Télécharger pour lire hors ligne
![37
pour les souris dont le gène JunB a été inactivé montre un phénotype étonnamment similaire
à celui des souris déficientes en CBFb. Par ailleurs, une étude du transcriptome dans les
cellules endothéliales de souris a révélé que CBFb était bien un gène cible de JunB. D’ailleurs
dans la moelle osseuse de souris déficientes en JunB, le niveau d’expression de CBFb est
diminué de 60% par rapport aux souris contrôles. Ceci montre que la régulation de
l’expression de CBFb est hautement dépendante de AP-1, en tout cas dans les cellules
endothéliales murines (Licht et al, 2006).
II.3 Relation Structure/ Fonction
II.3.1 La sous-unité protéique Runx1
Plusieurs domaines de la protéine Runx1 ont été conservés à travers l’évolution. On peut
notamment citer le domaine runt, les domaines d’autoinhibition, le domaine VWRPY, les
domaines de transactivation et la séquence de localisation nucléaire.
II.3.1.1 Le domaine runt de Runx1 : hétérodimérisation avec CBFβ et liaison à l’ADN
La famille de protéines à domaine runt est une famille de facteurs de transcription très
conservés, incluant Runt et Lozenge exprimés chez la drosophile, SpRunt chez les oursins,
Cs-Runt chez l’araignée (Cupiennius salei), Xam1 chez le xénope, Runx1, Runx2 et Runx3
chez les mammifères, RNT-1 (Caenorhabditis elegans). Le domaine runt (RD) est la signature
de cette famille de protéines. C’est un motif conservé de 128 acides aminés, responsable à la
fois pour la liaison à l’ADN de manière spécifique de séquence et de la dimérisation avec
CBFβ (Kagoshima et al, 1993). Le domaine runt de Runx1 interagit avec une région de 135
acides aminés de la protéine CBFβ. La stœchiométrie du complexe [Runx-CBFβ-ADN]
prédite et vérifiée est de 1:1:1. (Bravo et al, 2001; Ogawa et al, 1993a; Tang et al, 2000a;
Zhang et al, 2003). Des études de fixation de la protéine Runx1 montrent qu’elle a une
affinité réduite à l’ADN, par rapport au domaine runt seul, suggérant l’existence de
domaine(s) inhibiteur(s) hors du domaine runt. Cette inhibition de fixation à l’ADN est levée
par la liaison de CBFβ à Runx1, stimulant ainsi sa fixation à l’ADN d’au moins quarante fois.
Au sein du domaine runt, les régions respectivement impliquées dans l’interaction avec CBFβ
et la fixation à l’ADN sont distinctes et ne se chevauchent pas (Nagata & Werner, 2001)
(figure 17).
Comme il sera mentionné dans la section « II.3.1.2 Les domaines d’autoinhibition (NRHn,
NRDBn et NRHc », la dimérisation de CBFβ avec Runx1 peut être induite et stimulée par
d’autres facteurs de transcription, tel que Ets-1. Cependant, Runx1/CBFβ a un rôle dans des](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-65-320.jpg)
![40
identifiée en testant d’autres mutants de délétion de Runx1-P2. L’élément de transactivation
(TE) minimal s’étend ainsi des résidus 291 à 331 (TE1) et la région adjacente à TE1 qui
comprend les résidus 332 à 371 (appelée TE2) augmente significativement la transactivation
du mutant de Runx1-P2 (figure 18). Enfin, un autre TE a été identifié car le mutant de
délétion TE3 (résidus 243-191) possède, lui aussi une activité de transactivation (Kanno et al,
1998) (figure 18).
Il existe également une région d’activation dans la partie amino-terminale de Runx1 mettant
en jeu la partie adjacente au domaine runt et l’hélice α du runt domaine lui-même. C’est une
région acide de 26 résidus très conservée entre les trois protéines Runx de mammifères (Liu
et al, 2006) (figure 18).
II.3.1.5 Le signal de localisation nucléaire
Les protéines Runx contiennent un signal de localisation nucléaire (NLS) conservé dans la
partie C-terminale au domaine runt qui permet la localisation des protéines Runx dans le
noyau de la cellule. De plus, les protéines Runx possèdent également une séquence ciblant la
matrice nucléaire (NMTS) comprenant les résidus 324-353 chez Runx1-P2 murin (Kanno et
al, 1998) ou 351-381 chez son homologue Runx1-P2 humain (Zeng et al, 1997). L’association
du facteur CBF à la matrice nucléaire serait un pré-requis pour la transactivation par Runx1-
P2 (Zeng et al, 1998), d’ailleurs, la séquence NMTS de Runx1 comprend le domaine
d’activation (TE1 et TE2) (Kanno et al, 1998) (figure 18).
II.3.2 La sous-unité protéique CBFβ
La protéine CBFβ est une petite protéine de 22 kDa environ. Elle ne possède pas de
domaines particuliers : pas de NLS, pas de NES, pas de site de liaison à l’ADN. Le rôle le
plus important pour CBFβ est de lier le domaine runt et induire un changement de
conformation de Runx qui expose ainsi le domaine de liaison à l’ADN (figure 20).
La comparaison des constantes de dissociation [Runx-ADN] et [Runx-CBFβ-ADN] montre
que CBFβ augmente l’affinité de liaison à l’ADN de Runx. Le mécanisme de stabilisation de
la fixation de Runx à l’ADN par CBFβ n’est pas encore clairement défini, en revanche la
structure du dimère a été élucidée par le groupe de Bushweller (Huang et al, 1999; Tang et al,
2000a; Zhang et al, 2003). Ce groupe a également montré que les 141 premiers acides aminés
(1-141) suffisaient à CBFβ pour se lier au domaine runt avec la même efficacité que la
protéine complète (182 ou 187 résidus) (Zhang et al, 2003). Ce fragment N-terminal de 141
résidus est également capable de restaurer l’hématopoïèse terminale dans les cellules souches
embryonnaires déficientes en CBFb (Miller et al, 2001). Il est possible que ce domaine soit le](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-71-320.jpg)
![The Core Binding Factor CBF Negatively Regulates Skeletal Muscle
Terminal Differentiation
PHILIPOT Ophelie and AIT-SI-ALI Slimane*
UMR7216 Epigénétique et Destin Cellulaire, Centre National de la Recherche Scientifique (CNRS), Université
Paris-Diderot, 35 rue Hélène Brion, 75013 Paris, France. Previous address: Institut André Lwoff, CNRS, FRE2944,
7 rue Guy Moquet, 94800 Villejuif; Université Paris-Sud, France
Tel: (33)-1-5727-8919, Fax: (33)-1-1-5727-8910
*: Corresponding author, email: slimane.aitsiali@univ-paris-diderot.fr,
Running title: CBF in muscle diffeentiation
ABSTRACT
Core Binding Factor or CBF is a transcription
factor composed of two subunits,
Runx1/AML-1 and CBF beta or CBFβ. CBF
was originally described as a regulator of
hematopoiesis. Here we show that CBF is
involved in the control of skeletal muscle
terminal differentiation. Indeed,
downregulation of either Runx1 or CBFβ
protein level accelerates cell cycle exit and
muscle terminal differentiation. Conversely,
overexpression of CBFβ in myoblasts slows
terminal differentiation. CBF interacts directly
with the master myogenic transcription factor
MyoD in proliferating but not in differentiating
myoblasts. The MyoD/CBF complex contains
several chromatin modifying enzymes that
inhibits MyoD activity, such as HDACs. When
overexpressed, CBFβ induced an inhibition of
histone H3 acetylation at MyoD target
promoters. Finally, we show a preferential
recruitment of Runx1 protein on MyoD target
genes in proliferating myoblasts. Taken
together, our data show a new role for Runx1
and CBFβ in the control of the
proliferation/differentiation in skeletal
myoblasts.
Keywords: Differentiation, proliferation,
muscle, MyoD, Runx1/CBFβ
INTRODUCTION
Runx1 (for Runt-related factor, also known as
AML1 for Acute Myeloid Leukemia 1,
CBFA2 or PEPB2aB) belongs to a family of
highly homologous heterodimeric transcription
factors named Core Binding Factors or CBF
(reviewed in: [1]). To be fully functional as a
transcription regulator, DNA binding subunit
Runx1 must dimerize with its cofactor CBF-
beta (CBFb, a non-DNA-binding subunit that
is expressed in a ubiquitous manner [2] Runx1
was originally identified at a breakpoint on
human chromosome 21 in the t(8;21)
translocation, known as the most common
target of chromosomal translocations in human
leukemia [3,4]. Genetic studies showed that
Runx1 is essential in the developing murine
embryo for definitive hematopoiesis of all
lineages [5,6].
There is now strong evidence that Runx
proteins are also important for differentiation
of multiple cell types, including osteoblasts
[7], neurons [8,9], hematopoietic cells of all
lineages [5,6,10] and skin epidermis and hair
follicle stem cells [11,12]. Runx1 is also
involved in promoting senescence in primary
mouse fibroblasts [13], and in cell cycle
regulation [14-16].
Runx proteins have the potential to either
activate or repress transcription in a context
dependent manner. Runx1 seems to promote
proliferation in progenitor cells, whereas in
differentiating cells it cooperates with tissue-
specific transcription factors to regulate tissue-
specific gene expression. For example, Runx1
cooperates with C/EBPα and C/EBPβ to
regulate hematopoiesis and osteogenesis,
respectively [17,18]. The dual role of Runx1 in
regulating proliferation and differentiation
could depend on differential interactions with
protein partners, specific for each stage of cell
development. The molecular mechanisms
underlying such a switch in Runx1 function
remain however to be deciphered.
Runx1 and CBFβ have also been linked to
skeletal muscle differentiation [19-21], and
prevention of muscle wasting [20]. In skeletal
muscle, proliferation and differentiation are](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-91-320.jpg)
![mutually exclusive. Indeed, skeletal muscle
terminal differentiation begins with an
irreversible withdrawal from the cell cycle,
followed by muscle-specific marker expression
[22]. Irreversible cell cycle exit involves a
definitive silencing of proliferation-associated
genes (reviewed in [23] and references
therein). Terminal muscle differentiation is
orchestrated by myogenic bHLH transcription
factors, such as MyoD and Myf5, two master
myogenic determination factors. MyoD is
expressed in proliferating myoblasts, but is
unable to activate its target genes even when
bound to their promoters [24,25]. MyoD
therefore has a repressive role at its target
genes prior to initiating chromatin remodeling
in differentiating cells [24,26,27]. In
proliferating myoblasts, MyoD is associated
with histone deacetylases (HDACs), the
histone methyltransferase Suv39h1 and
heterochromatin protein HP1, and might
actively inhibit expression of its target genes
by inducing a local repressive chromatin
structure [24,28,29].
Here we show that CBF associates with MyoD
only in proliferating myoblasts, and
knockdown of Runx1 or CBFβ accelerates cell
cycle exit and terminal differentiation.
Conversely, overexpression of CBF slows cell
cycle exit and delays muscle differentiation. In
proliferating myoblasts, the MyoD/CBF
complex contains several chromatin modifying
enzymes such as HDACs. In agreement with
this, when overexpressed, CBFβ maintains
histone H3 deacetylated on MyoD target
promoters even in differentiation conditions.
Finally, Runx1 is recruited to MyoD target
genes only in proliferating myoblasts, when
these genes are repressed. Altogether, our data
suggest that CBF transcription factor plays a
pivotal role as a negative regulator of skeletal
muscle terminal differentiation.
RESULTS
CBF subunits, Runx1 and CBFβ, interact
with MyoD in proliferating myoblasts
In an attempt to charaterize MyoD protein
partners, we carried out double-affinity
purification of HA-Flag MyoD stably
expressed in HeLa cells (see purification
scheme on Supplementary Figure 1). MyoD
protein complex composition was then
analyzed by mass spectrometry (MS) and
western blot (WB). MS analysis of the purified
protein complex revealed some already known
partners of MyoD (Supplementary Figure 2),
such as Id, Pbx1, PC4 and E12/E47, and new
partners that had never been described to
interact with MyoD. Indeed, MS analysis
unveiled CBFβ protein within MyoD complex
with a high number of peptides, covering
almost 20% of its protein mass and amino
acids content (Figure 1A). WB analyses
confirmed that result and showed that Runx1
also copurified with MyoD (Figure 1B).
We then performed a complementary
experiment by transfecting HA-tagged MyoD
and/or HA-tagged Runx1 into HeLa cells
stably expressing Flag-HA-CBFβ (ectopic,
eCBFβ). We showed that, indeed, MyoD co-
precipitated with eCBFβ (Figure 1C).
Moreover, the simultaneous co-transfection of
HA-tagged Runx1 resulted in its co-
precipitation with CBFβ and, more
importantly, increased the MyoD-CBFβ co-
precipitation (Figure 1C).
To further investigate the CBF/MyoD
interaction, we turned to myogenic cells: the
murine myolastic cell line C2C12. Both CBFβ
and Runx1 are expressed in the C2C12
myoblasts and their protein level do not vary
significantly during differentiation
(Supplementary Figure 3). We found that
MyoD and CBFβ co-precipitated preferentially
in proliferating compared to differentiating
C2C12 myoblasts (Figure 1D).
To assay whether MyoD has the ability to
interact directly with CBF, we performed GST
pull-down experiments, which showed that
GST-MyoD strongly interacts with Runx1
(Figure 1E, lane 4), but not with CBFβ (Figure
1E, lane 5). The interaction of MyoD with
Runx1 was specific; we did not detect any
Runx1 signal in the presence of GST protein
alone (Figure 1E, lane 8) nor any luciferase
signal with GST-MyoD (Figure 1E, lane 7).
Interestingly, GST-MyoD interacts with CBFβ
only in the presence of Runx1 (Figure 1E,
compare lanes 5 and 6), in agreement with our
previous findings (Figure 1C). These results
show that MyoD interacts directly with
heterodimeric transcription factor CBF, via the
Runx1 subunit.](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-92-320.jpg)
![transcriptional repression: the histone 3 lysine
9 (H3K9) methyltransferase Suv39h1, the
heterochromatin protein HP1β, and the histone
deacetylases HDACs 1, 2 and 3 (Figure 3B).
These proteins are already known partners of
Runx1 on the one hand [30], and repressors of
MyoD activity on the other hand [31-33].
Given the association of CBFβ with
chromatin-modifying enzymes, we studied the
chromatin status of three target gene promoters
of MyoD in differentiating C2C12-CBFβ using
chromatin immunoprecipitation (ChIP). Our
results showed that, in contrast to control cells
in which histone H3 acetylation (a mark
associated with transcription activation) on
myogenin, cyclin D3 and p21 promoters
increased in differentiation compared with
proliferation conditions, histone H3 acetylation
levels at these promoters did not vary in
C2C12-CBFβ cells (Figure 3C). This result is
an agreement with our previous findings
showing that CBF associates with chromatin
modifying enzymes, such as HDACs, Suv39h1
and HP1β, which are known to repress MyoD
activity in proliferating myoblasts. Thus, CBF
has an effect on the chromatin structure of
three early target genes of MyoD and
contibutes to maintain a repressive chromatin
state.
DISCUSSION
Here we show that CBF transcription factor is
expressed in proliferating myoblasts where it
interacts with MyoD. We found that
modulating the expression levels of either of
the CBF subunits, Runx1 or CBFβ, impaired
cell cycle exit and terminal myogenic
differentiation.
Runx1 or CBFβ downregulation in myoblasts
induced an accelerated cell cycle exit (cyclin
D1 protein disappears 24 hours earlier) in
differentiation conditions. In addition, Runx1
or CBFβ downregulation led to a an increase in
G1-phase cells, suggesting that CBF positively
regulates myoblasts proliferation. Conversely,
CBFβ overexpression delayed cyclin D1
disappearance even in differentiation
conditions (cyclin D1 is still detectable 72
hours after the induction of differentiation),
demonstrating a delayed cell cycle exit.
Consequently, entry into terminal
differentiation was delayed. In agreement with
this, our ChIP results showed that in
proliferating myoblasts, Runx1 is recruited to
repressd p21 and cyclin D3, which encode cell
cycle regulators. Together, these results
suggest that CBF regulates positively
proliferation, and negatively terminal
differentiation, of skeletal myoblasts. Thus,
CBF impacts on the
proliferation/differentiation switch in
myoblasts (see model on Figure 4).
Our results revealed that such a role for CBF is
likely to be partly mediated through interaction
with MyoD. Indeed, we provide evidence that
CBF is recruited to early MyoD target genes in
proliferating myoblasts, where MyoD is
mainly associated with transcriptional
repressors [24]. This suggests that CBF may
serve for assembly of a transcription repression
complex at early MyoD target genes such as
p21 and cyclin D3. As for example, such a
mechanism could be involved in the repression
of the skeletal muscle acetylcholine receptor
gene, which contains a repressive E-box that
mediates its repression in proliferating
myoblasts [34]. In agreement with this, we
found that in proliferating myoblasts, CBF
associates with many chromatin modifying
enzymes, such as HDACs (1, 2 and 3),
Suv39h1, and HP1β, which are known to
repress MyoD activity in proliferating
myoblasts [24,31,35,36]; and already known to
interact with Runx1 [30,37,38]. We did not
succeed to show the concomitant presence of
Runx1 and MyoD on MyoD target genes,
given that it has reviously been demonstrated
that in proliferating conditions, a small fraction
of MyoD contributes to the repressive
remodeling of its target genes, prior
differentiation. Alternatively, Runx1 could
prevent the proper binding of MyoD and the
recruitment of the transcriptional machinery.
Notably, the displacement of Runx1 in
differentiating conditions is concomitant with a
strong binding of MyoD to its target promoters
(data not shown).
Our results showed that Runx1 was not located
on late target genes of MyoD, while it is
recruited into early muscle differentiation
genes. This suggests that Runx1 essentially
regulates cell cycle exit and early events of
skeletal muscle terminal differentiation.
Taken together, our results strongly suggest
that CBF could be recruited onto early MyoD](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-94-320.jpg)
![target genes to repress them in proliferating
myoblasts.
Interestingly, although MyoD is expressed
both in proliferating and differentiating cells,
we found that the interaction between MyoD
and CBF was lost in differentiating cells. In
proliferating myoblasts, a fraction of MyoD
could be recruited to its target genes where it
acts as a transcriptional repressor, until
differentiation starts [24]. We showed that
overexpression of CBFβ in myoblasts led to
stabilization of Runx1 that could more
efficiently repress MyoD transactivating
activity, which induces a delay in terminal
differentiation. In agreement with this, in
myoblasts overexpressing CBFβ, histone H3
acetylation (a mark of active transcription) on
MyoD target genes is delayed in differentiation
conditions.
In summary, we propose that CBF
transcription factor might participate in
recruiting chromatin modifying enzymes to
repress MyoD early target genes by locally
inducing a repressive chromatin structure. Our
data reveal a new critical role of CBF in the
regulation of the balance between proliferation
and differentiation in skeletal muscle cells.
They also demonstrate a new mechanism of
repression of differentiation genes in
proliferating myoblasts.
MATERIALS AND METHODS
Cell culture
C2C12 (CRL-1772, ATCC, USA) and HeLa S3
cells (CCL-2.2TM
, ATCC, USA) were cultured
under standard conditions. C2C12 cells and mouse
primary myoblasts (described in: [39]), were
cultured and differentiated as described in: [39].
Stable cell lines establishment and plasmid
construction
A HeLa cell line stably expressing MyoD was
established with a transgene encoding for full-
length MyoD; and HeLa and C2C12 cell lines
expressing CBFβ were established with a transgene
encoding for full-length CBFβ. The transgenes
were tagged with double-HA (Haemagglutinin) and
double-FLAG epitopes at the N-terminus as
described in [40].
Control cell lines transduced with the empty vector
were also established. Murine CBFβ cDNA (a kind
gift from Dr Nancy A. Speck) was amplified by
PCR with specific primers with protruding
restriction sites (fw-Pspx1:
CCGCTCGAGCCGCGCGTCGTCCCGGG, rev-Not1:
ATTCTATATGCGGCCGCTAACGAAGTTTGAGATC
ATCG, and subcloned into the XhoI-NotI sites in the
pREV retroviral vector after Pspx1 and Not1
digestion (Pspx1 is compatible with Xho cloning
site in the pRev vector) [40,41].
Protein complex purification
Flag-HA-MyoD complex purification from HeLa-
MyoD cells was performed as described in: [31]. 3
grams of C2C12-CBFβ cell pellet were used to
purify tagged CBFβ using a simple-affinity
purification method using Flag resin.
Preparation of nuclear extracts
Cells were scraped in a minimal volume of PBS and
centrifuged 2 min at 400 g. The pellet was
resuspended in: 20 mM Hepes pH 7, 0.15 mM
EDTA, 0.15 mM EGTA, 10 mM KCl, then lysed
by addition of NP-40 up to 4.5%. Nuclei were
immediately neutralized with addition sucrose
buffer (50 mM HEPES pH 7, 0.25 mM EDTA, 10
M KCl, 70% (m/v) sucrose). After centrifugation (5
min, 2000 g), nuclei were suspended in glycerol
buffer (10 mM HEPES pH 8, 0.1 mM EDTA, 100
mM NaCl, 25% glycerol) to remove any trace of
cytosolic components and centrifuged again. The
nuclei were then resuspended in sucrose buffer n°2
(20 mM Tris pH 7.65; 60 mM NaCl; 15 mM KCl;
0.34 M Sucrose) then lysed in a final concentration
of 250 mM NaCl using High Salt Buffer (20 mM
Tris pH 7.65; 0.2 mM EDTA; 25 % glycerol; 900
mM NaCl; 1.5 mM MgCl2). The lysates were
sonicated 3 times for 15s with the BioRuptor
(Diagenode, Liège, Belgium) on “High”, then
centrifuged 10 min at 13000 rpm to harvest the total
nuclear extracts (supernatants). Protein
concentration for each sample was estimated with
BCA kit (Perbio, Brebières, France).
Transient plasmid transfection and Flag-affinity
precipitation of Flag-HA-CBFβ
For plasmid transfection, 25 µg of pRcCMV-HA-
AML1 (kind gift of Dr I. Kitabayashi, Japan),
pCMV-HA-MyoD or pRC-CMV backbone were
transfected into HeLa-CBFβ cells, using calcium
phosphate pH 7.12, and Flag IPs was performed 24
h post-transfection (results presented on Figure 1C).
Each IP was performed with 1.5 mg of total nuclear
extracts and with 25 µL stock of ssDNA and BSA-
pre-blocked Agarose Flag M2 resin from Sigma. IP
was performed on wheel overnight at 4 °C. Resin
was then washed 5 times with TEGN buffer (20
mM Tris pH 7.65; 0.1 mM EDTA; 10 % glycerol;
150 mM NaCl; 0.5 % NP-40) and eluted by
competition with high-purity Flag peptide at a final
concentration of 0.2 mg/ml. The resin-free eluate
was retrieved using Clean-up Post reaction columns
(Sigma).](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-95-320.jpg)
![siRNA transfection
siRNAs were purchased from Sigma (Saint-Quentin
Fallavier, France) and were transfected using Hi-
Perfect reagent (Qiagen, Courtaboeuf, France)
according to the manufacturer recommendations.
We usually transfect 0.2 µmol of siRNA per 100
mm cell culture dish. CBFβ targeting siRNA
sequences used are: C1:
CCGGGAAUAUGUCGACUUA, and C2:
UAACUUAGGUGGCGGUGAU; Runx1 siRNA:
CUGUGAAUGCUUCUGAUUU; and the scrambled
siRNA: ACUUAACCGGCAUACCGGCTT.
Immunoprecipitation of endogenous proteins
For IP, we usually use 2 µg of antibodies, 10 µL
protein A/G Sepharose beads from Perbio and 1.2
mg of nuclear extracts from C2C12 cells, or 0.5 mg
from primary myoblasts. Elution was performed
with 40 µl of 0.1 M glycine pH 2.5, 15 min at 25
°C, the eluate was recovered using Spin cleaning-up
post-reaction column (Sigma). Acidity was
neutralized with Tris pH 8.0 before adding loading
buffer.
Western blotting
For western blotting, protein samples were resolved
on pre-cast NuPage 4-12% bis-Tris acrylamide
gradient SDS-PAGE gel (Invitrogen, Cergy-
Pontoise, France). Proteins were then transferred
onto nitrocellulose membrane during 1 h at 400 mA
in transfer buffer (25 mM Tris, 150 mM Glycine,
0.1 % SDS and 20 % methanol). Membranes are
blocked 1 hour in PBS-0.2 % Tween, 10 %
skimmed milk and incubated overnight at 4°C with
primary antibodies. Membranes were incubated
with the appropriate secondary antibodies coupled
to HRP and revealed using West Dura from Pierce
(Perbio, Brebières, France) and ChemiSmart 5000
system (Vilber Lourmat, Marne-La-Vallée, France).
