Marker-assisted introgression of waxy1 gene into elite inbreds for enhancement of amylopectin in maize hybrids. Mohammad Zahirul Alam Talukder

1. Marker-assisted introgression of waxy1 gene into
elite inbreds for enhancement of amylopectin in
maize hybrids
Speaker
Mohammad Zahirul Alam Talukder
PhD student
DIVISION OF GENETICS
ICAR-INDIAN AGRICULTURAL RESEARCH INSTITUTE
NEW DELHI- 110 012
Md. Zahirul A. Talukder, Vignesh Muthusamy, Rashmi Chhabra, Hema Singh
Chauhan, Rajkumar U. Zunjare and Firoz Hossain

2. DivisionofGenetics,ICAR-IARI
 Waxy corn is a special type of maize with nearly 100%
amylopectin in endosperm
 It is dark, smooth, and waxy that’s why the name is ‘waxy
endosperm’
 It’s also known as sticky maize or glutinous maize’
composed of amylopectin
 Amylopectin makes the kernel sticky during the cooking
process
Waxy corn

3. DivisionofGenetics,ICAR-IARI
 Maize contain ~10% protein and ~70% starch in the endosperm
Two forms of starch: linear amylose and branched amylopectin
 Normal maize endosperm is approximately 25% amylose and
75% amylopectin.
 The amylose content determines the starch gelling and firmness,
whereas the amylopectin is primarily responsible for the
formation of crystalline granules and thickening of paste.
Maize Starch
DuPont Pioneer

4. DivisionofGenetics,ICAR-IARI
Gene structure of waxy gene in maize.
Zheng et al. 2013
 The recessive single gene mutation wx is responsible for the
formation of waxy endosperm in maize
 The Wx locus is located on the short arm of chromosome 9
 It contains 3,718 bp and comprises 14 exons and 13 introns
Waxy gene

5. DivisionofGenetics,ICAR-IARI Pathway of starch production in maize
Li et al. 2018

6. DivisionofGenetics,ICAR-IARI
 Waxy corn is a popular choice as food in South-East Asian
countries.
 It is Consumed as fresh vegetables in Asian countries
 It is widely used as raw material in paper, textile, corrugating,
adhesive and food industry
 It is widely used in frozen food processing, paper-making and
livestock feeding industries
 In India, people in North-Eastern states of India prefer waxy
maize as food over traditional maize
Uses of waxy corn
Waxy corn
consumer products

7. DivisionofGenetics,ICAR-IARI Materials and Method
S. No. Hybrids Parental lines Maturity Area of adaptation
1 HM4 HKI1105 × HKI323 Medium Across the India
2 HM8 HKI1105 × HKI161 Medium Andhra Pradesh, Telengana, Tamil Nadu,
Maharashtra & Karnataka
3 HM9 HKI1105 × HKI1128 Medium West Bengal, Bihar, Jharkhand & Orissa
4 HM10 HKI193-2 × HKI1128 Medium Delhi, Punjab, Haryana, Western Uttar
Pradesh, Rajasthan, Madhya Pradesh,
Gujarat, Andhra Pradesh, Telengana,
Tamil Nadu, Maharashtra and Karnataka
5 HM11 HKI1128 × HKI163 Late Across the India except Himalayan belt
6 HQPM1 HKI193-1 × HKI163 Late Across the India
7 HQPM4 HKI193-2 × HKI161 Late Across the India except Himalayan belt
8 HQPM5 HKI163 × HKI161 Late Across the India
9 HQPM7 HKI193-1 × HKI161 Late Karnataka, Andhra Pradesh, Telengana,
Tamil Nadu & Maharashtra
Donor parent: MGU1-wx1

8. DivisionofGenetics,ICAR-IARI
Marker-assisted backcross breeding scheme (MABB)

9. DivisionofGenetics,ICAR-IARI
S. No. Marker
name
Type Primer sequence (5/-3/) Reference
1. phi027 SSR F: CACAGCACGTTGCGGATTTCTCT
R: GCGTACGTACGACGAAGACAC
www.maizeg
db.org
2. wx-2507F/RG InDel F: ACCTCAAGAGCAACTACCAGTC
R: AAGGACGACTTGAATCTCTCC
Shin et al.
2006
Table 2. Details of gene-based markers used in foreground selection of wx1
allele
Genotyping of populations of waxy gene
 SSR marker phi027 and InDel based wx2507 markers were used to
distinguish the parental lines
 phi027 was used in HKI323, HKI1105 and HKI1128 based populations,
while wx2507 was used in HKI161, HKI163, HKI193-1 and HKI193-2 based
populations.

10. DivisionofGenetics,ICAR-IARI
S.
No.
Generation Population size Wx1/Wx1 Wx1/wx1 Chi-
square
P-value
Mean Range Mean Range Mean Range
1. BC1F1 108 104-115 55 43-64 53 42-62 0.037 0.85NS
2. BC2F1 108 102-111 57 36-100 51 10-72 0.333 0.56NS
Table 3. Average segregation pattern of wx1 in different backcross
populations

11. DivisionofGenetics,ICAR-IARI
Fig. 1: Waxy1 gene structure depicting locations of phi057 and wx2507
Fig. 2: Segregation of phi057 in HKI1105 × MGU1-wx1. DP: donor parent,
RP: recurrent parent, Star indicates heterozygotes
Fig. 3: Segregation of wx2507 in HKI193-1 × MGU1-wx1. DP: donor parent,
RP: recurrent parent, Star indicates heterozygotes

12. DivisionofPGR,ICAR-IARI
Fig. 4: Segregation of BC2F2-based normal and waxy kernels on
BC2F1 ears

13. DivisionofPGR,ICAR-IARI
 Identified the heterozygotes (Wx1/wx1) in the BC1F1 and BC2F1
populations
 The phenotypic segregation of normal and waxy BC2F2 kernels
on BC2F1 ears suggested the efficiency of markers in selecting
the wx1 allele
 Background selection has led to the high degree of phenotypic
similarity in just two generations of backcrosses
 The waxy inbreds and hybrids being developed here would
possess higher amylopectin compared to normal maize
Conclusion

14.  I am greatly thankful to Dr. Firoz Hossain for giving me the opportunity to
work under his direct supervision
 I would like to show my heartfelt gratitude to my all the lab members for their
continues help
 Financial support from ICAR-Indian Agricultural Research Institute, New Delhi
in conducting the study is duly acknowledged.
 I am thankful to USAID, USA for providing the BHEARD fellowship for
undertaking the doctoral research at IARI and BARI, Bangladesh for giving
deputation
 We thank to Dr. B.M. Prasanna, CIMMYT-Mexico for providing the waxy source
germplasm.
 Our thanks are due to CCSHAU, Uchani for sharing the parental inbreds.
 We sincerely thank Director, IIMR, Ludhiana for providing the off-season
nursery at Hyderabad.
Acknowledgements
Thank you