The document describes a thesis project that aims to isolate and characterize an extracellular antifungal protein (exAFP-C28) from an endophytic fungal isolate. The objectives are to isolate the fungal strain from a medicinal plant, optimize culture conditions, purify the protein, and determine its antifungal activity and mechanism of action against Candida albicans through assays and microscopy. Results showed that the protein was effective against C. albicans by disrupting cell membranes, had a molecular weight of 28.2 kDa, and likely forms amphipathic helices contributing to its antifungal activity.
Isolation and characterization of an extracellular antifungal protein from an endophytic fungal isolate
1. Thesis Project
Isolation and Characterization of an
Extracellular Antifungal Protein
from an Endophytic Fungal Isolate
Kamdar Maulik Rajendra (07BT3007)
Supervised by
Professor Mrinal Kumar Maiti
Department of Biotechnology, IIT Kharagpur
2. Introduction
Endophytes: “microbes that colonize living internal tissues of plants
without causing any immediate, overt negative effects”
Found in virtually every plant on earth.
Reside in the living tissues of the host plant and do so in a variety of
relationships ranging from symbiotic to pathogenic.
Plant host is able to supply the necessary nutrients and the compounds
required for the endophyte to complete its life cycle.
Fig. Endophyte grows inside cell
Fig. Endophyte Life Cycle
3. The Study of Endophytes
Increase of disease causing microbes, which are resistant to
drug therapy
New antibiotics, chemotherapeutic agents to cure diseases
Natural selection has been found to be superior to
combinatorial chemistry for discovering novel substances
Novel bio-molecules are obtained from organism, like
endophytic fungi, that inhabits novel biotope.
Plants are directly used as medicines by a majority of cultures
around the world, for example Chinese medicine and Indian
medicine (Ayurveda).
Endophytes produce a wide range of bioactive natural
compounds.
Medicinal plants are known to harbor Endophytic fungi.
This group of microbes are not extensively studied at all.
4. Objectives
Goal: To isolate and characterize an extracellular antifungal protein
(exAFP-C28) from endophytic fungi Colletotrichum sp. (Strain-DM06)
associated with a medicinal plant Ocimum sanctum.
Isolation and molecular identification of endophytic fungal strain
Study
of fungal growth on various culture conditions to find out the
characteristic changes in the expression of protein synthesis
Isolation and Purification of the extracellular antifungal protein exAFP-C28
Determine minimal inhibition concentration (MIC) against
Study the
Candida albicans
surface morphology of Candida albicans under effect of exAFP-C28
Determine effect of exAFP-C28 on membrane permeability
Evaluation of
hemolytic activity of exAFP-C28
Molecular Mass Determination and Protein Sequence Analysis
Bioinformatics
analysis of the primary amino acid sequence, homology
modeling and prediction of amphipathic nature of the helixes.
5. Isolation of endophytic fungi
1 min
Surface
sterilization
Fresh plant parts
Distilled water
Ethanol 95%
1 min
Distilled water
BLOT DRY
1 min
1 min
NaOCl 0.5%
Ethanol 95%
Cut in section
Incubate 25c for 7 days
6. Molecular Identification
1 ml of fungal culture which contains about 5 x 105 number of
spores is inoculated in 100 ml culture media.
Culture grown at 28°C for 48 Hrs.
Mycelia is harvested from liquid culture by filtration through
Whatman filter paper no1.
CTAB method used for fungal genomic DNA isolation.
Small subunit RNA (17-18S) primers
TR1
TR2
GTTTCTAGGACCGCCGTA
CTCAAACTTCCATCGACTTG
Internal transcribed spacer region primers
ITS1
ITS4
TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC
Amplification performed with a denaturation step of 94°C for 3 min
followed by 30 cycles of 94°C for 1 min denaturation, 55°C for 1
min, 72°C for 2 min and final extension of 72°C for 7 min.