Plasmids, GST fusions and GST pull-down
GST and GST-MyoD plasmid constructs were
expressed in Escherichia coli strain BL21 and
purified using glutathione-sepharose beads
according to the manufacturer (Sigma, Saint
Quentin-Fallavier, France). Purified proteins were
quantified by coomassie staining after SDS–PAGE
separation. In vitro transcription and translation
(TNT) of pcDNA3-AML1b, pcDNA3-CBFβ and
luciferase were performed with Riboprobe in vitro
transcription systems (Promega, Charbonnières,
France) in the presence of 35
S-labelled methionine.
Agarose beads coated with equal amounts of GST
or GST-MyoD (1 mg) were incubated with 10 µL
of radioactive TNT reaction in reaction buffer (50
mM Tris pH 7.6, 150 mM NaCl, 0.1% Triton)
during 2 h at 4°C. Beads were washed 5 times with
wash buffer (50 mM Tris pH 7.6, 300 mM NaCl,
0.5 % Triton 100), resuspended and proteins
resolved by SDS-PAGE gel and revealed by
autoradiography.
Immunofluorescence
Cells were cultured in Labtecks permanox (Falcon)
and fixed briefly with 4% formaldehyde in PBS.
Residual formaldehyde was neutralized with 0.1 M
Glycine pH 8.0, and washed with PBS. Cells were
permeabilized and blocked using 1 % BSA, 1 %
goat serum, 0.3 % Triton-X100 in PBS. Primary
and secondary antibodies were diluted in the
permeabilizing/blocking solution and were washed
with 0.3% Triton-X100 in PBS. Nuclei are stained
with DAPI and the glass lid is fixed using an anti-
fading polymerizing media from DakoCytomation
(Dako, Trappes, France).
Antibodies
The C-20 anti-MyoD, M-225 anti-myogenin, C-20
anti-Myf5, FL-182 anti-CBFβ normal rabbit IgG
antibodies were purchased from Santa Cruz Biotech
(Santa Cruz, CA, USA). Rabbit polyclonal anti-
Suv39h1 antibody (ref. 07-550), and rabbit anti-
acetyl histone H3 (ref. 06-599) were obtained from
Upstate Biotech (Lake Placid, NY, USA). Anti-
HP1β (1MOD1A9AS) was from Euromedex
(Souffelweyersheim, France). Rabbit polyclonal
anti-MCK antibody was developed by Dr H. Ito
[42]. Anti-Flag and anti-α-tubulin antibodies were
purchased from Sigma (Saint-Quentin Fallavier,
France). Rat anti-HA antibody was purchased from
Roche (Meylan, France). Mouse anti-AML1
antibody (MAB10062) was purchased from
Millipore (Saint Quentin en Yvelines, France) and
mouse anti-HDAC3 antibody (611125) from BD
Biosciences (Le Pont de Claix, France). Goat anti-
rat IgG Alexa-488-conjugated, anti-rabbit IgG
Alexa-488 were from Invitrogen (Cergy-Pontoise,
France) and anti-mouse IgG TRITC (T7657) were
from Sigma (Saint-Quentin Fallavier, France).
FACS analysis
C2C12 were transfected with the siRNAs as
indicated in the Material and Method section. 48
hours post-transfection, cells were washed with
PBS, then scraped in 500 µL of PBS. Cells were
kept on ice while 4,5 mL of ethanol 70% were
added. Then cells are kept at least overnight at -
20°C. Propidium iodide (PI) staining proceeds as
follows: cells are centrifuged and the pellet is
washed with PBS. Cells are then centrifuged and
resuspended in 2mL PI solution (PI, RNase, Triton
0,1%) 30 minutes and kept in the dark. Cells are
homogeneized by vortexing before analysis. We
worked on a Beckman and Coulter FACS apparatus
and we counted at least 3000 events for each
condition.
Chromatin immunoprecipitation (ChIP)](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-96-320.jpg)
![ChIP protocol and primers have been described in:
[39]. The yet unpublished primers used are:
Myogenin fw: GAATCACATGTAATCCACGGA, rev:
ACGCCAACTGCTGGGTGCCA. Cyclin D3 fw:
CTGCTTGCCTCTGTCTTCA; rev:
GACCCATGTCAGATGACTC. 36B4 fw:
ATGTGCAGCTGATAAAGACTGG; rev:
CTGTGATGTCGAGCACTTCAG.
ACKNOWLEGEMENTS
We thank P. Robin, C. Pellentz, L. Fritsch, A.
Polesskaya, and A. Marchand for technical
help and critical reading of the manuscript. We
thank F. Ferri and C. Guillemin for technical
help. We thank C. Francastel, J. Weitzman, F.
Hubé, C. Rougeulle, V. Mezger and P-A.
Defossez for critical reading of the manuscript.
The authors warmly thank Drs N. Speck, G.
Mouchiroud, I. Kitabayashi, H. Ito, and L.
Delva for sharing reagents. This work was
supported by the Association Française contre
les Myopathies (AFM); the Fondation
Bettencourt-Schueller; the Ligue Nationale
contre le Cancer; the Association pour la
Recherche sur le Cancer (ARC), the CNRS;
and the Université Paris-Sud. PO was recipient
of fellowships from the Ministère de la
Recherche and the ARC.
CONFLICT OF INTEREST
None of the authors has any commercial
affiliations, consultancies, or equity interests,
nor patent-licensing arrangements that could
be considered to pose a conflict of interest
regarding the submitted manuscript.
REFERENCES
1. Mikhail FM, Sinha KK, Saunthararajah Y,
Nucifora G (2006) Normal and
transforming functions of RUNX1: a
perspective. J Cell Physiol 207: 582-593.
2. Wang Q, Stacy T, Miller JD, Lewis AF, Gu TL,
et al. (1996) The CBFbeta subunit is
essential for CBFalpha2 (AML1) function
in vivo. Cell 87: 697-708.
3. Miyoshi H, Shimizu K, Kozu T, Maseki N,
Kaneko Y, et al. (1991) t(8;21)
breakpoints on chromosome 21 in acute
myeloid leukemia are clustered within a
limited region of a single gene, AML1.
Proc Natl Acad Sci U S A 88: 10431-
10434.
4. Golub TR, Barker GF, Bohlander SK, Hiebert
SW, Ward DC, et al. (1995) Fusion of the
TEL gene on 12p13 to the AML1 gene on
21q22 in acute lymphoblastic leukemia.
Proc Natl Acad Sci U S A 92: 4917-4921.
5. Wang Q, Stacy T, Binder M, Marin-Padilla M,
Sharpe AH, et al. (1996) Disruption of the
Cbfa2 gene causes necrosis and
hemorrhaging in the central nervous
system and blocks definitive
hematopoiesis. Proc Natl Acad Sci U S A
93: 3444-3449.
6. Okuda T, van Deursen J, Hiebert SW, Grosveld
G, Downing JR (1996) AML1, the target
of multiple chromosomal translocations in
human leukemia, is essential for normal
fetal liver hematopoiesis. Cell 84: 321-
330.
7. Komori T, Kishimoto T (1998) Cbfa1 in bone
development. Curr Opin Genet Dev 8:
494-499.
8. Chen CL, Broom DC, Liu Y, de Nooij JC, Li Z,
et al. (2006) Runx1 determines nociceptive
sensory neuron phenotype and is required
for thermal and neuropathic pain. Neuron
49: 365-377.
9. Theriault FM, Nuthall HN, Dong Z, Lo R,
Barnabe-Heider F, et al. (2005) Role for
Runx1 in the proliferation and neuronal
differentiation of selected progenitor cells
in the mammalian nervous system. J
Neurosci 25: 2050-2061.
10. Ichikawa M, Asai T, Saito T, Seo S, Yamazaki
I, et al. (2004) AML-1 is required for
megakaryocytic maturation and
lymphocytic differentiation, but not for
maintenance of hematopoietic stem cells
in adult hematopoiesis. Nat Med 10: 299-
304.
11. Raveh E, Cohen S, Levanon D, Negreanu V,
Groner Y, et al. (2006) Dynamic
expression of Runx1 in skin affects hair
structure. Mech Dev 123: 842-850.
12. Osorio KM, Lee SE, McDermitt DJ, Waghmare
SK, Zhang YV, et al. (2008) Runx1
modulates developmental, but not injury-
driven, hair follicle stem cell activation.
Development 135: 1059-1068.
13. Wotton SF, Blyth K, Kilbey A, Jenkins A,
Terry A, et al. (2004) RUNX1
transformation of primary embryonic
fibroblasts is revealed in the absence of
p53. Oncogene 23: 5476-5486.
14. Britos-Bray M, Ramirez M, Cao W, Wang X,
Liu PP, et al. (1998) CBFbeta-SMMHC,
expressed in M4eo acute myeloid
leukemia, reduces p53 induction and slows
apoptosis in hematopoietic cells exposed
to DNA-damaging agents. Blood 92:
4344-4352.
15. Cao W, Adya N, Britos-Bray M, Liu PP,
Friedman AD (1998) The core binding
factor (CBF) alpha interaction domain and](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-97-320.jpg)
![107
between heterologous helix-loop-helix proteins generate complexes that bind specifically
to a common DNA sequence. Cell 58(3): 537-544
Mussini I, Favaro G, Carraro U (1987) Maturation, dystrophic changes and the continuous
production of fibers in skeletal muscle regenerating in the absence of nerve. J Neuropathol
Exp Neurol 46(3): 315-331
Nagata T, Werner MH (2001) Functional mutagenesis of AML1/RUNX1 and PEBP2 beta/CBF
beta define distinct, non-overlapping sites for DNA recognition and heterodimerization
by the Runt domain. J Mol Biol 308(2): 191-203
Naidu PS, Ludolph DC, To RQ, Hinterberger TJ, Konieczny SF (1995) Myogenin and MEF2
function synergistically to activate the MRF4 promoter during myogenesis. Mol Cell Biol
15(5): 2707-2718
Nam S, Jin YH, Li QL, Lee KY, Jeong GB, Ito Y, Lee J, Bae SC (2002) Expression pattern,
regulation, and biological role of runt domain transcription factor, run, in Caenorhabditis
elegans. Mol Cell Biol 22(2): 547-554
Nguyen DX, Baglia LA, Huang SM, Baker CM, McCance DJ (2004) Acetylation regulates the
differentiation-specific functions of the retinoblastoma protein. Embo J 23(7): 1609-1618
Niki M, Okada H, Takano H, Kuno J, Tani K, Hibino H, Asano S, Ito Y, Satake M, Noda T
(1997) Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene
encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer
binding protein 2/core binding factor. Proc Natl Acad Sci U S A 94(11): 5697-5702
Nimmo R, Antebi A, Woollard A (2005) mab-2 encodes RNT-1, a C. elegans Runx homologue
essential for controlling cell proliferation in a stem cell-like developmental lineage.
Development 132(22): 5043 - 5054
Nishimura M, Fukushima-Nakase Y, Fujita Y, Nakao M, Toda S, Kitamura N, Abe T, Okuda T
(2004) VWRPY motif-dependent and -independent roles of AML1/Runx1 transcription
factor in murine hematopoietic development. Blood 103: 562 - 570
Nishimura R, Hata K, Harris SE, Ikeda F, Yoneda T (2002) Core-binding factor alpha 1 (Cbfa1)
induces osteoblastic differentiation of C2C12 cells without interactions with Smad1 and
Smad5. Bone 31(2): 303-312
Norton JD, Deed RW, Craggs G, Sablitzky F (1998) Id helix-loop-helix proteins in cell growth
and differentiation. Trends Cell Biol 8(2): 58-65
Novitch BG, Mulligan GJ, Jacks T, Lassar AB (1996) Skeletal muscle cells lacking the
retinoblastoma protein display defects in muscle gene expression and accumulate in S and
G2 phases of the cell cycle. J Cell Biol 135(2): 441-456
Novitch BG, Spicer DB, Kim PS, Cheung WL, Lassar AB (1999) pRb is required for MEF2-
dependent gene expression as well as cell-cycle arrest during skeletal muscle
differentiation. Curr Biol 9(9): 449-459
Nurse P (1994) Ordering S phase and M phase in the cell cycle. Cell 79(4): 547-550
Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito-Fujimoto M, Ito Y, Shigesada K (1993a)
Molecular Cloning and Characterization of PEBP2[beta], the Heterodimeric Partner of a
Novel Drosophila runt-Related DNA Binding Protein PEBP2[alpha]. Virology 194(1):
314-331
Ogawa E, Maruyama M, Kagoshima H, Inuzuka M, Lu J, Satake M, Shigesada K, Ito Y (1993b)
PEBP2/PEA2 represents a family of transcription factors homologous to the products of](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-146-320.jpg)
![112
Strom DK, Nip J, Westendorf JJ, Linggi B, Lutterbach B, Downing JR, Lenny N, Hiebert SW
(2000) Expression of the AML-1 oncogene shortens the G(1) phase of the cell cycle. J
Biol Chem 275(5): 3438 - 3445
Sullivan J, Sher D, Eisenstein M, Shigesada K, Reitzel A, Marlow H, Levanon D, Groner Y,
Finnerty J, Gat U (2008) The evolutionary origin of the Runx/CBFbeta transcription
factors - Studies of the most basal metazoans. BMC Evolutionary Biology 8(1): 228
Sun L, Trausch-Azar JS, Ciechanover A, Schwartz AL (2005) Ubiquitin-proteasome-mediated
degradation, intracellular localization, and protein synthesis of MyoD and Id1 during
muscle differentiation. J Biol Chem 280(28): 26448-26456
Tajbakhsh S, Rocancourt D, Cossu G, Buckingham M (1997) Redefining the Genetic Hierarchies
Controlling Skeletal Myogenesis: Pax-3 and Myf-5 Act Upstream of MyoD. Cell 89(1):
127-138
Tanaka T, Kurokawa M, Ueki K, Tanaka K, Imai Y, Mitani K, Okazaki K, Sagata N, Yazaki Y,
Shibata Y, Kadowaki T, Hirai H (1996) The extracellular signal-regulated kinase pathway
phosphorylates AML1, an acute myeloid leukemia gene product, and potentially regulates
its transactivation ability. Mol Cell Biol 16(7): 3967-3979
Tanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, Shibata Y, Yazaki Y, Hirai H
(1995) An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell
differentiation and transcriptional activation antagonistically by two alternative spliced
forms. Embo J 14(2): 341-350
Tanaka Y, Watanabe T, Chiba N, Niki M, Kuroiwa Y, Nishihira T, Satomi S, Ito Y, Satake M
(1997) The protooncogene product, PEBP2beta/CBFbeta, is mainly located in the
cytoplasm and has an affinity with cytoskeletal structures. Oncogene 15(6): 677-683
Tang Y-Y, Crute BE, Kelley JJ, Huang X, Yan J, Shi J, Hartman KL, Laue TM, Speck NA,
Bushweller JH (2000a) Biophysical characterization of interactions between the core
binding factor [alpha] and [beta] subunits and DNA. FEBS Letters 470(2): 167-172
Tang Y-Y, Shi J, Zhang L, Davis A, Bravo J, Warren AJ, Speck NA, Bushweller JH (2000b)
Energetic and Functional Contribution of Residues in the Core Binding Factor beta
(CBFbeta ) Subunit to Heterodimerization with CBFalpha. J Biol Chem 275(50): 39579-
39588
Taya Y (1997) RB kinases and RB-binding proteins: new points of view. Trends Biochem Sci 22(1):
14-17
Thayer MJ, Tapscott SJ, Davis RL, Wright WE, Lassar AB, Weintraub H (1989) Positive
autoregulation of the myogenic determination gene MyoD1. Cell 58(2): 241-248
Theriault FM, Nuthall HN, Dong Z, Lo R, Barnabe-Heider F, Miller FD, Stifani S (2005) Role
for Runx1 in the proliferation and neuronal differentiation of selected progenitor cells in
the mammalian nervous system. J Neurosci 25(8): 2050-2061
Thomson S, Clayton AL, Hazzalin CA, Rose S, Barratt MJ, Mahadevan LC (1999) The
nucleosomal response associated with immediate-early gene induction is mediated via
alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase.
EMBO J 18(17): 4779-4793
Tintignac LA, Leibovitch MP, Kitzmann M, Fernandez A, Ducommun B, Meijer L, Leibovitch
SA (2000) Cyclin E-cdk2 phosphorylation promotes late G1-phase degradation of MyoD
in muscle cells. Exp Cell Res 259(1): 300-307](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-151-320.jpg)
![114
Wang X, Blagden C, Fan J, Nowak SJ, Taniuchi I, Littman DR, Burden SJ (2005) Runx1 prevents
wasting, myofibrillar disorganization, and autophagy of skeletal muscle. Genes Dev 19(14):
1715-1722
Wasserman WW, Fickett JW (1998) Identification of regulatory regions which confer muscle-
specific gene expression. J Mol Biol 278(1): 167-181
Wee H-J, Voon DC-C, Bae S-C, Ito Y (2008) PEBP2{beta}/CBF{beta}-dependent
phosphorylation of RUNX1 and p300 by HIPK2: Implications for leukemogenesis. Blood:
blood-2008-2001-134122
Wei L, Jamonnak N, Choy J, Wang Z, Zheng W (2008) Differential binding modes of the
bromodomains of CREB-binding protein (CBP) and p300 with acetylated MyoD.
Biochemical and Biophysical Research Communications 368(2): 279-284
Weintraub H, Davis R, Lockshon D, Lassar A (1990) MyoD binds cooperatively to two sites in a
target enhancer sequence: occupancy of two sites is required for activation. Proc Natl Acad
Sci U S A 87(15): 5623-5627
Weintraub H, Dwarki VJ, Verma I, Davis R, Hollenberg S, Snider L, Lassar A, Tapscott SJ (1991)
Muscle-specific transcriptional activation by MyoD. Genes Dev 5(8): 1377-1386
Weintraub H, Tapscott SJ, Davis RL, Thayer MJ, Adam MA, Lassar AB, Miller AD (1989)
Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines
by forced expression of MyoD. Proc Natl Acad Sci U S A 86(14): 5434-5438
Wong MW, Pisegna M, Lu MF, Leibham D, Perry M (1994) Activation of Xenopus MyoD
transcription by members of the MEF2 protein family. Dev Biol 166(2): 683-695
Wright WE, Sassoon DA, Lin VK (1989) Myogenin, a factor regulating myogenesis, has a
domain homologous to MyoD. Cell 56(4): 607-617
Wu Z, Woodring PJ, Bhakta KS, Tamura K, Wen F, Feramisco JR, Karin M, Wang JY, Puri PL
(2000) p38 and extracellular signal-regulated kinases regulate the myogenic program at
multiple steps. Mol Cell Biol 20(11): 3951-3964
Xia D, Zhang Y, Huang X, Sun Y, Zhang H (2007) The C. elegans CBF[beta] homolog, BRO-1,
regulates the proliferation, differentiation and specification of the stem cell-like seam cell
lineages. Developmental Biology 309(2): 259-272
Xie T, Spradling AC (1998) decapentaplegic is essential for the maintenance and division of
germline stem cells in the Drosophila ovary. Cell 94(2): 251-260
Xu Q, Yu L, Liu L, Cheung CF, Li X, Yee SP, Yang XJ, Wu Z (2002) p38 Mitogen-activated
protein kinase-, calcium-calmodulin-dependent protein kinase-, and calcineurin-mediated
signaling pathways transcriptionally regulate myogenin expression. Mol Biol Cell 13(6):
1940-1952
Yablonka-Reuveni Z, Paterson BM (2001) MyoD and myogenin expression patterns in cultures
of fetal and adult chicken myoblasts. J Histochem Cytochem 49(4): 455-462
Yaffe D, Saxel O (1977) Serial passaging and differentiation of myogenic cells isolated from
dystrophic mouse muscle. Nature 270(5639): 725-727
Yahi H, Fritsch L, Philipot O, Guasconi V, Souidi M, Robin P, Polesskaya A, Losson R, Harel-
Bellan A, Ait-Si-Ali S (2008) Differential cooperation between heterochromatin protein
HP1 isoforms and MyoD in myoblasts. J Biol Chem: M802647200
Yamaguchi Y, Kurokawa M, Imai Y, Izutsu K, Asai T, Ichikawa M, Yamamoto G, Nitta E,
Yamagata T, Sasaki K, Mitani K, Ogawa S, Chiba S, Hirai H (2004) AML1 Is Functionally](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-153-320.jpg)
![Author Proof
Review
10.1517/14728222.10.6.xxx © 2006 Informa UK Ltd ISSN 1472-8222 1
General
Chromatin modification and
muscle differentiation
Hakima Yahi*, Ophélie Philipot*, Valentina Guasconi, Lauriane Fritsch
& Slimane Ait-Si-Ali†
†Institut André Lwoff, Laboratoire ‘Epigénétique et Cancer’, FRE 2944, CNRS, 7 rue Guy Moquet,
94800 Villejuif, France. *These authors contibuted equally to this manuscript.
Skeletal muscle differentiation is a multistep process, which begins with the
commitment of multi-potent mesodermal precursor cells to the muscle fate.
These committed cells, the myoblasts, then differentiate and fuse into multi-
nucleated myotubes. The final step of muscle differentiation is the maturation
of differentiated myotubes into myofibres. Skeletal muscle development
requires the coordinated expression of various transcription factors like the
members of the myocyte enhancer binding-factor 2 family and the muscle
regulatory factors. These transcription factors, in collaboration with
chromatin-remodelling complexes, act in specific combinations and within
complex transcriptional regulatory networks to achieve skeletal myogenesis.
Additional factors involved in the epigenetic regulation of this process con-
tinue to be discovered. In this review, the authors discuss the recent discoveries
in the epigenetic regulation of myogenesis. They also summarise the role of
chromatin-modifying enzymes regulating muscle gene expression. These dif-
ferent factors are often involved in multiple steps of muscle differentiation and
have redundant activities. Altogether, the recent findings have allowed a
better understanding of myogenesis and have raised new hopes for the
pharmacological development of new therapies aimed at muscle degeneration
diseases, such as myotonic dystrophy or Duchenne muscular dystrophy.
Keywords: chromatin remodelling, differentiation, skeletal muscle
Expert Opin. Ther. Targets (2006) 10(6):xxx-xxx
1. Introduction
Skeletal muscles derive from muscle precursor cells (MPCs) that engage in a
multistep differentiation programme in which mesoderm progenitors become com-
mitted to a skeletal muscle fate, then proliferate and migrate to specific locations,
and finally differentiate into multinucleated myotubes to form myofibres [1].
Among the different factors expressed in the embryo structures, members of
the Wnts family and Sonic Hedgehog (Shh) factor are positive regulators of myo-
genesis [2-7]. These factors induce the production of Myf5 and MyoD, the determi-
nation factors of myogenesis. Many other regulatory factors involved in these
different steps have been identified, including the early markers Pax3, c-Met, the
members of the MEF2 family and the muscle regulatory factors (MRFs): MyoD,
myogenin, Myf5, and MRF4 (Table 1). The MEF2 and MRFs transcription factors
are the key regulators of the latest steps of myogenesis. The ectopic expression of an
individual MRF in a variety of non-muscle cells results in the activation of the skel-
etal muscle differentiation programme [8,9]. These transcription factors, in collabo-
ration with chromatin remodelling complexes, act in specific combinations and
within complex transcriptional regulatory networks to achieve skeletal myogenesis.
1. Introduction
2. The specification factors of
embryonic myogenesis
3. Transcriptional regulation of
muscle differentiation
4. Chromatin remodelling
enzymes in proliferating
myoblasts
5. Chromatin remodelling
enzymes in differentiating
myotubes
6. Insights from muscle
regeneration studies
7. Pharmacological triggering of
the transcription regulators of
skeletal muscle differentiation
8. Conclusion
9. Expert opinion](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-158-320.jpg)
![Author Proof
Chromatin modification and muscle differentiation
2 Expert Opin. Ther. Targets (2006) 10(6)
2. The specification factors of embryonic
myogenesis
In the embryo, a number of factors are implicated in the sur-
vival, delamination and migration of the MPCs from the
dermomyotome to sites of muscle formation in the body and
limbs (Figure 1). Several homeodomain transcription factors are
involved. Thus, Pax3 and Pax7 mark cells in the dermomyo-
tome and in newly forming muscle masses, such as the myo-
tome in the mature somite. Pax3 is essential for the formation
and migration of the MPCs. Pax3 gene acts upstream of the
myogenic programme and is necessary for MyoD activation in
the absence of Myf-5 [10,11]. Most of the functions of Pax3 can
be replaced by its paralogue Pax7 [12]. Msx1 is a homeodo-
main protein that can inhibit myogenesis, with an antagonist
effect of Pax3 and the MRFs. The Six family (homeobox pro-
teins) are transcription factors with notably Six1 and Six4 that
are expressed in MPCs and can bind the MEF-3 element
located in myogenin promoter. Lbx1 is also a homeobox pro-
tein necessary for a correct migration of the MPCs [13].
