How could you enable thousands and eventually millions of people to learn something new? What if the subject was poorly understood, wildly controversial yet profoundly important, and practically inaccessible to most? Stanford Professor Drew Endy reflects on a variety of experiences having to do with the emergence of a new engineering major (bioengineering) at both MIT and Stanford and the broader promulgation and advancement of these ideas globally via students everywhere through iGEM.
14. Third sentence:
“In the use of the term
bioengineering in this
book we exclude
genetic engineering;
that is, the systematic
design of phenotypes
by manipulation of
genotypes.”
18. Cure diseases.
Understand & “debug” natural
biological systems.
Teach me to…
Save environments.
Design & build organisms.
Make doing the above easier.
19. Could we make biology
easy to engineer?
Atomic-scale thermal noise
Self-mixing molecular
systems
Reproducing “machines”
High heterogeneity
Living ramifications
22. TAATACGACTCACTATAGGGAGA
DNA synthesis = 4 key keyboard for genetic stuff
Raw chemicals,
not derived
from existing
DNA
Play however you
like to get the
DNA you want,
from scratch.
23. Systems = One or more devices encoding
a human defined function(s). Note that my
system your device, and so on.
Devices = One or more parts encoding a
human defined function(s).
Parts = Basic biological functions encoded
via molecules.
DNA = Material encoding moleculesCTATAGGGAGA
8-bit counter
Abstraction barrier! Do not cross!
Abstraction barrier! Do not cross!
Abstraction barrier! Do not cross!
58. What is more valuable,
the puzzle or the answer?
kiva.org
59. What capacities should be available to all citizens?
Jefferson to
Adams re:
“natural
aristocracy”
October 1813
60. How many people should be
able to read and write?
http://themindunleashed.com/2015/06/see-the-worlds-most-spoken-languages-in-one-eye-opening-infographic.html