The two amplified products (amplicons) were sequenced, and the
sequences were analyzed by NCBI blast search.
7. Optimization of Culture Conditions
Colletotrichum sp. (Strain-DM06) was cultivated in various
media. All liquid cultures were incubated in shaken 500 mL
flasks containing 250 mL of medium at 28 °C and 150 rpm.
The fungal isolate was cultivated in media containing
different carbon sources, nitrogen sources, and ambient pH.
Yeast extract peptone sucrose medium (YEPS)
Yeast extract peptone dextrose medium (YEPD)
Potato Dextrose Agarose Medium (PDA)
Czapek DOX Broth Medium (CDX)
8. Separation of the Crude Protein
The
media was inoculated and incubated at 150 rpm at 28oC
for around 4 days.
Mycelia separated by Whatman Filter paper no1.
206 gm of (NH4)2SO4 added in small quantities every 10
minutes at 4°C , to avoid denaturation.
Incubation for the entire night and centrifugation for 30
minutes at 4oC and 10000 rpm, and dissolution in
Ammonium acetate buffer provides the protein extract. It is
tested with Bradford’s reagent.
Process was repeated for at least 10 times.
Following steps involve dialysis and lyophilization.
Protein Gel was run with the materials being prepared as
stated above using a protein Gel apparatus.
9. Purification of the Crude Protein
Amicon Ultra 4 Centrifugal Filter Devices
Spin Conditions: 4 mL starting volume
Fixed angle (25 degree), 5000 × g at 25 °C
15 min spin for separation of protein ≥100 kDa
Fixed angle (25 degree), 7500 × g at 25 °C
5 min spin for separation of protein ≥ 50 kDa
10 min spin for separation of protein ≥ 30 kDa
10 min spn for separation of protein ≥ 10 kDa
20 min spin for separation of protein ≥ 5 kDa
10. Radial Susceptibility Assay
exAFP-C28
was diluted from 128μgml-1 to 0.06μgml-1 in
96 microtiter wells containing 0.4% glucose.
C.
albicans cells were grown at 28 °C in YPD liquid
medium for 3 hours, up to mid-exponential phase.
The fungal cells
2×103 per well was used as inoculum for
susceptibility test. Separate wells containing no protein,
well with only glucose and blank well were used as
different controls. The plate was incubated at 28 °C for
24 hours.
The
glucose utilization in each well was checked by
Glucose Oxidase Assay Kit.
11. Scanning electron microscopy
C.
albicans, grown at 28 °C in YPD medium, were
treated with supra-MIC concentration of exAFP-C28 for
24 hours at 28°C.
10μl
of the cell suspension, placed onto a 0.45μm filter,
fixed with 2% glutaraldehyde for 1 hour, post-fixed with
1% OsO4.
Samples
were loaded onto a graphite stub and kept in
an auto sputter coater under low vacuum for gold
coating up to 5min. Surface morphology of C. albicans
cells was studied by using a SEM under 15-20 kV.
12. Flow Cytometry Analysis
Different
concentrations of exAFP-C28 protein were
incubated with 0.5 ml of C. albicans cell suspension at a
fixed concentration (10 μg ml-1) of propidium iodide (PI)
for 1 hour.
The
fluorescence data due to entry of PI inside the cells
was recorded by a FACS Caliber flow cytometer with a
488 nm laser wavelength, and analyzed by Cell
QuestPro software.
13. Hemolytic Activity Assay
Blood
sample was washed 3 times with PBS.
Triton X-100 was used as positive control.
Aliquots
(100 μl) of RBCs (8% suspension) were
transferred to 96-well microtiter plate, and hemolysis
was determined by measuring A570nm using the
‘Expert Plus UV’ (Emax) plate reader.
The percent (%) hemolysis was calculated as:
% hemolysis =
( A570nm with protein solution –
( A570nm with 1% Triton − X 100
A570nm in PBS )
× 100
– A570nm in PBS )
14. Molecular Mass Determination
and Protein Sequence Analysis
Mass Spectometry Analysis
Molecular
mass determined by Voyager DE ProTM mass
spectrometer.