Finally, the proto-oncogene c-met is a marker of the MPCs
delaminating and migrating from the lateral dermomyotome.
The c-met gene encodes a tyrosine kinase receptor and its lig-
and is the hepatocyte growth factor, also called scatter factor
because it delineates the migratory route of MPCs. During
migration, the MPCs express all these specification factors,
but do not yet express the determination factors, such as
MyoD and Myf-5 (Figure 1).
3. Transcriptional regulation of muscle
differentiation
The development of skeletal muscle is an ordered multistep
process requiring the sequential activation of essentially two
groups of myogenic transcription factors (Figures 1 and 2,
Table 1). The first group is composed of the
basic helix-loop-helix (bHLH) transcription factors family. The
second group includes the MEF2 family of transcription factors.
3.1 The myogenic bHLH transcription factors family
The myogenic bHLH family comprises MyoD, Myf5, myo-
genin and MRF4, which belong to the Class II of the tis-
sue-specific bHLH transcription factors family. Targeted gene
disruption of any of the four bHLH family members, MyoD,
Myf5, myogenin and Mrf4, in mice has shown that they play
central roles in myogenesis [14-16]. Progenitor cells remain
multi-potent in the absence of these factors, they do not
locate correctly to sites of myogenesis and adopt other cell
fates [17,18]. Moreover, in the absence of MyoD and Myf5,
myogenin and MRF4 are not observed [19-21]. On the con-
trary, it has been shown that mice lacking myogenin or MRF4
still develop skeletal muscle, although double knockout mice
totally lack skeletal muscle fibres and myoblasts [19-21]
(for review see [16]).
Further experiments have pointed out the compensatory
roles of Myf5 and MyoD. Inactivation of Myf5 gene results
in delayed myotome formation and aberrant migration of
Figure 1. Sequential expression of major markers of skeletal muscle differentiation and illustration of the different stages of
myogenesis, from the somitic cells to mature myofibres. The committed cells in the somite are characterised by the expression of
Pax3, which will further lead to the migration of the MPCs, along with c-Met. The expression of MyoD and Myf5 in the MPCs leads to
their determination into proliferating myoblasts. The concomitant expression of MyoD, Myf5, Mfr4 and the MEF2 factors, will induce
these myoblasts to exit from the cell cycle and to enter terminal differentiation. Late-stage markers of differentiation, such as MCK and
MHC, are expressed in the multinucleated myotubes. The latter finally fuse to form mature and functional myofibres.
MCK: Muscle creatine kinase; MEF: Myocyte enhancer factor; MHC: Myosin heavy chain; MPC: Muscle precursor cell; MRF: Muscle regulator factory; MyoD: Myogenic
determination.
Maturation
Committed myoblasts at the
site of muscle formation
Myotubes, at site of muscle
formation. Permanent cell
cycle exit
Mature myofibers
Uncommitted
cells of the
somite
DifferentiationDetermination
Terminally differentiatedProliferative
Specification
Muscle cell precursors
Pax3, Pax7
Wnt, Shh
Six1, Six4
c-met, lbx1, msx1
Myf5, MyoD, MRF4
MEF2
MyoD, MRF4,
Myogenin
MCK, MHC
Troponin1
AchR
MEF2](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-159-320.jpg)
![Author Proof
Yahi, Philipot, Guasconi, Fritsch & Ait-Si-Ali
Expert Opin. Ther. Targets (2006) 10(6) 3
muscle precursors into the adjacent tissues, dermis and
sclerotome, where they acquire non-muscle fates [22]. This
early defect in myogenesis is, however, compensated by the
later expression of MyoD, leading to essentially normal
muscles at birth. Similarly, disruption of the MyoD gene,
which is normally expressed two days after Myf5, does not
alter muscle formation. Indeed, homozygous MyoD-/- mice
are normal, fertile and do not show abnormal skeletal mus-
cles [23]. To understand this compensatory role, analysis of
the mRNA of newborn mice shows an increased level of
Myf5 expression, both in homozygous and heterozygous
MyoD+/- mice. This suggests that Myf5 replaces MyoD in
these mice and, thus, there is functional overlap between
these two genes.
MyoD positively auto-regulates its own expression, and
activates that of myogenin (Figure 2). Myogenin is expressed
in nonproliferating myoblasts as they enter the differentiation
pathway. Myogenin seems to be implicated in later steps of
muscle cell differentiation and triggers differentiation with
activation of muscle specific genes, such as muscle creatine
kinase (MCK) and myosin heavy chain (MHC).
Both MyoD and myogenin are expressed during skeletal
muscle differentiation and it is likely that, together, they reg-
ulate the late expression of MRF4, which contributes to
fibres’ maturation and to the maintenance of their differen-
tiated state (Figure 2). But Mrf4 is not only playing a role in
the late stages of muscle differentiation. Indeed, it was
recently shown that Mrf4 is expressed in MPCs, such as
MyoD and Myf5 [11,24,25]. Actually, Myf5 and MRF4 act
upstream of MyoD to direct embryonic multi-potent cells
into the myogenic lineage. Moreover, Myf5/MyoD double
null mice are able to form skeletal muscles if Mrf4 expres-
sion is not compromised [11]. Thus, MRF4 has roles in both
muscle determination and differentiation.
3.2 Molecular mechanisms
The bHLH transcription factors have a basic region and a
helix-loop-helix domain. These muscle-specific transcription
factors can either homodimerise, or heterodimerise with class I
bHLH transcription factors, which are quasi-ubiquitous E
proteins (such as HEB/HTF4, E2-2/ITF-2 and E12/E47). The
MRFs act on muscle-specific promoters where they can interact
with each other and with other transcription factors, such as
MEF2. In addition, they interact with chromatin-modifying
proteins, such as histone deacetylases (HDACs), histone acetyl-
transferases (HATs) and members of the SWI/SNF
ATP-dependent chromatin remodelling complex (Figure 3).
Each of the MRF members has been shown to heterodimer-
ise in vitro, and in vivo with quasi-ubiquitous E proteins that
are the alternatively spliced products of the E2A gene: E12 and
E47 [26-28]. Basically, dimers formed from bHLH proteins dif-
fer in their abilities to bind to DNA. For example, MyoD-E47
heterodimer forms efficiently and binds strongly to DNA,
whereas MyoD homodimers only poorly bind DNA. These
Table 1. The different maturation stages and
genes/proteins potentially involved at each stage
of skeletal muscle formation.
Myogenic stage Associated genetic factors
Delamination Pax3, c-Met
Migration c-Met/HGF, Lbx1, Msx1
Proliferation Pax, c-Met, Mox3, Six, (Myf5, MyoD)
Determination MRFs: Myf5, MyoD, MRF4
Differentiation MRFs (MyoD, myogenin, MRF4)
MEF2 (MEF2 A, B, C, D)
HGF: Hepatocyte growth factor; MEF: Myocyte enhancer factor;
MRF: Muscle regulatory factor; Myf: Myogenic factor; MyoD: Myogenic
determination.
Figure 2. The MRFs functional network during muscle differentiation. MyoD, Myf5 and MRF4 are necessary for the commitment
of the somitic cells to the myogenic lineage. They are also called the myogenic determination factors. Myf5 is a positive regulator of
MyoD expression and has a direct or indirect role in myogenin gene activation. Myogenin, in turn, stimulates MyoD expression, and both
MyoD and myogenin are necessary for the late expression of MRF4 in terminal differentiation. Finally, MRF4, MyoD and myogenin
promote the expression of late stage markers such as muscle creatine kinase and myosin heavy chain.
MCK: Muscle creatine kinase; MEF: Myocyte enhancer factor; MHC: Myosin heavy chain; MRF: Muscle regulatory factor; MyoD: Myogenic determination.
External
signals
MRF4
Growth
factors
MyoD
Myf5
Determination Differentiation
MRF4Myogenin
Muscle-specific
genes
(MCK, MHC…)
Maturation](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-160-320.jpg)
![Author Proof
Yahi, Philipot, Guasconi, Fritsch & Ait-Si-Ali
Expert Opin. Ther. Targets (2006) 10(6) 5
heterodimers bind to the consensus sequence CANNTG, the
so-called E-boxes (reviewed in [29,30]). The E-boxes are located
in the regulatory regions of muscle-specific genes, such as
MCK, Desmin and Tropinin I [31,32]. E-boxes occur frequently
on the genome and not only in the regulatory region of muscle
genes. Thus, intermolecular interactions appear to be necessary
for MyoD to activate muscle gene transcription. Binding sites
for factors such as MEF2 can functionally substitute for the
second E-box, indicating that the cooperative interactions
with adjacent factors are crucial for establishing a stable and
functional transcriptional complex [33].
3.3 MyoD, the major player
MyoD is considered as the major player in triggering muscle
terminal differentiation, even if Myf5 has a redundant role
in muscle development and adult myogenesis [34]. The abil-
ity of MyoD to convert non-muscle cells into skeletal muscle
strongly indicates that it might have a central role in myo-
genesis [35,36]. These findings provided the first direct evi-
dence that a single gene can initiate a complex programme
of differentiation, acting as a ‘master switch’ as named by
S Tapscott [37]. The role of MyoD in the cell-cycle arrest and
in triggering muscle differentiation will be discussed below,
as well as the repressive complexes that inhibit MyoD activ-
ity. Indeed, the myogenic activity of the bHLHs and MEF2
factors is both positively and negatively regulated by differ-
ent chromatin remodelling enzymes [38] and ATP-dependent
chromatin remodelling complexes, which play a pivotal role
in transcriptional regulation. For example, both families of
proteins associate with HATs and HDACs, which act in an
opposing manner to control the acetylation state on
nucleosomal histones (and of the proteins themselves), in
proliferating and differentiating myoblasts.
3.4 The myocyte enhancer binding factor 2 family
The MEF-2 family is part of the MADS-box-containing pro-
teins (MCM1, agamous, deficiens, serum response factor). In
vertebrates, the four genes of the MEF-2 family are Mef2: A, B,
C and D [39], and their alternative splicing gives rise to the
MEF2 proteins. These transcription factors bind to A/T-rich
sequences found at a number of muscle-specific promoters [39].
MEF2 proteins contain the highly conserved MADS, and
the adjacent MEF2 domains, involved in DNA binding and
dimerisation [40]. MEF2 factors can directly interact with, and
help, MyoD to bind to E boxes (recognised by the bHLH fac-
tors). Indeed, in many muscle-specific genes, the MEF2 bind-
ing sites and E boxes are juxtaposed [41]. Moreover, activation
of muscle gene expression by myogenic bHLH proteins
depends on their association with members of the MEF2
family [15], as documented by experiments of loss-of-function
on Mef2 that inhibited differentiation [42,43].
The four Mef2 genes’ expression profile corresponds to that
of myogenin, suggesting that MEF2 proteins are implicated in
the final steps of muscle differentiation [44]. The Mef2c gene is
the first member of the MEF2 factors to be expressed at the
onset of differentiation of skeletal muscle lineage in vivo,
followed by the expression of the other Mef2 genes, and its
expression is maintained throughout skeletal muscle develop-
ment. It has been shown that Mef2c is a direct transcriptional
target for MEF2 and myogenic bHLH proteins [45].
4. Chromatin remodelling enzymes in
proliferating myoblasts
It is interesting to take a glance at MyoD expression through-
out the cell cycle, because MyoD is expressed in proliferating
myoblasts without triggering muscle differentiation. MyoD
levels increase during G1 phase until a restriction point where
MyoD becomes phosphorylated on serine 200 and is then
ubiquitinylated to be finally degraded. After the S phase,
MyoD levels start increasing again, but at the onset of mitosis
MyoD is phosphorylated on serines 5 and 200 by
cyclin/CDK1 complexes and is further ubiquitinylated then
degraded [46-49]. In proliferating myoblasts, MyoD actually
represses its target genes. Indeed, class I and II HDACs are
expressed in proliferating myoblasts, providing a potential
explanation for the inability of MyoD, and MEF2, to activate
their target genes prior to differentiation. There would be at
least 17 HDACs, which are organised in three classes: I, II
and III. Class I HDACs are expressed ubiquitously, whereas
class II HDACs are highly enriched in heart, skeletal muscle
and brain. Thus, in proliferating myoblasts, MyoD is associ-
ated with class I HDACs through its bHLH region [38,50,51]
(Figure 3A). This interaction represses the transcriptional activ-
ity of MyoD, in part, by deacetylating MyoD itself [51], and by
deacetylating histones on its target gene promoters [50-52]. The
dimerisation of MyoD with its co-activators E12 and E47 is
also prevented as they are heterodimerised with antimyogenic
Id protein [53]. Furthermore, the activity of MEF2 proteins is
repressed by association with class II HDACs (HDAC4 and
HDAC5), resulting in histone deacetylation on, and
transcriptional repression of, muscle genes [54].
Finally, the class III histone deacetylase Sir2, a
NAD+-dependent deacetylase, inhibits myogenesis by form-
ing a complex with the HAT p300/CBP-associated factor
(PCAF) and MyoD and, when overexpressed, retards muscle
differentiation. Conversely, cells with decreased Sir2 differ-
entiate prematurely [52].
Moreover, the recruitment of the HDAC complexes to
deacetylate histones on the muscle promoters before differen-
tiation contributes to H3K9 methylation by histone methyl-
transferases (HMTs) on these same promoters. H3K9
surrounding a MEF2 binding site in the inactive myogenin
promoter is, indeed, highly methylated in proliferating myob-
lasts, but becomes acetylated during muscle differentiation,
when the myogenin gene is activated [55]. Methylated H3K9 is
a repressive epigenetic mark, which is recognised by hetero-
chromatin protein HP1, and thus contributes to form a
heterochromatic structure that represses transcription in a
stable way (Figure 3A). The authors’ results demonstrate that](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-162-320.jpg)
![Author Proof
Chromatin modification and muscle differentiation
6 Expert Opin. Ther. Targets (2006) 10(6)
MyoD protein interacts also with HP1 in myoblasts
(unpublished observation).
Other repressive HMTs negatively regulate muscle differen-
tiation. Notably, Ezh2, which is a polycomb protein with a
HMT activity specific for histone H3K27, is recruited specifi-
cally on muscle specific genes in proliferating myoblasts [56].
Ezh2 is found in a protein complex containing HDAC1
(Figure 3A). Indeed, muscle gene promoters were found to be
hypermethylated on H3K27 and thus silenced. Triggering of
differentiation and muscle gene activation is coupled with the
loss of this repressor complex from these loci. H3K27
becomes hypomethylated and the transcriptional activators
MyoD and MEF2 are recruited, allowing the transcription of
their target genes. Downregulation of Ezh2 coincided with
activation of muscle gene expression and its hyperexpression
inhibited muscle differentiation. These findings suggest the
existence of a two-step activation mechanism, whereby
removal of Ezh2-mediated H3K27 methylation, followed by
the recruitment of positive transcriptional regulators at dis-
crete genomic loci, are required to promote muscle gene
expression and cell differentiation. The Ezh2 complex might
not regulate the expression of every muscle-specific gene.
Indeed, myogenin expression is not influenced by Ezh2 [56].
5. Chromatin remodelling enzymes in
differentiating myotubes
During the early process of skeletal muscle differentiation,
myogenic factors regulate the transition from the proliferative
to a differentiating stage. Myoblasts must irreversibly exit the
cell cycle prior to the activation of muscle-specific gene.
Studies have revealed that MyoD contributes to both of these
events (reviewed in [57]). These two functions of MyoD are
controlled by distinct mechanisms: indeed, MyoD basic region
mutants are unable to activate differentiation, but can still
induce cell-cycle arrest [58]. The key step to growth arrest
involves the downregulation of cell cycle activators such as cyc-
lins (except cyclin D3) and cyclin-dependent kinases (CDKs),
and upregulation of cell-cycle inhibitors such as retinoblastoma
protein Rb, p21, p27 and p57. Cyclin D3, together with Rb
and the CDK inhibitor protein p21, are critical cell-cycle regu-
lators for MyoD-mediated growth arrest [59,60]. These genes
share the properties of being non-muscle-specific genes already
expressed in proliferating myoblasts, but have their expression
level raised by MyoD at the onset of differentiation [60]. In dif-
ferentiating myoblasts, MyoD associates to CREB (c-AMP
responsive element binding protein) and activates the Rb pro-
moter in cooperation with the HATs p300 and PCAF [61].
Hypophosphorylated Rb promotes cell cycle arrest and the
expression of late-stage muscle-specific genes, and also prevents
apoptosis during myoblast differentiation [62,63]. On the other
hand, a functional link between MyoD, HDAC1 and Rb pro-
tein, has been provided by Puri et al. [64] (Figure 3B). Indeed,
Rb has been shown to positively regulate muscle differentiation
by competing with MyoD for binding to HDAC1. During
muscle differentiation, HDAC1 is released from MyoD and
associates with hypophosphorylated (active) Rb. Rb-HDAC1
complex appear to stimulate differentiation by repressing E2F
target genes, which are responsible of the G1/S transition [65].
Moreover, H3K9 methylation mediated by Suv39h is neces-
sary for the silencing of E2F target genes. This H3K9 methyla-
tion of the E2F target genes is a prerequisite for the induction
of terminal muscle differentiation [66]. Suv39h is indeed
required for the silencing of proliferation genes and for the
activation of the programme of muscle differentiation, and
thus it plays a major role in the control of the balance between
proliferation and differentiation.
Skeletal muscle terminal differentiation is initiated by
MyoD, which binds directly to the regulatory regions of genes
expressed during skeletal muscle differentiation and initiates
chromatin remodelling at specific promoters, such as myogenin,
MCK and the MyoD gene itself. To this end, MyoD interacts
with an adjacent protein complex containing the homeodo-
main protein Pbx1, which appears to be constitutively bound at
the muscle gene promoters [67]. Pbx1 binds constitutively to the
promoter in a SWI/SNF-independent manner, suggesting a
two-step mechanism in which MyoD initially interacts indi-
rectly with the myogenin promoter and attracts chroma-
tin-remodelling enzymes [68], which then facilitate direct
binding by MyoD and other regulatory proteins such as HATs.
The HATs/MyoD complex has two distinct HAT activities,
p300/CBP and PCAF [38,69-72], which are necessary for the
full transcriptional activity of MyoD on chromatin-associated
templates [70,73]. First, MyoD would recruit p300/CBP to the
promoter, allowing p300/CBP to acetylate histones H3
and H4. p300/CBP would then recruit PCAF (the
p300/CBP-associated factor), which acetylates three lysine resi-
dues within MyoD, thereby facilitating the transactivation
process of muscle differentiation (Figure 3B and C) [73,74].
The authors also previously showed how class II HDACs (4,
5, 6 and 7) negatively regulate muscle differentiation through
association with members of the MEF2 family [38,75]. To initi-
ate muscle differentiation, CamK, a calcium-dependant kinase
under the control of the insulin growth factor (IGF-1), triggers
the phosphorylation of two serine residues on HDAC5,
resulting in its dissociation from MEF2 Figure 3B. Then, phos-
phorylated HDAC5 associates with the 14-3-3 chaperone,
which activates a nuclear export sequence in HDAC5 and
leads to its exportation from the nucleus. The following
recruitment of p300/PCAF and other co-activators with HAT
activity to MEF2 allows muscle-specific transcription and
myotube formation [72,76].
In addition to the HATs, the SWI/SNF ATP-dependent
chromatin remodelling complex and the histone arginine
methyltransferase, co-activator-associated arginine methyltrans-
ferase 1 (CARM1), have emerged as positive key regulators of
skeletal myogenesis [55,77]. MyoD recruits the SWI/SNF
ATP-dependent chromatin-remodelling complex through an
interaction that can be regulated by the p38
MAPK Figure 3C [77,78]. At myogenic loci, the p38 kinase](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-163-320.jpg)
![Author Proof
Yahi, Philipot, Guasconi, Fritsch & Ait-Si-Ali
Expert Opin. Ther. Targets (2006) 10(6) 7
phosphorylates the SWI/SNF subunit BAF60 [78]. Moreover,
the forced activation of the p38 pathway promotes SWI/SNF
recruitment, facilitates MyoD and MEF2 binding, leads to the
recruitment of RNA polymerase II and anticipates expression of
late muscle markers at early stages of differentiation [79]. Inhibi-
tion of SWI/SNF activity, as well as inhibition of HAT activity,
prevents the ability of MyoD to initiate transcription and
chromatin remodelling at specific loci [69,77,80]. Recent results
suggest that functional SWI/SNF complexes are required for
MyoD to activate muscle-specific gene transcription, but not to
activate negative cell-cycle regulators [77].
Recent reports showed that histone arginine methylation
also plays an important role in the positive regulation of mus-
cle gene expression. CARM1, which methylates arginines, is a
positive regulator of skeletal myogenesis via direct interactions
with MEF2C Figure 3B [77]. Indeed, CARM1, which is a
member of the protein arginine–N-methyltransferase family
(PRMT) has been shown to interact with MEF2 on the
endogenous MCK promoter in a differentiation-dependent
manner. Furthermore, the inhibition of CARM1 expression
inhibits differentiation and abrogates key transcription factors
of the differentiation cascade (myogenin and MEF2). The
recruitment of CARM1 during MEF2-dependent activation
of MCK expression and its function as a MEF2 co-factor sug-
gest that histone arginine methylation (such as that of histone
H3), and non-histone targets, potentiates the process of
terminal muscle differentiation.
6. Insights from muscle regeneration studies
Studies of muscle regeneration from satellite cells have
brought more information on the different partners involved
in muscle differentiation. In response to injury, quiescent sat-
ellite cells, located between the basal lamina and the mature
differentiated muscle fibres, are activated and start proliferat-
ing to form myoblasts [81]. These myoblasts divide a limited
number of times before terminally differentiating and fusing
to form multinucleated myotubes [82,83]. The myogenic line-
age progression of satellite cells and their myoblastic progeny
is regulated by various transcription factors, including the
paired-box transcription factors Pax3 and Pax7 and the
MRFs Myf5, MyoD and myogenin [84]. Satellite cells activa-
tion from quiescence is initially characterised by upregulation
of MyoD and Myf5 expression, which precedes mitotic activ-
ity and is maintained in proliferating satellite cell-derived
myoblasts. Myogenin is also upregulated following the same
progression as in embryonic myogenesis [85]. Most of the acti-
vated cells commit to differentiation; however, a minority
downregulates MyoD, while keeping a robust expression of
Pax7, and stops DNA synthesis, thus adopting a phenotype
that resembles that of quiescent satellite cells again. This
maintenance of satellite-cell populations seems to be a uni-
versal mechanism [84]. Finally, it has been shown that MyoD
acetylation is important during muscle regeneration in vivo and
in embryonic stem cells [86]. Thus, one could speculate that a
defect in HAT enzymes responsible for MyoD acetylation
could have dramatic effects on muscle regeneration.
7. Pharmacological triggering of the
transcription regulators of skeletal muscle
differentiation
The detailed understanding of the intermolecular interactions
and the gene programmes the myogenic factors control is
essential to the rational design of therapeutics. Indeed, aber-
rant forms of myogenic factors, or their aberrant regulation,
could be associated with muscle disorders such as congenital
myasthenias, myotonic dystrophy (DM), rhabdomyosarcoma
and defects in muscle regeneration. As such, these proteins
could provide an enormous pool of target molecules where one
might intervene in muscle disorders, both with regard to
mechanisms that cause disease and regenerative mechanisms
that can ameliorate disease processes. Because transcription
factors often interact with each other as a means of both posi-
tive and negative regulation of effector genes, such interven-
tion comes with particular peril, as the results of
pharmacological manipulation are likely to be highly pleio-
tropic. Nevertheless, the manipulation of transcriptional sig-
nals holds the promise of treating muscle diseases by exploiting
the ability of muscle cells to regenerate after injury, and these
factors provide keys to unlock the incredible developmental
potential of muscle cells to repair their own damage [87].
The essential role of the MRFs in muscle development has
been proven by gene disruption experiments in mice. Mice
lacking MyoD, although overtly normal, also have defects in
muscle regeneration [88,89]. The stimulation of regeneration is
a function of MyoD that is likely to be important in
neuromuscular diseases. For example, the mdx mouse model
of Duchenne muscular dystrophy has more severe pathology
in the absence of MyoD [88].
MyoD has also been implicated in myotonic dystrophy [90].
DM is caused by two similar, non-coding, repeat expansion
mutations (DM1 and DM2). These are thought to produce
pathogenic RNA molecules that accumulate in nuclear foci.
DM1 is a CTG expansion in the 3′UTR (untranslated region
of dystrophia myotonica protein kinase [DMPK] RNA).
Introduction of a mutant DMPK 3′UTR into cultured
muscle cells disrupts muscle differentiation by lowering the
expression of MyoD [90,91], although the mechanism for this
effect is unclear.
