SlideShare une entreprise Scribd logo
1  sur  65
Télécharger pour lire hors ligne
main( )
{
Learning by doing
Engineering + biology = ?
Now what?
}
# endy@stanford.edu
# Yale NUS STEM Innovation
# 27 April 2017
# fair use, public domain, have fun
Growing is Forever, a film by Jesse Rosten
#include <biology.h>
watermelon eggplant carrot
banana corn broccoli
#include <domestication.h>
#include <breeding.h>
#include <landuse.h>
#include <rDNA.h>
http://www.whatisbiotechnology.org/science/rdna
Engineering even a single
gene can be incredibly
important & valuable.
http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx
Dennis
Gonsalves
Graphic c/o "Synthetic Aesthetics,” MIT Press (2014)
http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html
#include <bioeconomy.h>
Third sentence:
“In the use of the term
bioengineering in this
book we exclude
genetic engineering;
that is, the systematic
design of phenotypes
by manipulation of
genotypes.”
http://www.depts.washington.edu/hhmibio/MIT05.pdf
http://www.depts.washington.edu/hhmibio/MIT05.pdf
http://www.depts.washington.edu/hhmibio/MIT05.pdf
Cure diseases.
Understand & “debug” natural
biological systems.
Teach me to…
Save environments.
Design & build organisms.
Make doing the above easier.
Could we make biology
easy to engineer?
Atomic-scale thermal noise
Self-mixing molecular
systems
Reproducing “machines”
High heterogeneity
Living ramifications
Free .PDF of full briefing via DOI 1721.1/38455
Graphic from "Synthetic Aesthetics" MIT Press (2014)
TAATACGACTCACTATAGGGAGA
DNA synthesis = 4 key keyboard for genetic stuff
Raw chemicals,
not derived
from existing
DNA
Play however you
like to get the
DNA you want,
from scratch.
Systems = One or more devices encoding
a human defined function(s). Note that my
system your device, and so on.
Devices = One or more parts encoding a
human defined function(s).
Parts = Basic biological functions encoded
via molecules.
DNA = Material encoding moleculesCTATAGGGAGA
8-bit counter
Abstraction barrier! Do not cross!
Abstraction barrier! Do not cross!
Abstraction barrier! Do not cross!
https://en.wikipedia.org/wiki/Pedagogy_of_the_Oppressed
“(Friere) argues for pedagogy
to treat the learner as a co-
creator of knowledge.”
MIT 2003
St-Pierre & Endy
PNAS USA 2008
http://youtu.be/sLkZ9FPHJGM
George Boole, c.1854
George Boole, c.1854
MIT 2004
SBC 2004
iGEM 2005
iGEM 2006
Tianjin 2006
iGEM 2007
iGEM 2008
http://diyhpl.us/wiki/dna/projects/
iGEM 2009
Cambridge iGEM 2009
iGEM 2010
38
iGEM.org ~2015
http://partsregistry.org/wiki/index.php?title=Part:BBa_K590087
http://synbiobeta.com/news/igem-startup-pvp-biologics-closes-35-million-agreement-pharmaceutical-company-takeda/
https://www.youtube.com/watch?v=JI5exP6iHWw
Overcoming Teaching Disorders
& Delusional Deliverables
What is more valuable,
the puzzle or the answer?
kiva.org
What capacities should be available to all citizens?
Jefferson to
Adams re:
“natural
aristocracy”
October 1813
How many people should be
able to read and write?
http://themindunleashed.com/2015/06/see-the-worlds-most-spoken-languages-in-one-eye-opening-infographic.html
http://githut.info/
https://www.infoq.com/news/2014/01/IDC-software-developers
How many people should be able to
read and write computer programs?
igem.org
How many people should be able to
read and write DNA?
What should be the price of using a language?
http://www.cnn.com/2013/11/18/tech/innovation/gettysburg-address-preservation/
www.sb7.info

Contenu connexe

Similaire à Learning bioengineering by doing

The seven-deadly-sins-of-bioinformatics3960
The seven-deadly-sins-of-bioinformatics3960The seven-deadly-sins-of-bioinformatics3960
The seven-deadly-sins-of-bioinformatics3960mare34
 
The Seven Deadly Sins of Bioinformatics
The Seven Deadly Sins of BioinformaticsThe Seven Deadly Sins of Bioinformatics
The Seven Deadly Sins of BioinformaticsDuncan Hull
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformaticsbiinoida
 
Scratchpads: Building web communities supporting biodiversity science
Scratchpads: Building web communities supporting biodiversity scienceScratchpads: Building web communities supporting biodiversity science
Scratchpads: Building web communities supporting biodiversity scienceVince Smith
 
download
downloaddownload
downloadbutest
 
Biocomputing
BiocomputingBiocomputing
Biocomputingijtsrd
 
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecuture
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecutureScott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecuture
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecutureScott Edmunds
 
Back to the Future Part III: Libraries and the New Technology Frontier
Back to the Future Part III: Libraries and the New Technology FrontierBack to the Future Part III: Libraries and the New Technology Frontier
Back to the Future Part III: Libraries and the New Technology FrontierBohyun Kim
 