Spectrum recorded in the (+ve) ion linear mode in
accelerating voltage 20 kV.
Proteomics Analysis
Mass
spectra of different peptides, obtained from
protein digestion using Trypsin, were acquired in (+ve)
ion reflector mode with range of 850–5000 Da.
Data was uploaded into MASCOT database to search
the protein identity.
15. Bioinformatics Analysis
Protein hydrophobicity and hydrophilicity
predicted using
algorithms of Kyte-Doolittle, Hoop-Woods and Garnier.
Homology model constructed using MODELLER 9v2.
Template: The crystal structure of 50S ribosomal protein L10
[Streptomyces avermitilis MA-4680]
Hydrophobic
moments
determined
using
the
Totalizer module of Membrane Protein Explorer:
N is the number of residues in the sequence segment,
Hn is the numerical value of hydrophobicity of the n th amino acid
residue from the Wimley-White interfacial hydrophobicity scale,
δ= 2π/m, and m is the number of residues per turn.
N
N
µ H = {[∑ Hn sin(δ n)] + [∑ Hn cos(δ n)]
n =1
2
n =1
2
16. Results
PCR amplification yielded 2 amplicons of 542bp and 522bp.
DNA fragments were sequenced and NCBI blast search was
performed using the sequences of these amplicons obtained
from each isolate.
99% sequence identity of the DM06specific amplicons with the genus
Colletotrichum sp.
The colony morphology of DM06 was
cottony and grayish white mycelia
with abundant bright orange conidial
mass were found on the colonies.
17. Results
Fig : (a) Phase-contrast microscopic picture of few spores. (b) Scanning electron microscopic view of the
mycelial mat. (c) Phylogenetic tree constructed on the basis of 18S rRNA gene sequences of some fungi with
their accession numbers in parenthesis. (d) The exAFP-C28 protein is neither a glycoprotein nor a lipoprotein
as unveiled through carbohydrate-, protein- and lipid-specific staining.
18. Expression pattern of extracellular
protein in different media
M
1
2
3
4
28KDa
Fig : SDS-PAGE of extracellular
protein of Colletotrichum sp.
grown on 4 different culture
media.
M;Size marker of protein,
1;YEPS media,
2;YEPD media,
3;PDA media,
4;CDX media.
19. Purification of 28 kDa fraction
C
1
2
3
4
M
Fig : Purification of the exAFPC28 protein from the culture
supernatant of Colletotrichum
sp. DM-06 grown in YPS
medium. Coomassie Brilliant
Blue stained SDS-PAGE (12%)
showing
the
extracellular
protein
profile
after
fractionation through different
cut-off of Amicon Ultra 4
Centrifugal Filter Devices.
28KDa
Lane 1: Crude total extracellular
protein, 2: Filtrate fraction of
100 kDa cutoff, 3: 50 kDa cutoff,
4: 30 kDa cutoff, 5: 3 kDa cutoff,
Lane M: Protein molecular
weight marker (in kDa)
20. Antibacterial Assay
The
antimicrobial activity of all the isolated extracellular
protein fractions was done.
28 kDa protein had the best antimicrobial activity than other
fractions. The antimicrobial plate assay on E. coli DH10B
showed inhibition zone surrounding the agar plaques when
2µg protein was loaded.