Chromatin-remodelling factors also influence muscle differ-
entiation, hypertrophy and fibre-type determination, signalling
mechanisms that impinge on these transcriptional complexes,
and how these multicomponent regulatory cascades may be
exploited in the development of novel therapies to more effec-
tively treat myopathies in humans. Indeed, as mentioned previ-
ously, several HDACs have been shown to regulate MEF2- and
MyoD-activated transcription. HDACs 4, 5 and 7, all of which
are class II HDACs, can associate with each of the four
vertebrate MEF2 proteins and affect their function [38].](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-164-320.jpg)
![Author Proof
Chromatin modification and muscle differentiation
8 Expert Opin. Ther. Targets (2006) 10(6)
The ability of HATs and HDACs to physically interact
with MRFs and MEFs confounds the design of pharmaco-
logical agents aimed at these molecules, as perturbation of
HATs and HDACs could affect loci beyond those involved in
gene regulation in muscle. However, the fact that there are
drugs that inhibit HDAC activity might well provide novel
opportunities to stimulate myogenic gene programs. In a
recent and exciting demonstration of this idea, exposure of
mouse embryos in utero to non-teratogenic doses of HDAC
inhibitors (trichostatin A or valproic acid) increased the
number of somites in mice [92].
Chromatin remodelling was also implicated in the control
of cardiac hypertrophy (reviewed in [93]), which is often asso-
ciated with increased risk of mortality, and the molecular
mechanisms of cardiomyocyte hypertrophy could have a sig-
nificant impact on human health. Thus, it seems likely that
p300/CBP positively regulate cardiac hypertrophy. This
hypothesis should be easily testable with specific inhibitors of
p300/CBP, such as Lys-CoA and dominant-negative mutants
of the HAT, as shown by Gusterson et al. [94].
On another hand, Olson’s group results suggest key roles
for class II HDACs as negative regulators of cardiac hypertro-
phy [55], found that diverse hypertropic signals stimulate the
activity of a cardiac HDAC kinase(s) that phosphorylates the
14-3-3 binding sites in HDAC4, -5, -7 and -9, and that
signal-resistant mutants of these HDACs containing alanines
in place of the target serine residues are potent repressors of
hypertrophy. These results strongly suggest that class II
HDACs function as signal-responsive repressors of cardiac
hypertrophy and heart failure, presumably through their
capacity to inhibit MEF2 target genes.
8. Conclusion
More is now understood about how chromatin remodelling
enzymes regulate myogenesis at the molecular level. However,
much remains to be done to fully evaluate the involvement of
these enzymes in muscle disease initiation and progression. It
will be of great interest to determine their target genes in the
context of muscular homeostasis. On the basis of this infor-
mation, it should be possible to develop novel drugs and
specific treatment strategies having fewer side effects than is
currently the case.
9. Expert opinion
All of the myogenic transcription factors represent potential
targets where pharmacological intervention could have a
dramatic impact on disease processes. Agents affecting
calcium signalling, protein phosphorylation and protein
methylation could also be exploited and are another class of
target molecules for the design of therapies.
Chromatin-modifying enzymes play critical roles in the
control of muscle gene regulatory programs. A major chal-
lenge for the future is to understand how these enzymes are
coopted by signalling cascades to allow for rapid and precise
changes in gene expression in response to physiological and
pathological cues. Elucidation of these molecular mechanisms
will undoubtedly reveal novel targets that are amenable to
pharmacological manipulation in the treatment of
muscle-related diseases in humans.
In addition to traditional pharmacological approaches,
techniques such as gene therapy and RNA interference [95] are
important for manipulating this biologically important class
of molecules in muscle cells. Indeed, small interfering RNAs
(siRNA) could be inoculated into humans, in order to knock
down the expression of a harmful gene. RNA interference
gene-silencing mechanism is induced by small
double-stranded RNA and is highly sequence specific. It is an
extremely powerful tool for silencing gene expression in vitro,
and might be used as therapy in human muscle pathologies to
specifically target a pathological version of a given RNA. It
could for example suitable for use to knock down the patho-
genic DMPK RNA in myotonic dystrophy. Indeed, the use of
lentivirus-delivered short hairpin RNAs (shRNAs) seem to
downregulate the endogenous nuclear retained mutant
DMPK mRNAs in cultured cells [96].
The emerging role of small non-coding RNAs in many cell
processes, including muscle differentiation, will be of great
therapeutical interest. Some of these microRNAs, such as
miR181, are directly involved in muscle differentiation [97]. It
was, for example, recently demonstrated that a mutation in
the 3′UTR of myostatin RNA creates a binding site for two
microRNAs expressed in muscle cells causing a translation
inhibition of the myostatin gene and then contributing to
muscle hypertrophy [98]. Non-coding RNAs are linked to
chromatin remodelling and gene silencing, at least in some
organisms such as plants and fission yeast [99]. It will be of
great interest to further investigate the link between the
non-coding RNAs and chromatin remodelling in mammals.
Deciphering such a link might help in a better understanding
of chromatin remodelling in muscle physiopathology and the
design of new therapies targeting non-coding RNAs.
Acknowledgements
The authors’ laboratory is supported by the Association
Française contre les Myopathies (AFM), the Ligue
Nationale contre le Cancer (LNCC), the Association pour
la Recherche sur le Cancer (ARC), the Fondation
Bettencourt-Schueller, and the European grant
LSHG-CT-2004-502950. H Yahi and V Guasconi were
recipients of fellowships from the Ligue Nationale contre le
Cancer, and OP from Ministère de la Recherche.](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-165-320.jpg)
![Genome Biology 2007, 8:R270
Open Access!""#Robinet al./olume 2, Issue 6!, 7rticle R!#"Method
Post-translational modifications of histones H3 and H4 associated
with the histone methyltransferases Suv39h1 and G9a
:hilippe Robin=, Lauriane Fritsch=, @phélie :hilipot=, Fedor SvinarchuEF
and Slimane 7it-Si-7li=
7ddresses: =Centre National de la Recherche ScientifiLue (CNRS) FRE !PQQ, Institut 7ndré LRoff, rue GuT UoLuet, /illejuif F-PQ2"6, FranceW
Xniversité :aris-Sud, /illejuif F-PQ2"6, France. FCentre National de la Recherche ScientifiLue (CNRS) FRE Y"62, GENET[@N, bis rue de
l'Internationale, EvrT F-P6""!, FranceW Xniversité d'EvrT, EvrT F-P6""!, France.
Correspondence: Slimane 7it-Si-7li. Email: aitsiali]vjf.cnrs.fr
© 2008 Robin et al.; licensee BioMed Central Ltd.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
[istone modifications associated Rith [UTs^p_Uass spectrometrT analTsis of the post-transcriptional modifications of histones [Y and [Q that Rere co-purified Rith histone meth-Tltransferases SuvYPh6 and GPa shoRs that, in [eLa cells, histone methTltransferases can be phTsicallT associated Rith acetTlated histones,Rhich normallT marE transcriptionallT active chromatin.^`p_
Abstract
Specific combinations of post-translational modifications of histones alter chromatin structure,
facilitating gene transcription or silencing. Here we have investigated the 'histone code' associated
with the histone methyltransferases Suv39h1 and G9a by combining double immunopurification and
mass spectrometry. Our results confirm the previously reported histone modifications associated
with Suv39h1 and G9a. Moreover, this method allowed us to demonstrate for the first time an
association of acetylated histones with the repressor proteins Suv39h1 and G9a.
Background
The amino-terminal tails of nucleosomal histones protrude
from the aN7 and are subject to covalent modifications.
These modifications include lTsine acetTlation, lTsine and
arginine methTlation, serine and threonine phosphorTlation,
7a:-ribosTlation, and ubiLuitination c6d. [istone lTsine
methTlation can have different effects depending on the resi-
due that is modified: methTlation of histone [Y at LTsQ
([YeQ) is associated Rith gene activation, Rhereas methTla-
tion of [YeP, [Ye!#, and [Qe!" generallT correlates Rith
transcriptional repression c!-Qd. The roles of [YeYf and
[Ye#P methTlation remain elusiveW indeed, these modifica-
tions are associated Rith both transcriptional activation and
repression cg,fd.
LTsine residues can be mono-, di-, or trimethTlated, inducing
different biological responses cY,#,2d. Thus, for example,
highlT condensed heterochromatic regions shoR a high
degree of trimethTlated [YeP ([YePmeY), Rhereas euchro-
matic regions are preferentiallT enriched in mono- and
dimethTlated [YeP c!,Yd. [istone lTsine methTlation is
mediated bT histone methTltransferases ([UTs), manT of
Rhich contain a conserved SET cSu(var)Y-P, Enhancer-of-
zeste, Trithoraxd domain, such as SuvYPh6 (Suppressor of
variegation YPh6) and GPa c6,!,Pd. SuvYPh6 belongs to a fam-
ilT of peri-centromeric proteins and is responsible for [YeP
trimethTlation c6"-6Yd. GPa (Eu[UTase-!) is the major
methTlase responsible for mono- and dimethTlation of [YeP
in euchromatic regions c6Q,6gd, but it maT also be present in
heterochomatic regions c6fd.
Covalent modifications of histones can regulate gene expres-
sion directlT or through recruitment of non-histone effector
proteins c!,6#d. These effector proteins bind modified chro-
matin using a varietT of chromatin-binding domains. For
example, bromodomains recognize acetTlated lTsines,
Rhereas chromo, UBT, Tudor, kQ" domains and :[a fin-
gers, recognize methTlated lTsines c6#,62d. Repressive
Published: 20 December 2007
Biology 2007, 8:R270 (doi:10.1186/gb-2007-8-12-r270)
Received: 2 October 2007
Revised: 6 December 2007
Accepted: 20 December 2007
The electronic version of this article is the complete one and can be
found online at http://genomebiology.com/2007/8/12/R270](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-171-320.jpg)
![(Fig. 6A). Overexpression of any of the HP1 isoforms, ␣, , or
␥, resulted generally in the inhibition of differentiation com-
pared with the control cell line. HP1-overexpressing cells did
not express the differentiation markers myogenin and MCK
(Fig. 6B) and did not fuse into myotubes (data not shown).
The faint expression of MCK and myogenin in HP1␣-ex-
pressing cells cultured in differentiation medium was due to
the fact that this cell line was not pure for the expression of
tagged HP1␣, ϳ90%; during cul-
ture, some cells lost tagged HP1␣
expression. We presume that
these cells differentiated normally
and expressed myogenin and
MCK.
Overexpression of HP1 proteins
could have broad effects (31). Thus,
differentiation inhibition we have
seen in cells overexpressing HP1
proteins could be a result of these
broad effects. To check the specific-
ity of the effects seen when we over-
express HP1 isoforms (Fig. 6, A and
B), we performed ChIP experiments
using anti-FLAG resin to test
whether the tagged HP1 isoforms
are recruited to MyoD target genes.
Our results show that the exoge-
nous HP1 isoforms are indeed phys-
ically recruited into MyoD target
genes (Fig. 6C), but unlike the
endogenous HP1 (Fig. 5), these
exogenous isoforms remain on
MyoD target promoters even in
myoblasts cultured in differentia-
tion conditions (Fig. 6C). This result
suggests that the differentiation
defect seen in HP1-overexpressing
myoblasts could be due, at least in
part, to a lack of de-repression of
MyoD target genes. Taken together,
these results suggest that overex-
pression of HP1 proteins impairs
MyoD target genes expression and
thus muscle terminal differentia-
tion, regardless of the HP1 isoform.
DISCUSSION
Repression of MyoD target genes
in proliferating myoblasts involves
H3K9 methylation (20, 22), which is
normally recognized by HP1 pro-
teins (4, 5). This suggests the forma-
tion of local facultative heterochro-
matin on MyoD target promoters,
insuring their stable repression
until the cells undergo terminal dif-
ferentiation. We tested the hypoth-
esis that HP1 proteins are involved
in the repression of MyoD target genes and explored their role
in muscle terminal differentiation in general.
Physical and Functional MyoD/HP1 Interaction—Immuno-
precipitation assays showed that MyoD interacts with HP1␣
and HP1, but not with HP1␥ in myoblasts. In vitro assays dem-
onstrated that MyoD interacts directly with HP1␣ and HP1
via their chromoshadow domains and the MyoD transactivat-
ing domain. A reporter gene assay indicated that this interac-
A
IB:MyoD
IB:GST
GST-HP1α
GST-HP1β
GST-HP1γ
GST
1 32 4
WT
119-189
1-119
67-119
1-67
C
IB:MyoD
IB:GST
CD CSD
1 67 119 189
HP1α
1 32 4 5
GST-HP1α:
MyoDWT
MyoDWT
Cteraa173-318
Nteraa1-114
∆Cteraa1-241
∆Nteraa83-318
GST-HP1βGST
Emptyvector
α-Flag
α-GST
GST-HP1β
GST
α-HA
D
1 31899 167
CterNter bHLH
TAD
Dimerization
DNA binding TAD
MyoD
GST
GST-HP1α
GST-HP1β
GST-HP1γ
GST
GST-HP1α
GST-HP1γ
input
input
GST-HP1α
GST-HP1γ
GST-HP1β
GST-HP1α
GST-HP1γ
+ --- --+ + + +++
1 2 3 4 5 6 7 8 9 10 11 12 13 14
MyoDMyogenin
MyoDMyogenin
B
MyoDWT
Cteraa173-318
Nteraa1-114
∆Cteraa1-241
∆Nteraa83-318
Emptyvector
E
*
*
*
* *
35,1
47,4
24,9
24,9
35,1
47,4
35,1
47,4
60,4
24,9
MW
KDa
MW KDa
MW KDa
y
MW KDa
35,1
*
*
*
*
*
47,4
35,1
24,9
47,4
60,4
24,9
35,1
47,4
24,9
47,4
60,4
FIGURE 3. HP1␣ and HP1, but not HP1␥, interact directly with MyoD in vitro via their chro-
moshadow domain and MyoD transactivating domain. A, HP1␣ and HP1 interact directly with MyoD
in a GST pulldown assay. Equivalent amounts of bacterially produced untagged MyoD were incubated
with GST beads (lane 4) or GST-HP1 beads (lanes 1–3). MyoD was detected by Western blotting using an
anti-MyoD antibody (upper panel), and GST fusions using an anti-GST antibody (lower panel). IB, immuno-
blot. B, unlike MyoD, myogenin does not interact with HP1 proteins. Myogenin and MyoD were in vitro
translated in the presence of radioactive [35
S] methionine (inputs on lanes 1 and 14, respectively). MyoD or
myogenin were incubated with equivalent amounts of either GST or GST-HP1 proteins, as indicated. GST
pulldown was then conducted as described under “Experimental Procedures,” except that at the end of
the experiment, the radiolabeled proteins were detected by autoradiography. Lanes 1–8, GST pulldown
experiment with [35
S]myogenin; lanes 9–14, with [35
S]MyoD. C, the chromoshadow domain of HP1␣ is
required for interaction with MyoD. Equivalent amounts of bacterially produced MyoD were incubated
with GST-HP1␣ deletion mutants on beads (lanes 2–5) or GST-HP1␣ wild type (lane 1). MyoD was detected
by Western blotting using an anti-MyoD antibody (upper panel) and GST fusions using an anti-GST anti-
body (lower panel). D, HP1 interacts with MyoD wild type and with MyoD deletion mutants containing
the C-terminal domain. Top panel, schematic diagram of MyoD functional domains . TAD, transactivation
domain. Lower panels, wild type MyoD was detected using anti-FLAG antibody, and its deletion mutants
were detected using anti-HA antibody (upper panels). GST and GST-HP1 were detected using anti-GST
antibody (lower panel). E, Western blotting using anti-FLAG and anti-HA to verify the expression level of
MyoD and its deletion mutants in HeLa cells used in D*
, specific bands.
HP1 and Terminal Differentiation
23696 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008
atCNRSonMarch26,2009www.jbc.orgDownloadedfrom](https://image.slidesharecdn.com/1cadc5b6-0df2-4ecd-a684-c949097bc1c4-150604075202-lva1-app6892/85/manuscrit-these-Ophelie-Philipot-186-320.jpg)
manuscrit these Ophelie Philipot
- 1. UNIVERSITE PARIS XI FACULTEDE MEDECINE PARIS-SUD Année 2008/2009 N° attribué par la bibliothèque THESE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITE DE PARIS XI Champ disciplinaire : Biochimie, Biologie Cellulaire et Moléculaire École Doctorale de rattachement : « Cancérologie : Biologie, Médecine, Santé » (0418) Présentée et soutenue publiquement par Ophélie PHILIPOT Le 21 Octobre 2009 Titre : Coopération entre le facteur de transcription CBF (Runx1-CBFβ) et le facteur myogénique MyoD dans la régulation de l’équilibre prolifération-différenciation musculaire Directeur de Thèse : AIT-SI-ALI Slimane JURY Président : Pr AUCLAIR Christian Rapporteur : Dr VANDEL Laurence Rapporteur : Dr DELVA Laurent Examinateur : Pr WEITZMAN Jonathan Directeur de thèse : Dr AIT-SI-ALI Slimane
- 2. A Patrick etAnnie,
- 3. Table des matières REMERCIEMENTSi LISTE DES FIGURES iii LISTE DES ABREVIATIONS iv AVANT-PROPOS 1 CHAPITRE I 2 LE MUSCLE SQUELETTIQUE 2 I. INTRODUCTION: PRESENTATION DU MODELE D’ETUDE, LE MUSCLE STRIE 2 I.1 Les types cellulaires qui composent le muscle strié 2 I.1.1 Les cellules extra fusales, ou cellules musculaires striées 2 I.1.2 Les cellules satellites 3 I.1.3 Les cellules du fuseau neuromusculaire 4 II. MISE EN PLACE DES FIBRES MUSCULAIRES STRIEES 4 II.1 Mise en évidence des MRFs 4 II.2 Détermination et différenciation des cellules musculaires au cours de la myogenèse embryonnaire 5 II.3 Les protéines Mef2, co-facteurs des MRFs 6 II.4 Relation structure/ fonction des MRFs 8 II.4.1 Le domaine bHLH est impliqué dans la fixation sur l’ADN et dans la dimérisation avec les protéines E 8 II.4.2 Les domaines de transactivation (TAD) N-terminal et C-terminal régulent l’activité des MRFs 9 II.5 La différenciation terminale se décompose en deux étapes discrètes 10 II.5.1 La sortie du cycle prolifératif 11 II.5.2 L’activation des gènes spécifiques du muscle 11 III. L’EQUILIBRE PROLIFERATION-DIFFERENCIATION DANS LE MUSCLE 12 III.1 Régulation négative de l’activité de MyoD dans les myoblastes proliférants 12 III.1.1 MyoD et ses cofacteurs sont régulés négativement au cours du cycle cellulaire 12 III.1.2 Les protéines bHLH inhibitrices séquestrent MyoD et ses co-facteurs 14 III.1.4 Dans les myoblastes en prolifération, MyoD contribue à la répression épigénétique de ses gènes cibles 15 III.2 MyoD orchestre la différenciation musculaire terminale 18 III.2.1 MyoD promeut la sortie du cycle cellulaire en stimulant l’expression de Rb, p21 et la cycline D3 18 III.2.2 MyoD interagit avec des facteurs régulant de manière positive sa fixation à l’ADN 20 III.2.3 Plusieurs voies de signalisation régulent positivement la différenciation musculaire 20 III.2.3 MyoD recrute des enzymes de remodelage de la chromatine sur ses gènes cibles 21
- 4. IV. LE MAINTIENDU MUSCLE ET SA REGENERATION DEPENDENT DE SON INNERVATION 25 IV.1 Le maintien de muscle adulte par les cellules satellites 25 IV.2 Le muscle adulte est régulé par son innervation 26 CHAPITRE II 29 LE FACTEUR DE TRANSCRIPTION RUNX1/CBFβ 29 I. INTRODUCTION : DECOUVERTE DE LA FAMILLE DE PROTEINES A DOMAINE RUNT ET CBFβ 29 II. EXPRESSION ET FONCTION DE RUNX1 ET CBFβ 31 II.1 Fonctions biologiques de Runx1 et de la sous-unité CBFβ chez les mammifères 31 II.2 Organisation génomique de Runx1 et CBFβ 34 II.2.1 Les deux promoteurs de Runx1 et l’épissage alternatif de son ARNm sont à l’origine de ses nombreuses isoformes 34 II.2.2 La protéine CBFβ et ses isoformes 36 II.3 Relation Structure/ Fonction 37 II.3.1 La sous-unité protéique Runx1 37 II.3.2 La sous-unité protéique CBFβ 40 III. REGULATION DE L’ACTIVITE DU FACTEUR DE TRANSCRIPTION CBF 41 III.1 Régulation positive de l’activité de transactivation de Runx1 42 III.2.1 Phosphorylation, acétylation et méthylation de Runx1 42 III.2.2 Modulation de l’activité de Runx1 par la MAP kinase ERK 43 III.2 Régulation négative de l’activité de Runx1 44 III.2.1 Groucho/TLE 44 III.2.2 mSin3A et les HDACs 45 III.2.3 HMTs 46 III.3 Régulation de la formation du dimère fonctionnel CBF par la localisation subcellulaire des sous- unités Runx1 et CBFβ 46 IV. CBF DANS LE CONTROLE DE L’EQUILIBRE PROLIFERATION- DIFFERENCIATION 47 IV.1 Régulation croisée entre CBF et les régulateurs du cycle cellulaire 47 IV.1.1 CBF accélère la phase G1 et stimule l’entrée en phase S 47 IV.1.2 Régulations croisées entre les régulateurs du cycle cellulaire et Runx1 48 IV.2 CBF et l’équilibre prolifération-différenciation 50 PRESENTATION DU PROJET DE RECHERCHE 53 CONTEXTE 53 PROBLEMATIQUE 54 ARTICLE DE RECHERCHE 55 DISCUSSION DES RESULTATS 77 Validation de la stratégie d’approche 77
- 5. Identification de Runx1-CBFβau sein du complexe MyoD 77 MyoD interagit avec CBF via la sous-unité Runx1 78 MyoD et CBF interagissent ensemble dans les myoblastes murins, préférentiellement en prolifération 79 CBF est recruté sur les gènes cibles de MyoD préférentiellement dans les cellules musculaires en prolifération, et non en différenciation 79 Le facteur CBF régule négativement la différenciation musculaire, au profit de la prolifération cellulaire 80 Dans les myoblastes en prolifération, CBFβ est associé à des répresseurs et inhibe le remodelage de chromatine sur les gènes cibles de MyoD après induction de la différenciation 82 Conclusion et Modèle 83 DISCUSSION GENERALE & PERSPECTIVES 84 I. Régulation de la translocation de CBFβ dans le noyau des myoblastes 84 II. CBFβ dans le cytoplasme : un rôle de senseur ? 87 III. Runx1, CBFβ et MyoD : un rôle dans la différenciation ostéoblastique ! 87 IV. Les variants d’épissage de Runx1 pourraient être à l’origine d’une double fonction : le contrôle de la prolifération et de la différenciation musculaire 90 MODELISATION & CONCLUSION 93 REFERENCES BIBLIOGRAPHIQUES 95 ANNEXE 1 117 Article de revue 1 118 ANNEXE 2 130 Article 2 131 ANNEXE 3 141 Article 3 142 ANNEXE 4 151 Curriculum Vitae 152
- 6. i Remerciements Je tiens vivementà remercier le Pr Christian Auclair d’avoir accepté d’être le président du Jury de ma thèse. Également merci aux Drs Laurence Vandel et Laurent Delva d’avoir été rapporteurs de ma thèse et de m’avoir aider à améliorer ce manuscrit. Enfin, un grand merci au Pr Jonathan Weitzman, mon directeur d’unité, qui me fait l’honneur d’être examinateur de ma thèse. Ma dernière année de thèse a été ponctuée par l’installation de mon équipe sur le campus de l’université Paris-Diderot, au sein de l’unité « Epigénétique et Destin Cellulaire » dirigé par le Pr Jonathan Weitzman. Jonathan, j’admire ta manière de créer cette cohésion et cette dynamique dans notre unité. Malgré ton busy schedule, tu trouves toujours le temps d’écouter et de conseiller. Un merci tout particulier à Pierre-Antoine Defossez, aka Mr Management. Merci pour tes livres, pour ton temps précieux, tes conseils et tes astuces. Grâce à tout ça, je ne me suis fait que partiellement ensevelir par la préparation de ma thèse. Ouf ! Ensuite, un grand merci à mon laboratoire d’accueil, littéralement ma deuxième maison pendant ma thèse. Slimane, je tiens à te remercier pour tous nos échanges. Lancer ma thèse en même temps que l’installation de ton labo était un pari risqué. Aujourd’hui c’est un pari gagné et je ne suis pas peu fière d’avoir survécu à l’aventure ! Plus qu’un enseignement scientifique, c’est une leçon de vie que j’ai apprise dans ton équipe. Alors, du fond du cœur : « Merci ! ». Mes manips ont largement profité du savoir-faire de nos deux « experts » au laboratoire, Lolo et Phiphi ! Merci pour tous vos conseils techniques et votre temps. Je tiens également à remercier Véronique, pourtant à peine arrivée dans l’équipe. Sa bonne humeur contagieuse m’a permis de positiver jusqu’au bout de l’aventure. Et puis il y a Aurélie avec qui ce n’était franchement pas gagné, mais qui finalement s’est révélée indispensable pour ma santé mentale sur la dernière ligne droite. Merci un million de fois : parce que tu sais râler avec classe, pour « l’escalator » , pour les fous rires, et pour ta playlist bien moisie. Enfin, je n’oublie pas ma petite Céline, la meilleure stagiaire du monde entier : ma petite padawanette, je sais que tu iras loin ! Tu as fait un boulot fantastique sur le projet. Merci pour ton investissement, tes lumières, ton soutien, ta sagesse, tes sourires et ta bonne humeur quotidienne.