Computing on the shoulders of giants
Computing on the shoulders of giantsComputing on the shoulders of giants
Computing on the shoulders of giantsBenjamin Good
 
Biomedical data
Biomedical dataBiomedical data
Biomedical databeiko
 
Bioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsBioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsProf. Wim Van Criekinge
 
Ontologies for baby animals and robots From "baby stuff" to the world of adul...
Ontologies for baby animals and robots From "baby stuff" to the world of adul...Ontologies for baby animals and robots From "baby stuff" to the world of adul...
Ontologies for baby animals and robots From "baby stuff" to the world of adul...Aaron Sloman
 
Computational of Bioinformatics
Computational of BioinformaticsComputational of Bioinformatics
Computational of Bioinformaticsijtsrd
 
Synthetic Biology beyond the bench: Biosafety & biosecurity
Synthetic Biology beyond the bench: Biosafety & biosecuritySynthetic Biology beyond the bench: Biosafety & biosecurity
Synthetic Biology beyond the bench: Biosafety & biosecurityDrew Endy
 
Introduction to Ontologies for Environmental Biology
Introduction to Ontologies for Environmental BiologyIntroduction to Ontologies for Environmental Biology
Introduction to Ontologies for Environmental BiologyBarry Smith
 

Similaire à Learning bioengineering by doing (20)

The seven-deadly-sins-of-bioinformatics3960
The seven-deadly-sins-of-bioinformatics3960The seven-deadly-sins-of-bioinformatics3960
The seven-deadly-sins-of-bioinformatics3960
 
The Seven Deadly Sins of Bioinformatics
The Seven Deadly Sins of BioinformaticsThe Seven Deadly Sins of Bioinformatics
The Seven Deadly Sins of Bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Scratchpads: Building web communities supporting biodiversity science
Scratchpads: Building web communities supporting biodiversity scienceScratchpads: Building web communities supporting biodiversity science
Scratchpads: Building web communities supporting biodiversity science
 
download
downloaddownload
download
 
BEACON Images - Evolution in Action
BEACON Images - Evolution in ActionBEACON Images - Evolution in Action
BEACON Images - Evolution in Action
 
Biocomputing
BiocomputingBiocomputing
Biocomputing
 
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecuture
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecutureScott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecuture
Scott Edmunds & Mendel Wong, Citizen Science #101. HKU MPA lecuture
 
Back to the Future Part III: Libraries and the New Technology Frontier
Back to the Future Part III: Libraries and the New Technology FrontierBack to the Future Part III: Libraries and the New Technology Frontier
Back to the Future Part III: Libraries and the New Technology Frontier
 
Computing on the shoulders of giants
Computing on the shoulders of giantsComputing on the shoulders of giants
Computing on the shoulders of giants
 
rheumatoid arthritis
rheumatoid arthritisrheumatoid arthritis
rheumatoid arthritis
 
Biomedical data
Biomedical dataBiomedical data
Biomedical data
 
Bioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsBioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformatics
 
Ontologies for baby animals and robots From "baby stuff" to the world of adul...
Ontologies for baby animals and robots From "baby stuff" to the world of adul...Ontologies for baby animals and robots From "baby stuff" to the world of adul...
Ontologies for baby animals and robots From "baby stuff" to the world of adul...
 
Computational of Bioinformatics
Computational of BioinformaticsComputational of Bioinformatics
Computational of Bioinformatics
 
Synthetic Biology beyond the bench: Biosafety & biosecurity
Synthetic Biology beyond the bench: Biosafety & biosecuritySynthetic Biology beyond the bench: Biosafety & biosecurity
Synthetic Biology beyond the bench: Biosafety & biosecurity
 
2015 genome-center
2015 genome-center2015 genome-center
2015 genome-center
 
Introduction to Ontologies for Environmental Biology
Introduction to Ontologies for Environmental BiologyIntroduction to Ontologies for Environmental Biology
Introduction to Ontologies for Environmental Biology
 
Drew Endy and Synthetic Biology trailer
Drew Endy and Synthetic Biology trailerDrew Endy and Synthetic Biology trailer
Drew Endy and Synthetic Biology trailer
 
PhDc exam presentation
PhDc exam presentationPhDc exam presentation
PhDc exam presentation
 

Dernier

ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxAreebaZafar22
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfAyushMahapatra5
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxDenish Jangid
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxheathfieldcps1
 
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Shubhangi Sonawane
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-II
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-IIFood Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-II
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-IIShubhangi Sonawane
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptxMaritesTamaniVerdade
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxVishalSingh1417
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural Resources
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural ResourcesEnergy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural Resources
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural ResourcesShubhangi Sonawane
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.MaryamAhmad92
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 

Dernier (20)

ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdf
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
 
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-II
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-IIFood Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-II
Food Chain and Food Web (Ecosystem) EVS, B. Pharmacy 1st Year, Sem-II
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural Resources
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural ResourcesEnergy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural Resources
Energy Resources. ( B. Pharmacy, 1st Year, Sem-II) Natural Resources
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 

Learning bioengineering by doing