Fig : Antimicrobial assay on E.coli, protein concentration used 0.5 µg/ml, 1.0 µg/ml, 1.5 µg/ml, 2.0 µg/ml
21. RSA and SEM Results
Fig : (a) The MIC value of exAFP-C28 against C. albicans was found to be 32 µg ml-1. The RSA also revealed
that glucose utilization by C. albicans gradually reduced and ceased in the wells containing >32 µg ml -1 of
exAFP-C28. (b) The scanning electron microscopy image clearly indicated that the exAFP-C28 at a
concentration of 32 µg ml-1 causes a significant damage in the cell wall in comparison to untreated cells
22. Flow Cytometry and Hemolysis
Fig : (a) Enhanced fluorescence level of propidium iodide (at fixed concentration of 10 μg ml -1) indicates
increase in membrane permeability of C. albicans cells treated with variable concentrations (i.e., 4, 8, 16,
32, 64 and 128 μg ml-1) of the exAFP-C28. (b) The exAFP-C28 at a concentration of 32 μg ml -1 has no
hemolytic activity towards human RBCs compared to the negative (1% Triton X-100) and positive (PBS)
controls with 30 min and 60 min of incubation. Data represent mean ± SD of triplicate experiments.
23. Mass Spectrometry and Proteomics
1 MARPDKAAAV AELADQFRSS NAAVLTEYRG LTVAQLKTLR RSLGEDAQYA
51 VVKNTLTKIA ANEAGINTLD DLFNGPTAVA FITGDPVVSA KGLRDFAKDN
101 PNLVIKGGVL DGKALSADEI KKLADLESRE VLLAKLAGAF KGKQSQAASL
151 FQALPSKFVR TAEALRAKKA EQGGAE
Fig : (a) Results obtained from peptide mass fingerprinting followed by MASCOT search shows 5 peptide
sequences have identical matching (in red bold) with several stretches of amino acid sequences of the 50S
ribosomal protein L10 of Streptomyces avermitilis, and display 61% coverage. (b) Mass spectrometric
result depicts the molecular mass of exAFP-C28 as 28.2 kDa. (c) Garnier Plot to determine the secondary
structure of the protein indicated that amino acid residues of exAFP-C28 form around 62% helixes.
24. Bioinformatics Analysis Results
Fig : (a) A superimposition of the Kyte-Doolittle
Hydrophobicity plot and Hopp-Woods Hydrophilicity
plot which indicate alternating hydrophobic and
hydrophilic residue structures in exAFP-C28 (b) A
plot of hydrophobic moments indicates strong
hydrophobic moments in amino acid regions 90-95
and 120-130 which are alpha helixes, indicating
amphipathic nature. (c) The homology model of
exAFP-C28 generated from YASARA has 8 alpha
helixes and 5 beta strands.
25. Discussion
The exAFP-C28 might be comprised of several more amino acids or
modified post-translationally by covalent binding with some other
biomolecules, as Mol. mass of S. avermitilis L10 protein (176 aa) is
18.54 kDa but Mol. Mass of exAFP-C28 is almost equal to 28 kDa.
Alternating hydrophobic and hydrophilic amino acid residues
increases the probability of amphipathic nature in α-helixes, which
provides the membrane permeability feature of exAFP-C28 (SEM).
Amino acid residues 90-95 and 120-130, regions which consist of
helixes (Garnier Plot), have very large hydrophobic moments.
Hence those α-helixes may have possible amphipathic nature.
N-terminal peptide derived from the 50S ribosomal protein L1 of
Helicobacter pylori has cecropin-like antibacterial activity, and is
also able to form perfect amphipathic helix, that is required for
membrane penetration or destabilization.
26. Conclusion
The Colletotrichum sp. DM-06, an endophytic fungus of the
medicinal herb Ocimum sanctum produces an extracellular
antifungal protein of ~28 kDa, which is designated as exAFP-C28.
The morphological features and phylogentic analysis indicate that
the endophyte fungal strain DM-06 is closely related to
Colletotrichum gloeosporioides.
Through SEM and flow cytometry analyses, we have established
that the exAFP-C28 protein destabilizes the cell membrane of the
fungal pathogen C. albicans in a dose-dependent manner.
exAFP-C28 protein shows no cytotoxic effect on human red blood
cells at a dose that is the MIC for the pathogenic C. albicans cells.