- 7. ii Je n’oublie pasmon premier labo dirigé par le Dr Annick Harel-Bellan, où s’est déroulée la majeure partie de ma thèse! Merci à tous ceux qui ont pris le temps de résoudre mes problèmes techniques et qui m’ont wisely conseillé, je pense notamment à Jacques, Sylvain, Anna… Un merci tout particulier aux « nénettes », Corinne et Cathy, pour les ragots, les imitations et les fous rires ! Et à ma Nora, celle qui a suivi de très près mes péripéties au lab et qui a toujours été là sans que je ne lui demande rien. Merci à mon rital préféré, Néri, toujours là prêt à sauter du Pont Neuf avec moi quand la qPCR a foirée! Merci à Sélim, mon coach sportif et détente: entre la piscine à l’aube les samedi mat’, les cours de salsa, les randos rollers et les après-midi bronzette, que de bons souvenirs! Je sais que tu es entre de bonnes mains avec Anna et il me tarde d’assister à ta soutenance de thèse ! Merci à ma nouvelle famille sur le campus de Paris-Diderot. Alors, à mes coacheuses shopping : Sandra, Mélanie et Fabienne. Merci pour vos tips pour ne pas me perdre dans Manhattan et profiter des bonnes affaires !! Après il y a mes fans, enfin, mon unique fan : merci Andrew de soutenir avec autant d’enthousiasme ma carrière cinématographique. Tu peux prendre rendez-vous avec mon attachée de presse A. Marchand pour une interview. Thank you Guillaume pour ton optimisme et tes blagounettes ; si t’es sage, je te léguerai mon collier de Stone-Age. Ensuite, un petit mot gentil pour Mika : n’oublie pas de m’inviter à ta crémaillère ! J’ai encore oublié de remercier Damien : merci de me prévenir avant d’aller manger, c’est mieux qu’après ! Merci Florent pour la bonne ambiance et tes communiqués de choc. Au fait, ya Heidi qui veut que je lui rende sa veste en poil de renard synthétique, merci de m’avoir balancé ! Enfin, ma chère Ryma, je te remercie pour nos petites discussions privées et aussi pour tes superbes compliments (je rigole encore pour le coup des Oscars !). Et pour finir, je lance un énorme merci à tous ceux que je n’ai pas cités mais qui ont été là à un moment ou à un autre et qui contribuent à la bonne ambiance de notre unité. Je remercie aussi ceux qui n’ont rien à voir avec le lab, mais sans qui j’aurai pris le premier TGV pour rentrer à la maison. Et bien ça y est, vous pouvez enfin me demander : alors cette thèse, tu la finis quand ? Mais il te reste encore combien d’années ? C’est normal que ce soit si long ? Et bien, « Guess what everybody ?! I did it!… and please, call me Doc’ ! » Enfin, merci à « toi, toi, mon toi ». Merci pour cette patience dont je n’ai jamais entrevu les limites. Tu as contribué à faire de cette année la meilleure des quatre… et de loin ! J’admire ton optimisme, ton énergie, ta bonne humeur, tes beaux yeux bleus… et tout le reste!
- 8. iii Liste des figures Figure1 : Les trois grandes étapes de la formation du muscle squelettique 3 Figure 2 : Structure du muscle strié (ou squelettique) 4 Figure 3 : Mise en place du muscle strié 5 Table 1 : Inactivations géniques chez la souris et phénotypes observés 6 Figure 4 : Boucles d’auto-amplification des MRFs et des protéines Mef2 8 Figure 5 : Domaines fonctionnels de MyoD 9 Figure 6 : La différenciation musculaire terminale se décompose en deux étapes discrètes 11 Figure 7 : Régulation de l’activité de Rb au cours du cycle cellulaire 13 Figure 8 : Modifications post-traductionnelles de MyoD 14 Figure 9 : Expression de MyoD au cours du cycle cellulaire 14 Figure 10 : MyoD participe au remodelage de la chromatine sur ses gènes cibles 15 Figure 11 : Dualité entre les régulateurs du cycle cellulaire et l’engagement dans la voie de différenciation terminale 18 Figure 12 : MyoD participe au remodelage de la chromatine sur ses gènes cibles 21 Figure 13 : Réponse des cellules satellites suite à une lésion ou un traumatisme 25 Figure 14 : Organisation des différents lignages hématopoïétiques 32 Figure 15 : Organisation du gène RUNX1 humain 34 Figure 16 : Structure génomique et variants d’épissage de CBFβ 36 Figure 17 : Structure du complexe formé du domaine runt de Runx1, CBFβ et l’ADN 37 Figure 18 : Domaines fonctionnels de la protéine Runx1 38 Figure 19 : Interaction particulière entre Runx1 (humain) et Ets-1 sur le site composite PBS (PEBP2 binding site) et les site EBS (Ets binding site) 39 Figure 20 : Changement de conformation de Runx1 après dimérisation avec CBFβ 40 Figure 21 : Runx1 associé à ses coactivateurs et ses corépresseurs 42 Figure 22 : Cascade de phosphorylation initiée par Runx1/p300 43 Figure 23 : Modélisation des résultats 83 Figure 24 : Représentation des rôles possibles pour MyoD, Runx1 et CBFβ dans le muscle présentés dans la discussion 93 Figure 25 : Diagramme du projet de recherche proposé par le Dr Slimane AIT-SI-ALI 94
- 9. iv Liste des abréviation ACh: acétylcholine Ala : alanine ALP : phosphatase alcaline AML : acute myeloid leukemia ARNi : ARN interférence APC : anaphase promoting complex Asp : asparagine bHLH : basic helix loop helix Bgb : Big brother BMP : bone morphogenetic protein BSP : bone sialo protein Bro : Brother CamK : Ca2+/calmodulin-dependent protein kinase CARM1 : coactivator-associated arginine methyltransferase 1 CBF : core binding factor CBP : creb binding protein Cdk : cycline dependent kinase ChIP : chromatin immunoprecipitation CKI : cyclin-dependent kinase inhibitor CREB : cAMP-responsive element binding protein EC : mouse embryonal carcinoma cells EGF : epithelium growth factor ERK : extracellular signal-regulated kinases FAB : French-American-British classification FGF : fibroblast growth factor GRIP1 : glucocorticoid receptor interacting protein 1 HA : Hemaglutinine HAT : histone acétyltransférase HDAC : histone désacétylase HGH : hepatocyte growth factor HIPK : homeodomain-interacting protein kinase HLH : helix loop helix HMT : histone méthyltransférase HP1 : heterochromatin protein 1 IGF1 : insulin-like growth factor 1 IL-3 : interleukine-3 IRES : internal ribosomal entry site Jak : kinase Janus MAPK : mitogen-activated protein kinase MCK : muscle creatine kinase Mef2 : myogenic enhancer factor 2 MHC : myosin heavy chain MPC : muscle precursor cells MRF : myogenic regulatory factor NAD : Aldehyde dehydrogenase NCAM : Neural Cell Adhesion Molecule N-CoR : nuclear receptor corepressor NLS : nuclear localisation signal NMTS : nuclear matrix targeting sequence
- 10. v NRDBn/c : negativeregulatory region for DNA binding N/C-terminal to the runt domain NRHn/c : negative regulatory region for heterodimerisation N/C-terminal to the runt domain OCN : ostéocalcine ORN : olfactory receptor neurons Osx : osterix PCAF : p300/CBP associated factor PE : Py enhancer PEBP2 : Py Enhancer Binding Protein 2 PRMT : protein-arginine N-methyltransferase Py : polyomavirus RD : runt domain SMMHC : smooth muscle myosin heavy chain SMRT : silencing mediator of retinoic acid and thyroid hormone receptor SRA : steroid receptor RNA activator STAT : signal transducer and activator of transcription SWI/SNF : switch/sucrose non fermentable TAD : transactivation domain TCR : T-cell receptor TGFβ : tumor growth factor beta TLE1 : transducin-like enhancer of split Thr : thréonine
- 11. 1 Avant-propos Une cellule peutêtre dans divers états physiologiques comme la prolifération, la différenciation, l’apoptose, la sénescence ou la quiescence. L’orientation d’une cellule vers l’une ou l’autre de ces voies doit être minutieusement contrôlée. En particulier, l’équilibre prolifération-différenciation de la cellule est fondamental pour maintenir l’intégrité des tissus. Il existe d’ailleurs de nombreuses pathologies graves associées à une dérégulation de cet équilibre. L’objectif principal de mon projet de thèse est de mieux comprendre comment l’équilibre prolifération-différenciation est régulé dans la cellule et pour cela nous avons utilisé comme modèle d’étude le muscle strié, où la différenciation terminale est bien caractérisée. Dans le muscle strié, la prolifération et la différenciation sont mutuellement exclusives : l’arrêt de la prolifération est requis pour permettre aux cellules de s’engager dans le processus de différenciation terminale. Ainsi, les régulateurs positifs de la différenciation terminale sont généralement des répresseurs de la prolifération. Dans le premier chapitre de ce manuscrit, je présente les caractéristiques du muscle squelettique. J’y décris sa structure, la manière dont il se met en place au cours du développement embryonnaire, les facteurs de transcription majeurs impliqués, l’équilibre prolifération-différenciation régulé par le facteur myogénique MyoD et, enfin, la régénération du muscle adulte et sa régulation par innervation. Dans un deuxième chapitre, je présente un facteur de transcription connu pour son rôle au cours du développement : le facteur CBF (formé du dimère Runx1 et CBFβ). Comme il sera décrit plus tard dans mes résultats, pour la première fois, je montre que ce facteur de transcription, initialement non-apparenté au muscle strié, joue de fait un rôle clé dans la régulation de l’équilibre prolifération-différenciation du muscle squelettique.
- 12.
- 13. 2 Chapitre I Le MuscleSquelettique I. INTRODUCTION: PRESENTATION DU MODELE D’ETUDE, LE MUSCLE STRIE I.1 Les types cellulaires qui composent le muscle strié Il existe trois types de cellules constituant le muscle strié (ou « muscle squelettique ») : les cellules extra fusales, majoritaires et également appelées cellules musculaires striées, les cellules satellites, et les cellules du fuseau neuromusculaire. I.1.1 Les cellules extra fusales, ou cellules musculaires striées Le muscle squelettique fait partie des muscles à contraction volontaire, contrairement aux muscles lisse et cardiaque, et il ne se contracte normalement qu’en présence de stimulation nerveuse. Il y a deux types de cellules musculaires striées en proportion variable chez l’Homme : les muscles de type I qui sont les muscles à contraction lente mais durable et les muscles de type II qui sont les muscles à contraction rapide mais courte. La différenciation du muscle en type I ou II dépend du motoneurone qui les innerve. Dans les gros muscles des membres, les petites unités lentes sont les premières recrutées dans la plupart des mouvements ; elles résistent bien à la fatigue et sont les plus fréquemment utilisées. Les unités rapides se fatiguent plus vite et sont généralement sollicitées pour les mouvements plus rigoureux. Les myotubes qui constituent les cellules musculaires fonctionnelles, dérivent des cellules progénitrices du muscle, également appelées MPCs (Muscle Progenitor Cells). Pour donner naissance aux myotubes, ces MPCs subissent d’abord une étape de détermination qui les convertit en myoblastes (figure 1). Contrairement aux myotubes, les myoblastes ont encore la
- 14. Figure 1. Lestrois grandes étapes de la formation du muscle squelettique. Après l’induction de MyoD et/ou Myf5, les cellules progénitrices du muscle (MPCs) sont engagées dans le lignage musculaire (myoblastes). Plus tard, l'activation des MRFs secondaires (myogénine et MRF4) induit la différenciation musculaire terminale des myoblastes, qui expriment alors les protéines spécifiques du muscle et fusionnent en myotubes multinucléés. Les myotubes subissent finalement une dernière étape de maturation, avec notamment leur innervation par les motoneurones, pour donner les myofibres striées. Figure adaptée de Chargé et Rundnicki, 2004. Progéniteur musculaire (MPC) Myofibre mature Myotube précoce Myoblaste Détermination MaturationDifférenciation
- 15. 3 possibilité de sediviser, en revanche, ils ne sont plus multipotents, c’est-à-dire qu’ils sont déterminés à se différencier en muscle. Sous l’influence de signaux extérieurs, les myoblastes se différencient, c’est-à-dire qu’ils sortent du cycle prolifératif, expriment des protéines spécifiques du muscle comme la créatine kinase musculaire (MCK) ou la chaîne lourde de la myosine (MHC), et fusionnent entre eux, donnant ainsi naissance aux myotubes (figure 1). Les myotubes subissent finalement une étape de maturation pour donner les fibres musculaires striées. Chaque fibre musculaire striée résulte donc de la fusion de plusieurs dizaines de cellules musculaires appelées myoblastes. La cellule musculaire striée est une cellule très spécialisée, très allongée (jusqu’à 50 cm de longueur) et de forme cyclindrique (10 à 50 µm de diamètre) : c’est pourquoi on parle également de fibre musculaire. Chaque fibre individuelle qui forme le muscle squelettique représente une unité de base du système musculaire. Elle possède une centaine de noyaux situés en périphérie. La plus grande partie du cytoplasme de ces cellules (appelé également sarcoplasme ou myoplasme) est constituée de milliers de myofibrilles organisées en faisceaux. Une myofibrille est constituée de petits cylindres allongés dans le sens de la cellule et qui donne son aspect strié à la cellule musculaire squelettique : ce sont les sarcomères, véritables unités contractiles de la cellule musculaire striée (figure 2). Le sarcomère est constitué de myofilaments fins d’actine et de myofilaments épais de myosine orientés selon le grand axe de la myofibrille. Dans le cytoplasme restant, se trouvent notamment du glycogène, des mitochondries, le réticulum endoplasmique lisse et l’appareil de Golgi. La fibre musculaire est limitée par une membrane plasmique, appelée sarcolemme, entourée par une membrane basale. Afin d’étudier les mécanismes impliqués dans la différenciation musculaire terminale sans être gêné par des cellules non-musculaires dans l’interprétation des résultats, la lignée de myoblastes murins C2C12 a été isolée et caractérisée (Blau et al, 1985; Yaffe & Saxel, 1977). Les myoblastes C2C12 sont devenus un outil de prédilection pour l’étude de la différenciation musculaire ex vivo et ont permis de mieux caractériser la différenciation musculaire et d’étudier notamment l’équilibre prolifération-différenciation du muscle squelettique. Cette lignée a la capacité à se différencier rapidement et à produire des myotubes contractiles exprimant des protéines caractéristiques du muscle. I.1.2 Les cellules satellites Les cellules satellites sont une population de cellules mononucléées et indifférenciées. Elles s’attachent à la surface de chaque fibre musculaire au niveau du sarcolemme, avant que la
- 16. Figure 2. Structuredu muscle strié (ou squelettique). Le muscle squelettique est formé de plusieurs faisceaux de fibres musculaires. Chaque faisceau comprend plusieurs milliers de fibres musculaires. Une fibre musculaire résulte de la fusion de plusieurs centaines de cellules musculaires appelées myoblastes. En fusion, les myoblastes forment d’abord des myotubes qui sont des cellules multinucléées. Après une étape de maturation, les myotubes deviennent des myofibres. Les myofibres (ou fibres musculaires) sont caractérisées par leur aspect strié. La striation est due à l’alternance des myofilaments d’actine et de myosine à l'intérieur de la fibre. La zone où les myofilaments fins d’actine d’un sarcomère se chevauchent avec les filaments d’actine du sarcomère suivant se trouvent les stries Z. Le sarcomère, véritable unité contractile de la fibre musculaire, est délimité par deux stries Z. Image adaptée de http://t.verson.free.fr/PHYSIOLOGIE/PHYSIOLOGIE_EXERCICE Faisceaux de fibres musculaires Fibre musculaire (cellule musculaire) composée de myofibrilles Vaisseaux sanguins Noyau de la cellule musculaire Myofibrille composée de filaments d’actine et de myosine Filament d’actine Filament de myosine Stries Z Stries Z Sarcomère
- 17. 4 lame basale n’entoureà la fois la cellule satellite et la fibre musculaire. Il y a environ une à cinq cellules satellites pour cent noyaux d’une fibre musculaire. Dans le muscle adulte, les cellules satellites interviennent durant l’hypertrophie musculaire liée à l’exercice et au cours de la régénération suite à une blessure, une dénervation ou l’absence de fonctionnement. En effet, bien que les cellules satellites soient mitotiquement quiescentes chez l’adulte, elles peuvent retrouver leur capacité à proliférer lors d’un stress ou d’un traumatisme, permettant la croissance et la régénération du muscle. L’équilibre entre la quiescence, l’activation des cellules satellites et l’induction de leur différenciation pour former de novo une fibre musculaire sera développé dans la dernière section de ce chapitre. I.1.3 Les cellules du fuseau neuromusculaire L’innervation du muscle est importante pour sa mise en place et son maintien dans le muscle adulte. L’absence d’innervation du muscle conduit d’ailleurs à la destruction progressive de la fibre musculaire. L’importance de l’innervation du muscle pour le maintien de son intégrité sera présentée dans la dernière section de ce chapitre. Les fuseaux neuromusculaires comportent des cellules intra fusales (cellules striées modifiées, spécialisées), des fibres nerveuses et des vaisseaux sanguins. Ce sont des formations allongées dans le même sens que les cellules musculaires striées et sont répartis à l’intérieur de la partie charnue du muscle. Chacun est délimité par une capsule conjonctive. Les cellules musculaires intra-fusales constituent des mécanorécepteurs qui renseignent sur le degré d’étirement ou de contraction du muscle. Elles sont de deux types : cellules musculaires à sac (qui renseignent sur la vitesse de variation de la longueur du muscle) et cellules musculaires à chaîne (qui codent en plus pour la longueur instantanée du muscle). Dans les deux cas, la partie contractile de ces fibres se situe à leurs deux extrémités et la partie centrale reçoit l’innervation afférente. L’allongement de la partie centrale des fibres est à l’origine d’une déformation mécanique des terminaisons sensorielles qui s’enroulent dans cette région. Cela entraîne un potentiel de récepteur qui remonte vers la moelle épinière et le cortex pariétal. II. MISE EN PLACE DES FIBRES MUSCULAIRES STRIEES II.1 Mise en évidence des MRFs Les “Myogenic Regulatory Factors”, ou MRFs, ont été mis en évidence pour la première fois grâce à des expériences de traitement des fibroblastes par un agent déméthylant de l’ADN, la 5-azacytidine. En effet, le traitement à la 5-azacytidine des fibroblastes induisait
- 18. Figure 3. Miseen place du muscle strié. Pendant le développement, les cellules souches mésodermiques s’engagent dans un des multiples lignages cellulaires possibles, notamment dans le lignage musculaire. L’expression de Pax3 dans les cellules progénitrices contribue à l’expansion myogénique. Après l’induction de MyoD et/ou Myf5, les cellules progénitrices mésodermiques sont engagées dans le lignage musculaire (myoblastes). Plus tard, l'activation des MRFs secondaires (myogénine et MRF4) induit la différenciation musculaire terminale des myoblastes en myocytes. Finalement, la fusion des myocytes donne naissance aux myotubes multinucléés qui subiront une dernière étape de maturation avec notamment leur innervation par les motoneurone, pour donner les myofibres striées. Pendant la phase plus tardive de de la myogenèse embryonnaire, une population cellulaire distincte des myoblastes et dérivée des cellules satellites du muscle, fusionne avec la fibre musculaire existante permettant ainsi à la fibre musculaire de s'accroitre. Certaiens cellules satellites restent associées aux myofibres, sous une forme quiescentes et dans un état indifférencié. L’origine embryonnaire des cellules satellites n’est pas bien connue à ce jour. Cependant, l’expression de Pax7 est nécessaire pour la spécification et l’expansion de la population de cellules satellites. FC : facteurs de croissance. Figure adaptée de Chargé et Rundnicki, 2004. Progéniteur mésodermique Myogénine, p21, Rb, Mef2 Cyline D1 Rb-P Myofibre mature Myotube précoce Myoblaste Détermination myogénique Evénements plus tardifs de la différenciation (« innervation ») Myogénine, MRF4 FC Id, Pax3 MyoD Myf5 MyocytesCellule somitique mésoder- mique Sortie du cycle prolifératif Expression des gènes spécifiques du muscle BMP4 Wnts Shh Noggin
- 19. 5 spontanément leur conversionen myoblastes, qui pouvaient alors entrer en pseudo- différenciation musculaire terminale en absence de signaux mitogènes. Un criblage différentiel entre les fibroblastes traités ou non-traités à la 5-azacytidine a permis d’isoler le gène MyoD (Davis et al, 1987). MyoD est un facteur de transcription myogénique puissant qui, lorsqu’il est exprimé ectopiquement dans des cellules non-musculaires (neurones, adipocytes, mélanocytes, chondrocytes), est capable de les convertir en myotubes (Choi et al, 1990; Weintraub et al, 1989) ; Davis et al, 1987). Sur la base de ces résultats, le gène MyoD a été proposé comme un des acteurs principaux dans le développement musculaire. Cette démarche a permis l’identification de trois autres gènes, myogénine (Edmondson & Olson, 1989; Wright et al, 1989), Myf5 (Braun et al, 1989) et MRF4 (Rhodes & Konieczny, 1989), qui interviennent aussi dans le développement musculaire. La famille des MRFs est ainsi composée de quatre membres : MyoD, Myf5, MRF4 et myogénine. Cette famille de facteurs de transcription est exclusivement exprimée dans la lignée myogénique. II.2 Détermination et différenciation des cellules musculaires au cours de la myogenèse embryonnaire Pendant le développement de l’embryon de souris, l’expression de Myf5 est induite dans les somites dorsaux-médiants (qui donnent plus tard les muscles du tronc et intercostaux), elle est suivie par l’expression de MyoD dans les somites dorso-latéraux (qui donnent naissance par la suite aux muscles des membres et de l’enveloppe corporelle). Les voies Wnts, Sonic hedgehog (Shh) et d’autres voies de signalisation contribuent à la détermination du muscle, en induisant les expressions de Myf5 et MyoD (pour revue voir (Buckingham, 2001)) (figure 3). L’expression de MyoD et Myf5 est une étape clé qui marque l’engagement des cellules somitiques multipotentes dans le lignage myogénique. L’activation de MyoD est retardée dans les embryons où le gène Myf5 est inactivé, montrant que l’expression de MyoD est initialement sous le contrôle de Myf5 (Tajbakhsh et al, 1997). Cependant, par la suite MyoD est activé indépendamment et la myogenèse se déroule normalement avec une localisation correcte des cellules (Kassar-Duchossoy et al, 2004) (table 1). De même, en absence de MyoD, la myogenèse se déroule apparemment normalement aussi, bien que les muscles des membres se forment plus tardivement, certainement en raison du niveau initial insuffisant de Myf5 pour déclencher la différenciation (Rudnicki et al, 1992). Après induction de MyoD, normalement le niveau de Myf5 diminue. Ainsi, chez les souris dont le gène MyoD est inactivé, le niveau de Myf5 reste relativement élevé probablement pour pallier l’absence de MyoD. Dans les doubles mutants Myf5:MyoD (Rudnicki et al, 1993), la myogenèse n’a pas lieu
- 20. Pas de différenciation terminale. Létalité. Myogénine Musculature normale MRF4 Pas demuscle squelettique MyoD:Myf5 Musculature normale MyoD Musculature normale Myf5 Phénotype observé Inactivation génique Table 1. Inactivations géniques chez la souris et phénotypes observés.
