Expression Compiler 1 & ACGT 2 JIM offset 3 ( 4 |)* AC 5 & TT ACGTCGGGGCGTGCAAATGCCCCGTGCGATTTGCGTGACGTCGGGGCGTGCAAATGCCCC GTGCGATTTGCGTGACGTCGGGGCGTGCAAATGCCCCGTGCGATTTGCGTGACGTCGGGG CGTGCAAATGCCCCGTGCGATTTGCGTGCGTGCGATTTGCGTGACGTCGGGGCGTGCAAA CGTGCGATTTGCGTGACGTCGGGGCGTGCAAAGCTCGATCGATCGATCGA. Data Instruction Set Match results
  12. 12. 12 The Compiler Regular Expression Compiler 1 & ACGT 2 JIM offset 3 ( 4 |)* AC 5 & TT Instruction Set (ACGT|AC)*TT 1. Lexical Analyzer 2. Code Transformation 3. Code Optimization
  13. 13. 13 Single Core Architecture
  14. 14. 14 Board Test 1 Test 2 Test 3 Flex Intel i7, 2.80 GHz Exec. Time [µs] 271 121 263 Speedup 1X 1X 1X Grep (Xeon) Exec. Time [µs] 205 108.11 336.73 Speedup 1.32X 1.11X 0.78X PYNQ-Z1 8-core, 70.5 MHz Exec. Time [µs] 7.2 8.21 30.3 Speedup 37.63X 14.73X 8.67X VC707 16-core, 130.1 MHz Exec. Time [µs] 2.07 4.54 3.36 Speedup 130.9X 26.65X 78.27X VU9P (AWS) 16-core, 202.7 MHz Exec.Time [µs] 1.03 0.75 2.96 Speedup 263.11X 161.33X 88.85X Performance Analysis Latency Dataset Baseline
  15. 15. 15 Summary Fast Flexible (Customized ISA) Cross-Platform Design Strength Points Multi-core possibility
  16. 16. 16 Summary Fast Flexible (Customized ISA) Cross-Platform Design Strength Points Multi-core possibility Cover more types of regular expression Fix corner case bugs Work in progress ... Nondeterministic version
  17. 17. 17 Thank you Questions? Contacts Filippo Carloni, Davide Conficconi, Alessandro Comodi, Alberto Scolari, Marco Santambrogio {filippo.carloni, alessandro.comodi} @mail.polimi.it, {davide.conficconi, alberto.scolari, marco.santambrogio} @polimi.it

×