- 21. 6 et les cellulesmyogéniques sont absentes (Braun & Arnold, 1996); Petrovick et al, 1998). Ces expériences mettent en avant le rôle important de MyoD et Myf5 dans la myogenèse. Le rôle joué par MRF4 pendant la myogenèse est plus compliqué. En effet, MRF4 est exprimé de manière transitoire dans le myotome de souris au jour E9, en suivant de près l’expression de Myf5. Son expression disparaît au jour E11,5 et est réinitiée au jour E16 dans les fibres musculaires en différenciation. MRF4 a donc un rôle à la fois dans la spécification des somites en progéniteurs myogéniques, mais également au cours de la différenciation terminale (table 1). Enfin, la myogénine joue un rôle critique au cours de la différenciation musculaire terminale. En effet, chez les souris dont le gène myogénine a été inactivé, la deuxième phase d’expression de MRF4 et la formation des fibres secondaires (Ontell & Kozeka, 1984a; Ontell & Kozeka, 1984b) sont sévèrement compromis (table 1). Chez ces souris, les myoblastes sont présents, montrant que la myogénine n’est pas requise pour acquisition de l’identité de myoblastes, cependant la différenciation terminale est fortement compromise (Venuti et al, 1995). En résumé, ces études d’inactivation montrent que Myf5 et MyoD sont requis pour l’engagement dans le lignage myogénique, alors que la myogénine joue un rôle critique dans l’expression du phénotype musculaire final. Enfin, MRF4 participe à ces deux fonctions. Ainsi, MyoD, Myf5, et dans une certaine mesure MRF4, sont considérés comme des facteurs d’engagement ou de « détermination», alors que la myogénine est perçue comme un facteur de « différenciation » uniquement (figure 3). II.3 Les protéines Mef2, co-facteurs des MRFs Parallèlement aux MRFs, une autre famille de facteurs de transcription joue un rôle clé dans la différenciation musculaire : les protéines de la famille des Myocyte Enhancer Factor 2 (Mef2). Les protéines Mef2 appartiennent à la famille de facteurs de transcription à domaine MADS (MCM1, agamous, deficiens, serum response factor) (Yu et al, 1992) et sont induites quand les myoblastes entrent dans le programme de différenciation terminale (Gossett et al, 1989). L’inactivation de l’unique gène Mef2 chez la drosophile entraîne une létalité embryonnaire, ainsi qu’une perte complète de différenciation musculaire dans les trois lignages musculaires (squelettique, lisse et cardiaque). Cependant, dans ce cas, les myoblastes sont présents et correctement localisés, ce qui indique que c’est le processus de différenciation terminale et non de détermination qui est affecté (Bour et al, 1995; Lilly et al, 1995).
- 22. 7 Chez les mammifères,la famille Mef2 comprend quatre membres, Mef2 A à D, chacun codé par un gène séparé. Alors que l’expression des MRFs est strictement cantonnée au muscle, les gènes Mef2 sont exprimés dans une grande variété de tissus et de lignées cellulaires et sous la forme de nombreux transcrits différents, en raison de leur épissage alternatif. Cependant, les protéines elles-mêmes et leur activité de liaison à l’ADN semblent limitées aux cellules musculaires différenciées et aux neurones. Les protéines Mef2 se fixent ainsi sur un site riche en A/T retrouvé dans les promoteurs et les enhancers de nombreux gènes spécifiques du muscle : CTA(A/T)4TAG (Gossett et al, 1989). L’expression ectopique de Mef2 ne permet pas d’induire le programme de différenciation myogénique in vitro. En revanche, plusieurs éléments permettent de dire que les protéines Mef2 assistent les MRFs. Ainsi, MyoD et Mef2 interagissent directement in vitro et activent de manière synergique des gènes rapporteurs contenant des boîtes E et des sites de liaison Mef2 (Molkentin et al, 1995). Les boîtes E sont situées dans la région régulatrice des gènes spécifiques du muscle, tels que MCK (créatine kinase musculaire), Desmine, Troponine I, et sont des sites de fixation reconnus par les MRFs. Dans les promoteurs et enhancers des gènes spécifiques du muscle, les boîtes E sont souvent situées à proximité des sites Mef2, appuyant encore une fois le rôle coopératif de Mef2 et MyoD pour activer la transcription (Wasserman & Fickett, 1998). Par exemple, les protéines Mef2 se fixent sur l’enhancer du gène codant pour MCK et leur présence est nécessaire pour l’activité maximale de cet enhancer (Gossett et al, 1989). Des sites de fixation fonctionnels pour les protéines Mef2 ont également été identifiés dans les promoteurs de nombreux gènes structuraux des muscles cardiaques et squelettiques. Certaines études in vitro ont montré que l’activation de certains promoteurs par MyoD nécessite la présence de deux boîtes E sur lesquelles MyoD se fixe de manière coopérative (Thomson et al, 1999). Sur les promoteurs cibles de MyoD ne possédant qu’une seule boîte E, il est possible que la présence d’une boîte Mef2 compense fonctionnellement l’absence d’une seconde boîte E, facilitant ainsi la fixation de MyoD. De manière intéressante, Mef2 peut se fixer sur le promoteur de la myogénine et son site de fixation est nécessaire pour l’activité complète du promoteur (Edmondson et al, 1992). La capacité de la myogénine à induire l’expression de Mef2, qui en retour régule l’expression de la myogénine, fournit un mécanisme par lequel ces facteurs s’amplifient et se maintiennent mutuellement quand les myoblastes entrent en différenciation. Finalement, les protéines Mef2 sont capables de transactiver les gènes MyoD (Leibham et al, 1994; Wong et al, 1994), myogénine (Cheng et al, 1993; Edmondson et al, 1992) et MRF4 (Black et al, 1995; Naidu et al, 1995). La surexpression de Mef2A peut en effet activer l’expression de MyoD et de la
- 23. Figure 4. Bouclesd’auto-amplification des MRFs et des protéines Mef2. Au cours de la différenciation musculaire, MyoD déjà exprimé dans les myoblastes active l’expression de la myogénine, MRF4 et Mef2. En retour, la myogénine et Mef2 stimulent l’expression de MyoD. MRF4 stimule également l’expression de la myogénine et Mef2. Ensemble, ces boucles d’activation permettent l'amplification efficace des MRFs et des facteurs Mef2 au cours de la différenciation terminale. Signaux Externes Facteurs de croissance MyoD Myf5 Détermination Différenciation Myog Activation Inhibition Myf5 MRF4 Mef2 Myog MRF4
- 24. 8 myogénine, et réciproquementl’expression des MRFs dans des cellules non-musculaires induit l’activité des protéines Mef2 (Cserjesi & Olson, 1991). Ceci tend à montrer que les membres de la famille Mef2 interviennent dans le maintien et l’amplification de l’expression des MRFs (figure 4). Il a été précédemment montré qu’une boucle d’autorégulation des MRFs existe et qu’elle repose en partie sur les MRFs eux-mêmes. Notamment, l’expression ectopique de MyoD active l’expression de la myogénine de manière directe (Hollenberg et al, 1993; Thayer et al, 1989). MyoD est également capable de se fixer sur des séquences en 5’ de son propre gène et de s’autoactiver (Hollenberg et al, 1993). Réciproquement, la myogénine est capable d’activer MyoD, notamment lorsque les cellules entrent en différenciation. Mais il existe un rétrocontrôle positif de MyoD indépendamment de la myogénine, ce qui suggère fortement l’intervention d’autres facteurs tels que les facteurs Mef2 (Hollenberg et al, 1993; Thayer et al, 1989). II.4 Relation structure/ fonction des MRFs Les quatre protéines MyoD, Myf5, myogénine, et MRF4 appartiennent à la famille des facteurs de transcription de type bHLH (basic helix loop helix). Les MRFs présentent une homologie de séquence à 80% sur un fragment de 70 acides aminés qui regroupe une région basique et un domaine hydrophobe hélice-boucle-hélice (HLH). Ils contiennent également des domaines de transactivation dans leur parties amino- et carboxy- terminales, qui sont importants pour l’activation efficace de la transcription des gènes spécifiques du muscle (figure 5) (Edmondson & Olson, 1993). II.4.1 Le domaine bHLH est impliqué dans la fixation sur l’ADN et dans la dimérisation avec les protéines E Le motif bHLH définit une superfamille de protéines, dont font partie les bHLH myogéniques : MyoD, Myf5, MRF4 et myogénine. Près du centre de ces protéines se trouve une région basique (b), voisine du domaine hydrophobe hélice-boucle-hélice (HLH). La région basique des bHLH myogéniques joue un double rôle dans le contrôle de la transcription des gènes spécifiques du muscle en permettant la liaison à l’ADN des MRFs et en conférant une spécificité de transcription. Les bHLH myogéniques diffèrent des autres bHLH du fait qu’ils contiennent un motif de reconnaissance conservé au sein du domaine basique. Ce « code myogénique » comprend les résidus conservés « Ala86, Thr87, Asp109, Ala114 et Thr115 » et leur confère la capacité à activer les gènes spécifiques du muscle (Brennan et al, 1991; Davis et al, 1990; Huang et al, 1998a). La mutation de la région basique empêche la liaison à l’ADN mais pas la dimérisation (Brennan et al, 1991; Davis et al, 1990).
- 25. Figure 5. Domainesfonctionnels de MyoD. Les différentes régions fonctionnelles de MyoD sont représentées par des rectangles : en bleu pour le domaine d’activation, en gris clair pour le domaine C/H, en orange pour le domaine basique, en jaune pour le domaine HLH et en gris foncé pour le domaine C-terminal. Les chiffres indiquent la position des acides aminés aux bornes de chaque domaine. Figure adaptée d’après « Puri and Sartorelli, Journal of cellular physiology, 2000 ». 1 53 108 125 137 146 166 319 Activité de remodelage de la chromatine Activité de remodelage de la chromatine DimérisationFixation sur l’ADN
- 26. 9 Des expériences demutagenèse montrent que ce motif HLH sert d’interface à la dimérisation, ce qui permet de former un domaine composite de liaison à l’ADN après dimérisation de deux protéines bHLH (Davis et al, 1990; Voronova & Baltimore, 1990). Le motif bHLH est également trouvé dans une classe de protéines ubiquitaires connues sous le nom de protéines E, qui inclut HEB/HTF4, E2-2/ITF-2 et l’epissage alternatif du produit du gène E2A : E12/E47. Ainsi, les bHLH myogéniques peuvent soit s’homodimériser, soit s’hétérodimériser avec les facteurs de transcription bHLH de classe I, que sont les protéines E. Les dimères formés par dimérisation de protéines bHLH diffèrent par leur affinité de liaison pour l’ADN. Par exemple, le dimère MyoD-E47 se forme efficacement et se fixe fortement sur l’ADN, alors que l’homodimère MyoD se fixe à l’ADN faiblement (Murre et al, 1989). Les hétérodimères MRF-protéine E se fixent sur la séquence consensus “CANNTG”, appelée boîte E. Des préférences de liaison à l’ADN dépendantes des séquences adjacentes et des séquences internes à la boîte E ont été identifiées pour les homodimères et les hétérodimères MRF-protéine E in vitro (Blackwell & Weintraub, 1990). Les boîtes E sont fréquemment représentées dans le génome et pas seulement dans les régions régulatrices des gènes du muscle. Ainsi, des interactions intramoléculaires sont indispensables pour que MyoD puisse activer spécifiquement la transcription des gènes du muscle. Par exemple, la présence d’un site de liaison pour le facteur Mef2, augmente de manière coopérative la transcription. Par ailleurs, Mef2C interagit directement avec le dimère MyoD-E12, mais pas avec ces protéines individuellement (Molkentin et al, 1995; Molkentin & Olson, 1996; Olson et al, 1995). II.4.2 Les domaines de transactivation (TAD) N-terminal et C-terminal régulent l’activité des MRFs En plus du domaine bHLH, des analyses de mutation et de délétion ont identifié trois domaines de MyoD ayant des fonctions importantes dans la régulation des gènes spécifiques du muscle : le domaine acide N-terminal, le domaine riche en histidine et cystéine (H/C) et l’hélice III. Le domaine N-terminal, qui comprend les résidus 1 à 53, est très acide et permet l’activation d’un promoteur hétérologue (Weintraub et al, 1991). Le domaine acide N-terminal de MyoD est requis pour l’activation d’un plasmide rapporteur dirigé par plusieurs boîtes E, suggérant qu’il fonctionne comme un domaine de transactivation (TAD) et qu’il est nécessaire pour la fixation de MyoD sur les boîtes E (Weintraub et al, 1990).
- 27. 10 En plus dudomaine de transactivation N-terminal, deux autres motifs conservés ont été identifiés : du côté N-terminal du domaine bHLH, il y a le domaine riche en H/C et du côté C-terminal, il y a une structure en hélice α, également appelée hélice III. Ces deux domaines de MyoD sont nécessaires pour le remodelage de la chromatine, au niveau du promoteur de la myogénine (Gerber et al, 1997), en coopérant avec Pbx et Meis. Les facteurs Pbx et Meis font partie de la famille de facteurs de transcription à homéodomaine, initialement identifiés pour leur rôle au cours de l’embryogenèse (Berkes et al, 2004). Les complexes Pbx-Meis interagissent de manière coopérative avec les bHLH myogéniques in vitro sur un ADN synthétique contenant les sites consensus de fixation de Pbx et Meis et une boîte E. Cette liaison coopérative requiert la présence d’un résidu tryptophane conservé au sein du domaine riche en H/C des bHLH (Knoepfler et al, 1999). Les mutants de MyoD pour la région riche en H/C sont incapables d’initier le remodelage de la chromatine sur le locus de la myogénine (Gerber et al, 1997), probablement car le mutant ne peut plus interagir avec le complexe Pbx/Meis. L’hélice III a été montrée comme nécessaire pour initier l’activation de la myogénine au niveau endogène (Bergstrom & Tapscott, 2001). Par ailleurs, un exemple qui montre que chaque MRF a sa propre spécificité est le fait que MyoD et la myogénine possèdent leur propre hélice III. Cette hélice permettrait à MyoD d’activer certains gènes cibles spécifiquement, car si on remplace l’hélice III de la myogénine par celle de MyoD, la protéine chimère devient à son tour capable d’activer certains gènes cibles de MyoD (Bergstrom & Tapscott, 2001). II.5 La différenciation terminale se décompose en deux étapes discrètes La différenciation des myoblastes en myotubes implique une cascade d’événements modifiant profondément la cellule à la fois au niveau morphologique et moléculaire. Ceci implique une reprogrammation importante du profil d’expression des gènes des cellules en question, aboutissant à l’inhibition de certains gènes et à l’activation d’autres gènes. Lorsqu’il est exprimé de manière ectopique dans certains types cellulaires, MyoD est capable d’induire la conversion de ces cellules en cellules myoblastiques, ce qui montre que MyoD est capable d’induire cette reprogrammation génique. De fait, l’ensemble des études effectuées à ce jour sur MyoD montre que c’est un facteur de transcription capable de transactiver un nombre important de gènes qui interviennent à toutes les étapes du processus de différenciation musculaire. Notamment, MyoD est capable d’orchestrer les deux étapes discrètes de la différenciation terminale : la sortie du cycle prolifératif et l’expression des gènes spécifiques
- 28. Myotube précoce Myoblaste Myocytes alignés Sortie du cycle prolifératif Expressiondes gènes spécifiques du muscle & fusion Figure 6. La différenciation musculaire terminale se décompose en deux étapes discrètes. Les myoblastes exprimant MyoD prolifèrent sous l’influence des facteurs de croissance. Sous l’influence de stimuli extérieurs (ex vivo, les signaux mitogènes sont diminués artificiellement), les myoblastes vont sortir définitivement du cycle cellulaire grâce à l’action concertée de MyoD, Rb hypophosphorylé, et p21. L’action de Mef2 entretient les boucles d’amplification des MRFs et va induire l’expression de myogénine de concert avec MyoD et MRF4. Les myocytes fusionnent enfin pour former les myotubes multinucléés et expriment les gènes spécifiques du muscle. MyoD, Rb, p21 Myogénine, MyoD, Mef2, MRF4
- 29. 11 de la différenciationmusculaire. MyoD fonctionne ainsi comme un interrupteur moléculaire, en « éteignant » la prolifération et en « allumant » la différenciation terminale, et permet ainsi la séparation de ces deux processus (figure 6). II.5.1 La sortie du cycle prolifératif Pendant le processus de différenciation musculaire, les facteurs myogéniques ne sont pas seulement impliqués dans l’induction des gènes spécifiques du muscle, mais également dans la régulation de la transition entre l’état prolifératif (quand MyoD et Myf5 sont déjà exprimés) et la sortie ordonnée du cycle de division cellulaire. L’arrêt du cycle prolifératif est un pré-requis pour que la différenciation musculaire terminale puisse avoir lieu. Cette étape clé de la différenciation musculaire squelettique implique la diminution des activateurs du cycle cellulaire, tels que les cyclines et les kinases dépendantes des cyclines (Cdks), et l’augmentation des inhibiteurs du cycle cellulaire, tels que Rb, p21, p27 et p57. Ainsi, MyoD intervient tout d’abord au niveau de la sortie du cycle cellulaire en activant notamment les gènes p21 (Halevy et al, 1995), la cycline D3 (Cenciarelli et al, 1999) , et Rb (Bergstrom et al, 2002). En particulier, Rb et p21 jouent un rôle très important dans l’arrêt de la croissance des myoblastes. Leur niveau d’expression et leur activité, bien que régulés négativement par les facteurs de croissance, sont régulés positivement par MyoD, qui joue un rôle coopératif dans l’induction de l’arrêt du cycle cellulaire. D’ailleurs, MyoD peut bloquer la prolifération indépendamment de son activité transcriptionnelle. En effet, exprimé ectopiquement dans des cellules non musculaires, MyoD inhibe le cycle cellulaire avant la phase S, indépendamment de son activité de liaison à l’ADN et de l’induction de la différenciation myogénique (Crescenzi et al, 1990; Sorrentino et al, 1990). II.5.2 L’activation des gènes spécifiques du muscle Pour induire la différenciation terminale ex vivo, les signaux mitogènes sont diminués artificiellement en cultivant les cellules dans un milieu à faible teneur en sérum et en laissant les cellules à confluence. Ce n’est qu’après l’arrêt permanent de la prolifération que les myoblastes vont exprimer les protéines spécifiques du muscle et fusionner entre eux pour former des cellules multinucléées appelées myotubes. Plusieurs études indépendantes ont permis d’identifier certains gènes cibles de MyoD. En particulier, une étude utilisant comme modèle la conversion myogénique de fibroblastes, a permis d’étudier le transcriptome de ces cellules lorsque la différenciation musculaire est induite par MyoD (Bergstrom et al, 2002). Simultanément à l’arrêt du cycle, MyoD active l’expression d’autres acteurs importants de la différenciation comme la myogénine et Mef2 (Black & Olson, 1998; Cheng et al, 1993; Edmondson et al, 1992). Comme il a été mentionné précédemment, la myogénine intervient
- 30. 12 en aval deMyoD dans le processus de différenciation. Elle peut elle aussi assurer l’activation des gènes de la famille Mef2 (Cserjesi & Olson, 1991). L’activation de la famille Mef2 et de la myogénine permettrait de prendre le relais de MyoD et/ou de contribuer à la reprogrammation transcriptionnelle des noyaux des myoblastes en cours de différenciation. Plus tard au cours de la différenciation, MyoD participe à l’activation de gènes codant des protéines fonctionnelles du muscle, comme la créatine kinase musculaire (MCK), la troponine I et la chaîne lourde de la myosine (MHC), qui sont indispensables à la fois à la structure et au fonctionnement des myotubes (Bergstrom et al, 2002; Lassar et al, 1989). MyoD semble également intervenir dans l’expression de gènes codant des protéines d’adhérence, et de certains intermédiaires des voies de transduction des signaux comme le gène codant le récepteur à l’acétylcholine (Bergstrom et al, 2002; Gilmour et al, 1991). III. L’EQUILIBRE PROLIFERATION-DIFFERENCIATION DANS LE MUSCLE III.1 Régulation négative de l’activité de MyoD dans les myoblastes proliférants MyoD est exprimé dans les myoblastes en prolifération, alors que les gènes cibles principaux de MyoD ne sont pas activés. Cela implique une inhibition active de l’activité de MyoD. On comprend donc aisément que les cellules assurent une régulation de l’activité de MyoD à plusieurs niveaux. Comme cela va maintenant être décrit, l’activité de MyoD dépend beaucoup des partenaires protéiques avec lesquels il interagit. Ainsi, ses partenaires influent sur la fixation de MyoD à l’ADN, son intensité de transactivation, sa stabilité protéique, sa spécificité sur ses promoteurs cibles, ainsi que le contexte chromatinien qui rend possible ou non la transcription. III.1.1 MyoD et ses cofacteurs sont régulés négativement au cours du cycle cellulaire La décision cellulaire de progresser vers un nouveau cycle de division cellulaire a lieu à la transition G1/S. Au niveau moléculaire, plusieurs régulateurs positifs et négatifs du cycle cellulaire ont été identifiés. Parmi les régulateurs positifs du cycle se trouvent les complexes cycline/Cdks (Nurse, 1994; Sherr, 1994). Les régulateurs négatifs du cycle, qui sont aussi des coactivateurs de la différenciation musculaire, comprennent entre autres les inhibiteurs de Cdks (CKIs) (Sherr & Roberts, 1995; Sherr & Roberts, 1999) et la famille des protéines à
- 31. Figure 7. Régulationde l’activité de Rb au cours du cycle cellulaire. Durant le début la phase G1, la transcription des gènes de la phase S dépendante de E2F, est réprimée par la fixation de Rb à E2F. Au point de restriction R, des complexes cyclines/CDKs phosphorylent Rb, qui se décroche alors de E2F, permettant à celui-ci d’activer la transcription de ces gènes cible et le passage en S. La sortie du cycle précédant la différenciation cellulaire se fait au cours de la phase G1 lorsque l’inhibition de E2F par Rb est toujours active. Figure extraite de Giacinti and Giordano, Oncogene 2006. R
- 32. 13 poche : laprotéine Rb, le produit du gène de susceptibilité au rétinoblastome, et deux protéines apparentées à Rb : p107 et p130 (Mulligan & Jacks, 1998). III.1.1.1 Phosphorylation de Rb par les complexes cycline/cdk Le passage de la phase G1 vers la phase S est contrôlé par les cyclines D (associées aux Cdk4 et Cdk6), la cycline E et la cycline A (associées à Cdk2). Une des cibles les plus étudiées pour les cyclines A ou E/Cdk2 pendant la transition G1/S est la protéine Rb. Dans sa forme hypophosphorylée, Rb régule négativement la progression du cycle cellulaire au niveau de la progression de la phase G1 vers la phase S. Rb hypophosphorylé agit au niveau transcriptionnel en interagissant et en modulant l’activité de nombreux facteurs de transcription (Kouzarides, 1995; Taya, 1997), réprimant ainsi l’expression des gènes requis pour l’entrée en phase S. Trois facteurs de transcription de la famille E2F (E2F1, E2F2 et E2F3) régulent notamment les gènes associés à la prolifération. Les facteurs E2F sont les cibles de Rb les plus étudiées pendant la phase G1 (Chellappan et al, 1991; Helin, 1998). Dans sa forme active (hypophosphorylée), Rb interagit avec E2F et réprime ainsi son activité. Au cours de la phase G1, la phosphorylation progressive et massive de Rb par les complexes cycline/Cdk, induit sa dissociation de E2F et ce qui permet l’entrée des cellules en phase S (Mittnacht, 1998). La protéine Rb reste ainsi hyperphosphorylée jusqu’à l’entrée en mitose, ce qui conduit à sa dégradation. Ainsi, la progression du cycle cellulaire est largement sous le contrôle de la régulation génique dépendante de Rb-E2F (figure 7). L’expression de la cycline D1 est induite par les facteurs de croissance tels que le FGF (fibroblast growth factor) et le TGF-β (tumor growth factor), et son niveau est maximal pendant la phase G1 (Sherr, 1994). La surexpression de la cycline D1 accélère la progression G1/S (Quelle et al, 1993) et inhibe la transactivation des gènes spécifiques du muscle en partie par la voie Rb/E2F (Guo & Walsh, 1997; Rao et al, 1994; Skapek et al, 1995). Des expériences de transdifférenciation musculaire de fibroblastes en culture cellulaire montrent que les cyclines A et E bloquent la différenciation. La présence d’une protéine Rb mutante non- phosphorylable abolit l’effet négatif des cyclines A et E sur la différenciation musculaire (Skapek et al, 1996). En revanche, l’expression de la cycline D1 réussit quand même à inhiber la différenciation musculaire même en présence de ce mutant de Rb. Ceci indique que l’activité des cyclines/cdk bloque la différenciation musculaire à la fois par un mécanisme dépendant de la phosphorylation de Rb, et par un second mécanisme indépendant de la phosphorylation de Rb (Skapek et al, 1996).
- 33. Myoblastes (prolifération) ? Myotubes (différenciation) Figure8. Modifications post-traductionelles de MyoD. Les cercles rouges entourant un « P » représentent un résidu phosphorylé, les cercles jaunes indiquant « Ub » représente un acide aminé ubiquitinylé et un cercle bleu indiquant « Ac » représente un résidu acétylé. Les modifications post-traductionnelles retrouvées dans les myoblastes en prolifération sont placées au dessus et celles apparaissant en condition de différenciation sont illustrées en bas. Figure adaptée d’après « Puri and Sartorelli, Journal of cellular physiology, 2000 ». Figure 9 : Expression de MyoD au cours du cycle cellulaire. Le niveau de MyoD augmente au cours de la phase G1 et atteint son niveau maximum en milieu de phase G1 au niveau d’un point de restriction noté « R ». En présence de signaux mitogènes, Cdk2 phosphoryle alors MyoD sur la sérine 200 ce qui entraîne sa dégradation. Le niveau de MyoD augmente à nouveau durant la phase G2. La phosphorylation de MyoD par CDK1 au niveau des sérines 5 et 200 entraîne sa dégradation avant l’entrée en mitose.
- 34. 14 III.1.1.2 Modifications post-traductionnellesde MyoD conduisant à sa dégradation La protéine MyoD comporte plusieurs sites de modifications post-traductionnelles (figure 8). Ces modifications vont réguler l’activité de MyoD et/ou provoquer sa dégradation par le protéasome (Breitschopf et al, 1998; Floyd et al, 2001). Ainsi, MyoD est phosphorylé dans les myoblastes en prolifération et cette phosphorylation diminue lorsque les myoblastes se différencient en myotubes (Kitzmann et al, 1999). MyoD est phosphorylé sur la sérine 200 dans les myoblastes en prolifération et cette phosphorylation est induite par cdk1 ou cdk2 (Tintignac et al, 2000). La phosphorylation de MyoD sur la sérine 200 est impliquée dans la dégradation de MyoD, puisque les mutants de MyoD ayant une alanine 200 non- phosphorylable ont une demie-vie augmentée trois à quatre fois par rapport à la protéine sauvage (Song et al, 1998). La phosphorylation de MyoD par le complexe cycline E/cdk2 est impliquée dans sa dégradation dépendante de l’ubiquitine pendant la phase G1-S (Tintignac et al, 2000). Parce que la cycline D1 est essentielle pour l’induction de la cycline E (Nurse, 1994; Sherr, 1994), le rôle du complexe cycline E/cdk2 dans la phosphorylation de MyoD et sa dégradation consécutive, fournit une explication supplémentaire pour le rôle inhibiteur de la cycline D1 dans la myogenèse. En particulier, la surexpression de la cycline D1 induit l’accumulation de Cdk4 dans le noyau, qui se lie alors à l’extrémité N-terminale de MyoD et empêche sa liaison à l’ADN (Zhang et al, 1999a). Finalement, MyoD atteint son plus haut niveau d’expression en début de phase G1, et si les stimuli extérieurs sont favorables, c’est pendant cette fenêtre de temps que les myoblastes sortent du cycle cellulaire pour s’engager dans le processus de différenciation terminale, sinon, MyoD est dégradé. Le point du cycle matérialisant le moment auquel se fait le choix entre la sortie et la poursuite du cycle cellulaire est nommé point de restriction. Après la phase S, le niveau de MyoD commence à augmenter à nouveau (figure 9). Cependant, à l’enclenchement de la mitose, MyoD est à nouveau phosphorylé sur les sérines 5 et 200 par les complexes cycline/cdk, puis ubiquitinylé et dégradé (pour revue voir (Kitzmann & Fernandez, 2001)). III.1.2 Les protéines bHLH inhibitrices séquestrent MyoD et ses co-facteurs L’activité de MyoD et celle de ses co-facteurs, les protéines E et les facteurs MEF2, sont hautement régulées par des interations protéine-protéine. Toutes les protéines à domaine HLH ne possèdent pas de propriétés activatrices, au contraire, la plupart fonctionnent comme des régulateurs négatifs de la transcription. Un cas bien illustré est celui des protéines Id, qui possèdent un motif HLH mais pas de domaine basique. Id est donc capable de former des hétérodimères avec les protéines bHLH, mais empêche leur liaison à l’ADN (Benezra et al, 1990a; Benezra et al, 1990b). Id se lie à MyoD, et plus préférentiellement aux protéines E
- 35. Figure 10. MyoDparticipe au remodelage de la chromatine sur ses gènes cibles. Sur les gènes spécifiques du muscle, la chromatine et les protéines interagissant au niveau de la chromatine sont dans un état réprimé dans les myoblastes en prolifération. MyoD, Mef2 et YY1 recrutent des complexes co-répresseurs contenant des histones désacétylases (HDACs) et des histones méthylases (par exemple Ezh2), qui empêchent l’hyperacétylation et induisent la di- ou tri-méthylation de résidus lysine spécifiques (comme K27 et K9) pour donner une conformation répressive à la chromatine au niveau des gènes spécifiques du muscle. La voie CaMK activée pendant la différenciation et les niveaux de Rb hypophosphorylé (suite à la baisse des signaux mitogènes) déplacent les HDACs de la chromatine et permettent l’hyperacétylation des histones par les acétyltransférases. Figure adaptée de Forcales and Puri, Cell and Developmental Biology, 2005. YY1 Ezh2 Rb HDAC classe I Rb Histone méthyl- transférases Mef2 MyoD HDAC classe 2 CaMK PP Pol II Enhancer /Promoteur musculaire HDAC classe I cytoplasme K27 Me Me Me K9 Me Me Boîte Mef2 Boîte E
- 36. 15 (Benezra et al,1990a), empêchant ainsi la formation d’un dimère actif MyoD-protéine E (Jen et al, 1992). À l’enclenchement de la différenciation musculaire, la localisation de Id devient cytoplasmique et il ne peut plus interagir avec MyoD. De plus, alors que son taux de dégradation par le protéasome reste inchangé, les niveaux d’ARNm et protéique de Id sont diminués lorsque les signaux mitogènes sont diminués et pendant la myogenèse (Norton et al, 1998; Sun et al, 2005; Trausch-Azar et al, 2004). Une autre classe d’inhibiteurs à domaine HLH sont les protéines HES qui répriment l’activité transcriptionnelle via leur liaison à une boîte N (apparentée aux boîtes E) sur l’ADN (Sasai et al, 1992). De la même manière, la protéine bHLH Twist altère l’activité de MyoD en bloquant sa liaison à l’ADN, à la fois en titrant les protéines E, mais aussi en interagissant directement avec Mef2 (Hamamori et al, 1997; Spicer et al, 1996). D’autres protéines bHLH qui régulent négativement l’activité de MyoD et bloquent la différenciation musculaire, sont les protéines MyoR et Mist1. Ces facteurs contiennent des régions basiques et forment des dimères avec les MRFs. MRF/MyoR et MRF/Mist1 sont des hétérodimères inactifs, capables de se fixer sur les boîtes E, mais sans activer la transcription (Lemercier et al, 1998; Lu et al, 1999). La protéine bHLH Mist1 peut aussi occuper les boîtes E en formant un homodimère Mist1- Mist1 (Lemercier et al, 1998). Enfin, il a été démontré qu’une autre bHLH, Dermo-1, est capable d’inhiber l’activité transactivatrice de MyoD d’une manière plus efficace que Id (Gong & Li, 2002). Contrairement à l’inhibition liée à Id qui peut être levée par compétition en co-transfectant la protéine E12, l’inhibition par Dermo-1 n’est apparemment pas ou peu dépendante de E12. Dermo-1 induit la répression de la transcription des gènes cibles de MyoD par son interaction directe avec la protéine Mef2C, mettant en jeu ses domaines N- et C-terminaux (Gong & Li, 2002). III.1.4 Dans les myoblastes en prolifération, MyoD contribue à la répression épigénétique de ses gènes cibles Si MyoD est titré hors de l’ADN et ses cofacteurs séquestrés ou dégradés, une fraction de MyoD est malgré tout retrouvée sur la chromatine. Dans ce cas, MyoD est associé à la répression de ses gènes cibles car il interagit avec différents facteurs de modification ou de remodelage de la chromatine (figure 10), agissant ainsi au niveau épigénétique. En effet, de nombreuses études ont permis d’établir une relation entre la structure chromatinienne et la régulation de la transcription. L’induction de la transcription s’accompagne d’une altération de la structure des nucléosomes positionnés sur les séquences régulatrices. La structure de la chromatine est affectée par différents complexes de remodelage, dont les complexes dépendants de l’ATP et les complexes d’acétylation ou de désacétylation des histones. Les
- 37. 16 histones peuvent subirde multiples modifications post-traductionnelles comme la phosphorylation, la méthylation, l’ubiquitinylation et l’acétylation. Ces modifications interviennent essentiellement au niveau des queues N-terminales, qui sont à l’extérieur du nucléosome. Elles constituent autant de signaux de reconnaissance pour des facteurs impliqués dans les processus de transcription, de réparation, de condensation des chromosomes, de dégradation. En 2000, Strahl et Allis font ainsi référence à « code des histones », dans lequel chaque modification aurait son propre rôle dans l’activation de la transcription, mais également un effet combinatoire avec les autres modifications (Strahl & Allis, 2000). III.1.4.1 Les histones désacétylases Les histones désacétylases régulent négativement l’expression des gènes spécifiques du muscle via leur interaction avec les protéines MyoD et Mef2. De ce fait, dans les myoblastes en prolifération, MyoD est associé à la répression de ses propres gènes cibles. En effet, les histones désacetylases (HDACs) de classes I et II sont exprimées dans les myoblastes, fournissant un autre fragment d’explication pour l’incapacité de MyoD et Mef2 à activer leurs gènes cibles avant leur entrée en différenciation. Dans les myoblastes en prolifération, MyoD est en fait associé aux HDACs de classe I, via son domaine bHLH. Cette interaction réprime l’activité transcriptionelle de MyoD à deux niveaux : (i) en désacétylant MyoD lui-même, (ii) en désacétylant les histones sur ses promoteurs cibles. Par exemple, HDAC1 s’associe avec MyoD et est capable de le désacétyler in vitro (Mal et al, 2001). De plus, MyoD est trouvé complexé à HDAC1 dans les myoblastes en prolifération, mais pas dans les myotubes en différenciation (Mal et al, 2001). Le recrutement de HDAC1 sur les gènes cibles de MyoD se fait probablement par le co-répresseur N-CoR/SMRT, qui interagit directement avec MyoD et qui est connu pour recruter HDAC1 sur l’ADN. L’histone désacétylase de classe II, Sir2, une HDAC dépendante du NAD+, inhibe également la myogenèse en formant un complexe avec l’histone acétyltransférase PCAF (p300/CBP associated factor) et MyoD, et lorsque Sir2 est surexprimée, elle retarde la différenciation musculaire. Inversement, la diminution de Sir2 accélère la différenciation musculaire (Fulco et al, 2003). L’activité de Mef2 est elle aussi réprimée par son association avec les HDACs de classe II (telles que les HDACs 4 et 5), provoquant la désacétylation et la répression des gènes contenant les sites de fixation de Mef2 (Lu et al, 2000). HDAC7 inhibe également spécifiquement Mef2 (-A, -C, -D) et n’affecte pas MyoD et la myogénine (Dressel et al, 2001). Les HDACs de classe II n’interagissent pas directement avec MyoD, mais répriment
- 38. 17 l’expression de sesgènes cibles lorsqu’ils contiennent un site Mef2 en supplément de la boîte E, en s’associant aux facteurs Mef2 (Lu et al, 2000). III.1.4.2 Les histones méthyl-transférases Il a été montré que le recrutement de complexes HDACs pour désacétyler les histones sur les promoteurs du muscle avant la différenciation, contribue à la méthylation de l’histone H3 sur sa lysine 9 (H3K9) par des histones méthyl-transférases (HMTs), sur ces mêmes promoteurs (Zhang et al, 2002). À ce propos, Mal et Harter montrent que dans les myoblastes en prolifération, MyoD est associé à HDAC1 sur le promoteur de la myogénine et que ce promoteur présente alors une désacétylation ainsi qu’une méthylation de l’histone H3 sur la lysine 9 (H3K9), ce qui correspond à des marques épigénétiques répressives (Mal & Harter, 2003). Par ailleurs, l’histone méthyltransférase Suv39h, qui méthyle H3K9, interagit avec MyoD dans les cellules en prolifération et ce complexe est détecté sur le promoteur de la myogénine qui est un gène cible de MyoD réprimé en prolifération. La présence de Suv39h1 sur ce promoteur est corrélée à la méthylation de H3K9 (Mal, 2006). La méthylation de H3K9 est une marque épigénétique reconnue par la protéine de l’hétérochromatine HP1, qui va contribuer à former une structure hétérochromatinienne compacte non-permissive à la transcription. J’ai d’ailleurs participé à une étude montrant que la protéine HP1 est impliquée dans la répression de la différenciation musculaire et qu’elle interagit directement avec MyoD (Yahi et al, 2008) (Annexe 3). D’autres méthyltransférases d’histones régulent négativement la différenciation musculaire. Notamment Ezh2, une protéine polycomb avec une activité spécifique de méthylation de H3K27, est recrutée spécifiquement sur les gènes spécifiques du muscle dans les myoblastes en prolifération (Caretti et al, 2004). Ezh2 est retrouvée dans un complexe protéique contenant HDAC1. Les promoteurs du muscle sont hyperméthylés sur H3K27 et donc réprimés. L’enclenchement de la différenciation est couplé à la disparition de ce complexe sur ces mêmes loci. H3K27 devient donc hypométhylé et MyoD et Mef2 sont recrutés, permettant la transcription de leurs gènes cibles. La diminution de Ezh2 est corrélée avec une activation de l’expression des gènes du muscle et sa surexpression inhibe la différenciation musculaire (Caretti et al, 2004).
- 39. Figure 11. Dualitéentre les régulateurs du cycle cellulaire et l’engagement dans la voie de différenciation terminale. MyoD et Myf5 sont exprimés dans les myoblastes en prolifération, où leur activité est inhibée par les complexes Cdk4/Cycline D. Les complexes cycline/Cdk sont activés par les signaux mitogènes. En absence de facteurs de croissance, MyoD induit l’expression de p21 et de Rb ce qui résulte en l’arrêt du cycle cellulaire. Notamment, p21 inhibe les complexes cycline/Cdk, qui ne peuvent alors plus phosphoryler Rb. En effet, en condition de prolifération cellulaire, Rb est normalement hyperphosphorylé par les complexes cycline/cdks, ce qui rend la protéine Rb inactive et l’empêche de s’associer avec le facteur E2F. E2F est donc libre d’aller transcrire les gènes nécessaire à la prolifération cellulaire. En absence de signaux mitogènes, Rb hypophosphorylé séquestre E2F et contribue à l’arrêt du cycle cellulaire. La myogénine est activée dans les myoblastes ayant arrêté de proliférer et c’est un élément intermédiaire important dans la différenciation terminale des myoblastes. Figure adaptée d’après Molkentin and Olson, Current Opinion in Genetics and Development, 1996). MyoD/Myf5 Myogénine p21 Arrêt de la prolifération Différenciation musculaire Rb-E2F cyclineD/Cdk4 E2F Prolifération Rb- P inactif Facteurs de croissance
- 40. 18 III.2 MyoD orchestrela différenciation musculaire terminale III.2.1 MyoD promeut la sortie du cycle cellulaire en stimulant l’expression de Rb, p21 et la cycline D3 Un point de contrôle de l’entrée en différenciation a été mis en évidence (Puri et al, 2002). Ce point de contrôle semble permettre aux myoblastes d’interrompre leur prolifération, notamment lors d’un traitement des cellules par des agents génotoxiques. MyoD coopère avec les régulateurs du cycle cellulaire, notamment les complexes cycline/cdk, les CKIs et Rb, dans la voie de signalisation qui mène à l’arrêt du cycle en phase G1 et l’engagement dans la voie de différenciation (Guo et al, 1995; Halevy et al, 1995; Novitch et al, 1996; Parker et al, 1995; Schneider et al, 1994) et pour revue voir (De Falco et al, 2006) (figure 11). III.2.1.1 Régulation des complexes cycline/cdk Globalement, l’expression et l’activité des régulateurs positifs du cycle cellulaire sont diminuées pendant la différenciation terminale. Si l’expression de cdk4 et cdk2 reste inchangée pendant la différenciation musculaire squelettique, celle de cdk1, des cyclines D, E et A décline. Cependant, une catégorie de cycline et Cdk échappe à cette règle, les cyclines T et Cdk9 sont augmentées dans les myotubes en différenciation et aideraient même MyoD à activer ses gènes cibles (Giacinti et al, 2006; Simone & Giordano, 2001; Simone et al, 2002b). Dans les myoblastes, la protéine Rb interagirait également avec cycline T2/cdk9 (Simone et al, 2002a). La cycline D3 est également une cycline dont l’expression est augmentée au cours de la différenciation musculaire (Kiess et al, 1995; Rao & Kohtz, 1995). MyoD stimule lui- même l’expression de la cycline D3, par un mécanisme qui requiert l’acétyltransférase p300 (Cenciarelli et al, 1999). La cycline D3 contribue à la sortie du cycle cellulaire et elle est associée à cdk4 et Rb dans les myotubes différenciés (Cenciarelli et al, 1999). III.2.1.2 Régulation des CKIs L’expression des inhibiteurs de cdks (CKIs), en particulier p21 (Guo et al, 1995; Halevy et al, 1995; Parker et al, 1995; Skapek et al, 1995), mais également p27 (Zabludoff et al, 1998) et p18 (Franklin & Xiong, 1996), est renforcée pendant la myogenèse embryonnaire et pendant la différenciation myogénique de myoblastes en culture. Dans les myoblastes, la majorité des CKIs sont capables d’améliorer la capacité de transactivation de MyoD. L’augmentation des CKIs à l’enclenchement du processus de différenciation terminale, explique la diminution drastique de l’activité des complexes cycline/cdk au cours de la différenciation. Par exemple, le complexe cdk2/ cycline E est inhibé par p57 (Reynaud et al, 2000). La sortie du cycle cellulaire est essentiellement contrôlée par l’expression de deux inhibiteurs de cdk, p21 et p57
- 41. 19 (Zhang et al,1999b). MyoD induit directement l’expression de p21 au cours de la myogenèse (Guo et al, 1995; Halevy et al, 1995; Parker et al, 1995). L’importance du rôle joué par p21 dans la sortie du cycle prolifératif est illustrée par le fait que l’expression forcée de p21 dans les myoblastes est suffisante pour enclencher le programme de différenciation terminale, même en présence de facteurs de croissance (Guo et al, 1995). L’expression de p21 et p57 est indispensable à la différenciation musculaire comme le montre la double inactivation génique p57:p21, qui donne le même phénotype que les souris inactivées pour la myogénine (Zhang et al, 1999b). III.2.1.3 Régulation de Rb En plus de réguler l’expression de la cycline D3 et p21, MyoD active directement l’expression de Rb. Le mécanisme par lequel MyoD active Rb est distinct de sa fonction myogénique (Martelli et al, 1994). L’activation de l’expression de Rb passe par le recrutement du facteur de transcription CREB (cAMP-responsive element binding protein) qui reconnaît un site CRE sur le promoteur du gène codant pour Rb. De manière intéressante, les auteurs montrent que MyoD s’associe à CREB dans un complexe comprenant également les protéines à activité acétyl-transférase, p300 et PCAF. Cependant les auteurs montrent que l’acivité acétyl- transférase de p300 n’est pas requise pour augmenter l’activité transcriptionnelle de MyoD, en revanche celle de PCAF est indispensable. Les auteurs notent également que MyoD se fixe sur le promoteur de Rb uniquement en présence de CREB (Magenta et al, 2003). À l’enclenchement de la différenciation terminale, la baisse massive des régulateurs du cycle permet à la protéine Rb de rester dans une forme hypophosphorylée. Rb hypophosphorylé peut alors interagir directement avec le domaine d’activation des facteurs E2Fs, les empêchant ainsi d’agir pour stimuler la progression vers la phase S. Par ailleurs, le facteur E2F voit également son expression diminuer et les myocytes surexprimant E2F1 n’arrivent pas à sortir du cycle cellulaire, même dans des conditions favorables à la différenciation (Wang et al, 1995). De plus, l’interaction de la protéine Rb dans sa forme hypophosphorylée avec MyoD et les autres bHLH myogéniques est nécessaire à la différenciation musculaire. Rb coopère notamment avec MyoD pour stimuler l’activité transcriptionnelle de Mef2 dans les myoblastes en différenciation (Novitch et al, 1999). Rb va subir des modifications post- traductionnelles comme sa phosphorylation par la cycline T2/Cdk9, mais aussi une acétylation par p300 et PCAF sur sa région N-terminale. Ces modifications sont indispensables pour la sortie du cycle cellulaire et l’induction de la transcription des gènes spécifiques du muscle (Chan et al, 2001; Nguyen et al, 2004). Notamment, Rb va stimuler
- 42. 20 l’expression de gènestardifs de la différenciation comme MCK et MHC, en augmentant significativement l’activité transcriptionnelle de MyoD (Gu et al, 1993). III.2.2 MyoD interagit avec des facteurs régulant de manière positive sa fixation à l’ADN La protéine musculaire LIM interagit avec le dimère E12-MRF, augmente son activité de liaison à l’ADN et stimule la myogenèse (Arber et al, 1994). Des expériences ont montré que son inhibition dans les myoblastes empêche leur différenciation terminale, alors que sa surexpression favorise ce processus (Kong et al, 1997). La protéine Pbx est une homéoprotéine exprimée de manière ubiquitaire et qui peut se fixer de manière constitutive à certains promoteurs. En particulier, Pbx1 peut se fixer sur le promoteur de la myogénine avant la fixation de MyoD, alors même que la structure de la chromatine est défavorable à la transcription. Par ailleurs, MyoD forme un complexe avec Pbx1 sur ce même promoteur, suggérant que Pbx1 pourrait aider à la fixation de MyoD sur son gène cible (Berkes et al, 2004). MyoD peut être phosphorylé par d’autres kinases que les Cdks et notamment par la kinase Mos. L’inhibition de Mos dans les myoblastes diminue leur potentiel de différenciation alors que sa surexpression augmente l’activité de MyoD. Ceci montre que Mos est un régulateur positif de la différenciation musculaire. Mos phosphoryle MyoD directement sur la sérine 237 et favorise ainsi la dimérisation de MyoD avec la protéine E12 (Aurade et al, 1994; Lenormand et al, 1997; Solhonne et al, 1999). III.2.3 Plusieurs voies de signalisation régulent positivement la différenciation musculaire III.2.2.1 La voie Jak/STAT La protéine STAT3 est un facteur de transcription activé par la kinase Janus (Jak) en réponse à des stimuli extracellulaires tels que certains facteurs de croissance. Sa phosphorylation par Jak2 permet l’homodimérisation et la relocalisation de STAT3 dans le noyau, où STAT3 se fixe sur ses gènes cibles. Deux études montrent clairement que l’expression de STAT3 est augmentée au cours de la différenciation musculaire et que la diminution de STAT3 par ARN-interférence inhibe la différenciation. De plus, les auteurs montrent que MyoD et STAT3 interagissent et proposent un rôle positif pour STAT3 au cours de la différenciation musculaire (Wang et al, 2008; Yang et al, 2009a).
- 43. Figure 12. MyoDparticipe au remodelage de la chromatine sur ses gènes cibles. Les signaux induits par la différenciation aboutissant au déplacement de YY1 et des méthyltransférases, ainsi que la déméthylation des résidus lysine des histones ne sont pas bien connus. Après, (ou au même moment) que le déplacement des complexes corépresseurs et des marques épigénétiques de la chromatine, l’assemblage du transcriptosome myogénique induit le recrutement de plusieurs complexes dotés de différentes activités enzymatiques (comme les acétyltransférases, les complexes de remodelage dépendants de l’ATP ou les arginine méthyltransférases). La kinases p38 activée pendant la différenciation régule plusieurs étapes de l’assemblement du transcriptosome, en ciblant et en phosphorylant les facteurs de transcriptions (Mef2), les partenaires d’hétérodimérisation des MRFs (E47) et les composants du complexe SWI/SNF (BAF60). p38 peut également réguler la stabilité de l’ARN naissant. Le recrutement d’acétyltransférases sur les régions régulatrices des gènes du muscle n’est apparemment pas dépendant de la voie p38 et est probablement régulé par une cascade parallèle activée pendant la différenciation. Chacun des composants recrutés dans le transcriptosome myogénique est essentiel pour conférer la capacité à activer la transcription. Figure adaptée de Forcales and Puri, Cell and Developmental Biology, 2005. Enhancer /Promoteur musculaire R Me R Me p300 GRIP1 Mef2 MyoDE12/47 P P P/CAF SWI/SNF Brg1 Brm P CARM1 Acétylation Remodelage de la chromatine p38 ARNm Pol II Boîte Mef2 Boîte E
- 44. 21 III.2.2.2 La voiep38 MAPK La kinase p38 a un rôle particulièrement important dans l’expression des gènes spécifiques du muscle, et le mécanisme par lequel p38 affecte les voies de régulation des gènes musculaires a été abondamment décrit. L’activité de la kinase p38 augmente progressivement au fur et à mesure du processus de différenciation et son activité est surtout nécessaire pour la différenciation terminale (Wu et al, 2000). p38 est responsable de la phosphorylation du domaine de transactivation de Mef2 (Cox et al, 2003; Zetser et al, 1999; Zhao et al, 1999). L’inhibition de p38 atténue le potentiel d’activation de Mef2 et inversement l’expression d’un mutant de p38 actif constitutivement promeut la différenciation musculaire (Puri et al, 2000; Wu et al, 2000; Zhao et al, 1999). La kinase p38 jouerait également un rôle dans le recrutement du complexe de remodelage de la chromatine SWI/SNF sur les gènes cibles de MyoD (Simone et al, 2004) et dans la phosphorylation des histones, comme cela a été montré sur certains gènes précoces de la différenciation musculaire (Clayton et al, 2000; Thomson et al, 1999). Notamment, la voie p38 MAPK, de concert avec deux autres voies de signalisation, agirait pour stimuler la liaison de MyoD, Mef2 et des protéines Six sur le promoteur proximal de la myogénine pour activer son expression (Xu et al, 2002). III.2.3 MyoD recrute des enzymes de remodelage de la chromatine sur ses gènes cibles Principalement deux classes de co-activateurs coopèrent avec les facteurs de transcription pour permettre l’expression spécifique des gènes : les protéines modifiant les histones (telles que les acétyltransférases ou les méthyltransférases) et les facteurs de remodelage de la chromatine dépendants de l’ATP (tels que les protéines de la famille SWI/SNF) (figure 12). III.2.3.1 Les histones acétyl-transférases Les histone-acétyltransférases (HATs) fonctionnent en transférant des groupements acétyl de l’acétyl-coA sur les résidus lysine des protéines histones, ainsi que des protéines non-histones. L’acétylation des histones provoque le transfert des histones H2A/H2B de l’ADN vers des protéines chaperonnes (Ito et al, 2000), augmentant ainsi l’accessibilité des facteurs de transcription à l’ADN. Les HATs et les HDACs interagissent toutes deux avec MyoD et ont des activités opposées qui sont critiques pour faire basculer MyoD d’un état répresseur à un état activateur sur certains loci. Par exemple, la protéine Rb peut déplacer HDAC1 de MyoD (Puri et al, 2001), laissant MyoD libre d’activer la transcription. D’ailleurs, la libération de MyoD de HDAC1 est un préalable à l’association de MyoD avec la HAT PCAF (Mal et al, 2001). Une régulation de la transition des interactions HATs et HDACs est également contrôlée pour Mef2. Le complexe
- 45. 22 Mef2/HDAC de classeII est sensible à la kinase CamK dépendante du calcium, qui médie l’effet stimulant de IGF1 (insulin-like growth factor 1) sur la différenciation musculaire. CamK phosphoryle HDAC5 sur deux résidus sérine, ce qui stimule sa liaison à la protéine chaperonne 14-3-3. L’interaction de HDAC5 avec la protéine 14-3-3 provoque l’exposition d’un signal d’export nucléaire de HDAC5 et sa sortie du noyau (McKinsey et al, 2000; McKinsey et al, 2001). Les coactivateurs transcriptionnels tels que p300, c-AMP response element-binding protein (CREB)- binding protein (CBP) et p300/CBP-associated factor (PCAF) possèdent une activité acétyl- transférase sur les lysines. L’activité acétyl-transférase (AT) générale augmente au cours de la différenciation myogénique (Polesskaya et al, 2001b) et l’activité de MyoD est augmentée par l’acétylation de ses résidus lysines par CBP, p300 et PCAF in vitro (Duquet et al, 2006; Polesskaya et al, 2000; Polesskaya & Harel-Bellan, 2001; Sartorelli et al, 1999). Il y a une association préférentielle entre MyoD acétylé (en comparaison avec MyoD non-acétylé ou non-acétylable) et le bromodomaine de CBP et p300 (Polesskaya et al, 2001a). Dans la même étude, les auteurs montrent avec un système rapporteur que l’acétylation de MyoD augmente significativement sa capacité à activer la transcription. Une étude très récente montre que l’acétylation de la lysine 99 de MyoD est indispensable pour son interaction avec le bromodomaine de CBP et que la double acétylation des lysines 99 et 102 est requise pour l’interaction de MyoD avec p300 (Wei et al, 2008). De nombreux groupes qui ont étudié le rôle de CBP et p300 dans la différenciation musculaire n’ont pas toujours discriminé la présence de CBP et p300 dans les complexes HATs où est retrouvé MyoD. Cependant, puisque le motif de reconnaissance de CBP et p300 se situe au niveau de la lysine 99, ceci génère certainement un encombrement stérique prévenant la formation d’un complexe contenant à la fois CBP et p300. Il est donc fort à parier que les complexes HAT dans lesquels MyoD est retrouvé pour activer le programme myogénique contiennent soit p300, soit CBP selon les gènes cibles de MyoD à activer. Bien que p300 ait été identifié comme un coactivateur de MyoD et accroisse l’activité transcriptionnelle de ce dernier (Sartorelli et al, 1997; Yuan et al, 1996), l’activité AT de p300 est dispensable pour l’activation des gènes cibles précoces de MyoD (Polesskaya et al, 2001b; Puri et al, 1997). La protéine p300 agirait comme un pont moléculaire et permettrait le recrutement de PCAF. Dans les myotubes différenciés, MyoD est en effet complexé avec p300 (ou CBP) et PCAF. Ce complexe trimérique est capable de se lier à une boîte E in vitro, suggérant que MyoD recrute p300 (ou CBP) et PCAF sur les promoteurs spécifiques du muscle (Puri et al, 1997). Le démantèlement de ce complexe en neutralisant PCAF inhibe la
- 46. 23 différenciation musculaire, indiquantque le recrutement de PCAF par MyoD, via p300/CBP, est indispensable pour l’activation du programme myogénique. D’après une étude utilisant un système rapporteur, il est proposé que l’acétylation des histones soit effectué par p300 et que l’acétylation de MyoD soit effectué par PCAF (Dilworth et al, 2004). La liaison de MyoD à certains promoteurs spécifiques est concomitante avec l’acétylation des histones (Bergstrom et al, 2002). Cette acétylation favoriserait le recrutement du complexe de remodelage SWI/SNF sur ces gènes cibles (de la Serna et al, 2005). III.2.3.2 Les histones méthyl-transférases L’arginine méthyl-transférase CARM1 a été impliquée positivement dans la myogenèse. CARM1 (également appelée PRMT4) est un membre de la famille des PRMT (protein-arginine N-methyltransferase) et catalyse la méthylation des résidus arginine sur une large série de substrats. Par exemple, CARM1 peut méthyler l’histone H3 in vitro et est impliquée dans la différenciation de différents types cellulaires. CARM1 stimule la myogenèse en étant associée directement avec GRIP1 (le coactivateur du récepteur aux stéroïdes) et Mef2C dans un complexe (Chen et al, 2002). De plus, Mef2 et CARM1 sont recrutés sur le promoteur de MCK en condition de différenciation et l’inhibition de CARM1 inhibe la différenciation musculaire en abolissant l’expression de facteurs de transcription clés de la différenciation terminale, tels que Mef2 et la myogénine (Chen et al, 2002). Paradoxalement, CARM1 a également été montré comme modifiant les arginines des histones H3R17 et H3R26 de la région promotrice de la cycline E1, stimulant l’expression de la cycline E1 et de ce fait stimulant la prolifération dans ces cellules (El Messaoudi et al, 2006). Cette étude n’a pas été réalisée dans des cellules musculaires et la stimulation de l’expression de la cycline E1 reste à montrer dans les myoblastes. Par ailleurs, il n’est pas exclu que CARM1 ait un double rôle, mais que son rôle prédominant dans les myoblastes soit de stimuler la différenciation terminale. Une autre protéine de la même famille, PRMT5, a également été montrée comme stimulant la myogenèse. En effet, l’arginine diméthylée en position 8 de l’histone H3 (H3R8) et PRMT5 sont retrouvées au cours de la différenciation sur un promoteur cible de MyoD activé précocement : le promoteur de la myogénine (Dacwag et al, 2007). Les auteurs montrent que PRMT5 est nécessaire pour la diméthylation de H3R8 et la diminution de PRMT5 prévient la fixation de Brg1, la sous-unités ATPasique du complexe SWI/SNF et de MyoD lui-même. III.2.3.3 Le complexe de remodelage de la chromatine SWI/SNF Les membres de la famille du complexe de remodelage de la chromatine SWI/SNF jouent des rôles critiques dans le contrôle de la transcription. Les protéines SWI/SNF sont les
- 47. 24 composants d’un complexemultimérique qui modifie la structure de la chromatine en altérant les contacts entre ADN et histones au sein d’un nucléosome, d’une manière dépendante de l’ATP (pour revue voir (Martens & Winston, 2003) et (Racki & Narlikar, 2008)). La sous- unité ATPasique, Brm ou Brg1, du complexe SWI/SNF possède un motif appelé bromodomaine, qui est capable de lier les résidus lysine acétylés dans la queue N-terminale des histones in vitro. Plusieurs travaux ont mis en évidence un rôle essentiel de SWI/SNF dans la transactivation des promoteurs musculaires médiée par MyoD. Il a tout d’abord été montré que la conversion myogénique de fibroblastes par MyoD est inhibée par la surexpression d’un mutant dominant négatif de Brm ou de Brg1 et au plan moléculaire, cela se traduit par l’inhibition de la transcription de certains gènes cibles de MyoD, comme par exemple la myogénine et MHC (de la Serna et al, 2001a). Par ailleurs, une autre étude montre que la fixation du complexe SWI/SNF sur le promoteur de la myogénine nécessite la présence de MyoD (de la Serna et al, 2005). De manière intéressante, une étude complémentaire montre que les gènes cibles de MyoD impliqués dans la sortie du cycle cellulaire (p21, Rb, Cycline D3) ne sont pas affectés par les mutants de Brm ou de Brg1 ; SWI/SNF interviendrait donc au niveau de l’étape de différenciation elle-même, mais pas dans la sortie du cycle cellulaire (de la Serna et al, 2001b). Les sous-unités ATPasiques, Brm et Brg1, sont nécessaires pour la myogenèse dans les cellules exprimant MyoD (de la Serna et al, 2001a; Roy et al, 2002). MyoD et Mef2 recruteraient le complexe SWI/SNF sur les gènes spécifiques du muscle pour activer leur transcription pendant la différenciation musculaire. MyoD co-précipite ainsi avec p300, PCAF et Brg1 dans l’extrait nucléaire de myoblastes en différenciation (Simone et al, 2004) et ces protéines sont retrouvées (de pair avec MyoD) sur les promoteurs de la myogénine et de MCK. Une étude intéressante par Giacinti et ses collègues montre une relation entre le complexe cdk9/cyclin T2 qui, de concert avec p300 et PCAF et le complexe de remodelage SWI/SNF, est recruté par MyoD sur les promoteurs et les enhancers des gènes spécifiques du muscle. Ce recrutement aboutit au final à l’acétylation des queues N-terminales des histones, au remodelage de la chromatine et à la phosphorylation de l’ARN polymérase II sur ces sites, permettant l’activation de la transcription des gènes cibles de MyoD (Giacinti et al, 2006). Récemment et pour la première fois, SRA (steroid receptor RNA activator), un ARN non-codant, a été montré associé à MyoD et à deux protéines ARN hélicases, p68 et p72. Comme le suggèrent leurs expériences d’immunoprécipitation de la chromatine, cette association serait retrouvée sur certains loci. De plus, in vitro les auteurs montrent que la présence concomitante
- 48. Figure 13. Réponsedes cellules satellites suite à une lésion ou un traumatisme. En réponse à une lésion, les cellules satellites sont activées et prolifèrent (a). Une partie des cellules satellites réapprovisionnent le stock de cellules satellites quiescentes présentes sur la myofibre grâce à un processus d’auto-renouvellement. Les cellules satellites vont migrer au niveau de la région endommagée (b), et en fonction de la gravité de la lésion, vont fusionner à la fibre existante (c) ou vont s’aligner et fusionner entre elles pour produire une nouvelle fibre musculaire (d). Dans la myofibre régénérée, les noyaux des cellules qui viennent de fusionner sont initialement centraux (e), mais migreront plus tard vers la périphérie de la myofibre. Figure adaptée de Hawke and Garry, Journal of Applied Physiology, 2001. a. Activation et prolifération des cellules satellites b. Attraction par chimiotactisme des cellules satellites vers la fibre endommagée c. Fusion avec la fibre endommagée (hypertrophie) d. Alignement et fusion pour produire une nouvelle myofibrille (hyperplasie) e. Myofibrille régénérée avec un noyau central
- 49. 25 de p68, p72et SRA augmente significativement l’activité de MyoD dans un système rapporteur. Par ailleurs, la présence de p68 et p72 faciliterait le remodelage de la chromatine initié par Brg1 sur certains gènes cibles de MyoD (Caretti et al, 2006). IV. LE MAINTIEN DU MUSCLE ET SA REGENERATION DEPENDENT DE SON INNERVATION IV.1 Le maintien de muscle adulte par les cellules satellites Le muscle squelettique des mammifères est capable de réaliser une régénération massive et rapide en cas de dommage sévère. La régénération musculaire est caractérisée par une phase dégénérative et une phase régénérative (Lecker et al, 2004). Dans un premier temps, les sites lésés sont envahis par les cellules inflammatoires, notamment les neutrophiles et les macrophages. La dégénération est suivie par la régénération et la réparation du muscle. La phase de régénération est caractérisée par la prolifération des cellules myogéniques appelées cellules satellites, situées le long de chaque fibre musculaire. La prolifération de ces cellules permet de former un réservoir suffisant de cellules musculaires qui pourront alors fusionner et remplacer les fibres musculaires lésées. En absence de stimuli, les cellules satellites sont quiescentes et transcriptionnellement moins actives que les noyaux des myofibres. L’activation des cellules satellites n’est pas restreinte à la zone lésée. Un dommage causé à l’extrémité de la fibre musculaire peut activer les cellules satellites situées tout le long de la fibre, conduisant à une prolifération et à une migration des cellules satellites vers le site de régénération (Schultz et al, 1985). La particularité des cellules satellites est leur division asymétrique qui permet de restaurer la réserve de cellules satellites au tour de la fibre musculaire néo-formée. Après l’activation de leur prolifération, une partie des cellules satellites fusionne pour régénérer le muscle et une autre partie retourne à l’état de quiescence pour reconstituer la réserve de cellules satellites (Kuang et al, 2008) (figure 13). Les processus d’activation et de différenciation des cellules satellites pendant la régénération sont similaires à ceux observés durant la mise en place de la musculature embryonnaire. Les cellules satellites sont caractérisées par l’expression du facteur de transcription Pax7 (Kuang et al, 2006; Seale et al, 2000), et dans plusieurs muscles également Pax3 (Buckingham, 2007). D’ailleurs les souris dont le gène Pax7 est inactivé ne possèdent (pratiquement) pas de cellules satellites (Seale et al, 2000). Outre la mise en place des cellules satellites avant la naissance, Pax7 aurait lui-même un rôle au cours de la régénération musculaire. Les cellules
- 50. 26 satellites au reposexpriment un récepteur de surface codé par le proto-oncogène c-Met. Le récepteur c-Met possède une forte affinité de liaison pour l’agent chimiotactique HGF (hepatocyte growth factor). La fixation de HGF sur c-Met régule une cascade de signalisation aboutissant à l’expression des MRFs Myf5 et MyoD spécifiques des myoblastes et la prolifération des cellules satellites (pour revue voir (Buckingham, 2001) et (Charge & Rudnicki, 2004)). Les précurseurs myogéniques dérivent des cellules satellites activées. L’arrêt de la prolifération des précurseurs va être déterminé à la fois par l’augmentation de l’expression de facteurs myogéniques régulateurs (MRFs) Myf5 et MyoD, et par la diminution de la régulation de Pax7 (pour revue voir (Charge & Rudnicki, 2004)). Il est proposé que dans la différenciation musculaire Myf5 ait plutôt un rôle favorisant la prolifération transitoire des précurseurs myogéniques (Ishibashi et al, 2005; Ustanina et al, 2007), alors que MyoD favoriserait plutôt l’entrée en différenciation des précurseurs myogéniques (Ishibashi et al, 2005; Megeney et al, 1996; Ustanina et al, 2007). Le processus de formation des nouvelles fibres musculaires est caractérisé par : (i) MyoD et la myogénine qui sont exprimés dans les cellules satellites activées avant et après la fusion des myoblastes (Paoni et al, 2002; Pownall et al, 2002; Yablonka-Reuveni & Paterson, 2001), (ii) l’isoforme embryonnaire de la myosine qui est exprimée dans les fibres musculaires naissantes (Paoni et al, 2002) et (iii) l’isoforme de la molécule d’adhérence des cellules neurales (NCAM) qui est exprimée dans les cellules satellites activées et dans les myotubes nouvellement formés (Crameri et al, 2004; Mesires & Doumit, 2002). IV.2 Le muscle adulte est régulé par son innervation Pour fonctionner, le muscle est en connexion avec les motoneurones qui, sous impulsion électrique, vont stimuler sa contraction. La formation et le maintien du muscle sont donc en partie régulés par son innervation (Magnusson et al, 2005). La destruction du nerf entraîne l’atrophie du muscle et engendre un processus de régénération pour compenser l’atrophie de la fibre. Certaines observations montrent que pendant plusieurs semaines, voire les premiers mois suivant la dénervation, la régénération de nouvelles fibres musculaires est souvent suffisante pour maintenir, et parfois même augmenter, le nombre de fibres musculaires viables (Mussini et al, 1987; Schmalbruch & Lewis, 2000). Cependant, lorsque la dénervation est maintenue sur des périodes très longues (au-delà de deux mois), le muscle squelettique perd sa capacité à se restaurer dans un état complètement structuré et fonctionnel, même après régénération du nerf dans le muscle (Carlson & Faulkner, 1988).
- 51. 27 La réponse àla dénervation est biphasique. La réponse initiale a lieu dans les premiers jours suivants la dénervation, avant la mort d’aucune fibre musculaire, et se traduit par la formation de nouvelles fibres musculaires, le long des fibres musculaires en atrophie. La deuxième phase de la réponse myogénique n’a pas lieu avant deux à quatre mois post-dénervation. Ici spécifiquement, la myogenèse se déroule de concert avec la mort de la fibre et la perte de myocytes. Les signaux nécessaires pour activer les deux phases ne sont pas connus. Il a été montré que la première phase de la réponse myogénique à la dénervation ne nécessite pas la mort cellulaire. Dans ce cas l’activation des cellules satellites est probablement due aux changements physiologiques immédiat qui se passent dans les myocytes dénervés, tels que les changements des récepteurs à l’acétylcholine et les facteurs de transcription classiques du muscle (MyoD, myogénine, Myf5, MRF4). Trois jours après dénervation, MyoD est exprimé à son niveau maximum dans les cellules satellites, mais également dans les noyaux de la myofibre (Ishido et al, 2004). De manière intéressante, les deux gènes cibles de MyoD régulant positivement la différenciation musculaire, p21 et Rb, sont exprimés dans les noyaux des myofibres, mais pas dans les cellules satellites. Ces deux gènes sont activés dans les noyaux des myofibres lorsqu’elles sont dénervées. En fait, p21 et Rb auraient dans la myofibre un rôle anti-apoptotique pour limiter son atrophie (Ishido et al, 2004). Des études montrent que les muscles dénervés au-delà d’une période de deux mois présentent des altérations dans leur réserve de cellules satellites qui se traduisent par un nombre diminué de cellules satellites dont les noyaux sont plus petits et plus compacts et dont l’activation est diminuée (Kujawa et al, 2004; Kujawa et al, 2005). Il n’est toujours pas clair si la dénervation affecte directement les cellules satellites ou si le phénotype observé sur ces cellules est dû à la libération de facteurs par les fibres musculaires en atrophie. Le groupe de B. Carlson qui a étudié l’effet de la dénervation à long terme sur les cellules satellites, propose qu’après une trop longue période de dénervation, la réponse myogénique démesurée pour régénérer la fibre, finit par épuiser les cellules satellites (Borisov et al, 2005). De manière intéressante, Batt et ses collègues ont étudié l’expression des gènes du cycle cellulaire pour suivre l’activation de la prolifération des cellules activées après dénervation. Effectivement, l’expression de facteurs favorisant la croissance cellulaire comme la cycline D1 ou c-Jun sont augmentés de manière significative le premier mois qui suit la dénervation, puis chutent complètement à leur niveau basal après trois de dénervation du muscle. Réciproquement, des facteurs inhibant la progression cellulaire, comme p107 (protéine apparentée à la protéine Rb), sont inhibés suivant le premier mois de dénervation puis leur expression est augmentée au niveau basal après trois mois (Batt et al, 2005). Batt et ses collègues proposent que ce
- 52. 28 schéma d’expression desrégulateurs du cycle cellulaire observé pendant le premier mois suivant la dénervation du muscle pourrait résulter en l’activation et la prolifération des cellules satellites musculaires. La perte de cette réponse proliférative après trois mois empêcherait l’augmentation de la masse musculaire et limite la capacité de régénération à trois mois (Batt et al, 2005). La fibre musculaire stimule la transcription d’un certain nombre de gènes après dénervation pour maintenir sa fonction. De nombreuses études sur la régénération musculaire ont révélé les gènes dépendants/sensibles à l’activité électrique dans le muscle. Ces gènes sont susceptibles d’être des activateurs des cellules satellites. Parmi les gènes dont le niveau de transcription est augmenté, plusieurs études ont notamment mis en évidence le gène Runx1 (Gonzalez de Aguilar et al, 2008; Zeman et al, 2009). De manière intéressante, l’expression de Runx1 est fortement augmentée dans les muscles paralysés, pré-paralysés et dénervés (Gonzalez de Aguilar et al, 2008). Cela est en accord avec les travaux du groupe de S. Burden qui montrent pour la première fois que l’expression de Runx1 dans le muscle est régulée par l’innervation (Zhu et al, 1994). En effet, dans le muscle squelettique de rat, l’expression de Runx1 est augmentée de 50 à 100 fois cinq jours après la dénervation du muscle. Une décennie plus tard, le même groupe de recherche montre que Runx1 participe positivement au maintien de la fibre musculaire après dénervation. Dans cette étude, les auteurs montrent que Runx1 est un facteur de transcription qui régule 29 gènes du muscle et la perte de Runx1 conduit à une accélération de l’atrophie liée à la dénervation (Wang et al, 2005).
- 53. 29 Chapitre II Le Facteurde Transcription Runx1/CBFβ I. INTRODUCTION : DECOUVERTE DE LA FAMILLE DE PROTEINES A DOMAINE RUNT ET CBFβ La famille de facteurs de transcription à domaine runt (appelée également protéines Runx) a été étudiée et découverte par plusieurs groupes de recherche et dans des contextes très différents. Pour comprendre d’où viennent les nombreuses dénominations des protéines à domaine runt, et pour avoir un premier aperçu des rôles très variés de ces protéines, voici un rapide historique de la découverte des protéines Runx et leur partenaire unique de dimérisation, CBFβ. PEBP2/PEA2/CBF lient les enhancers viraux murins La découverte des facteurs de transcription de la famille Runx est due à des virologistes (pour revue voir (Ito, 2008)). La découverte des enhancers de la transcription débute en 1981 avec l’étude de l’enhancer du virus simien SV40 et du polyomavirus Py. De manière intéressante, Py n’est capable d’infecter les cellules de carcinome embryonnaire (EC) que lorsqu’elles sont en différenciation. Au début des années 80, la comparaison du Py sauvage aux Py mutants capables d’infecter les EC non différenciées a révélé que ces mutations se trouvaient dans la région enhancer du polyomavirus (Fujimura et al, 1981; Sekikawa & Levine, 1981; Vasseur et al, 1980). L’analyse de cet enhancer a permis l’identification du facteur de transcription PEBP2 (Py Enhancer Binding Protein 2), exprimé dans les cellules EC en différenciation et se fixant à cet
- 54. 30 enhancer. En 1985,quatre éléments de l’enhancer de Py sont identifiés et nommés PE-A à D (Veldman et al, 1985) et en 1987, le groupe de M. Yaniv identifie deux facteurs liant l’élément A, PEA1 et PEA2 (Piette & Yaniv, 1987). À nouveau, l’expression de ces deux facteurs n’est retrouvée que dans les cellules EC différenciées (Furukawa et al, 1990; Piette & Yaniv, 1987). Le facteur PEA2 est en fait identique à PEBP2 et sera reconnu plus tard comme une protéine à domaine runt. Plus tard, le clonage de CBF (core binding factor) qui code pour une protéine liant un site conservé sur l’enhancer du virus de la leucémie murine (MMLV), révèlera que CBF est également identique à PEBP2/PEA2 (Wang et al, 1993). Runt et Lozenge chez la drosophile En 1990, le gène runt de la drosophile est découvert et classé comme un des gènes appartenant à la classe des “pair-rule” et c’est le premier gène reporté dans la famille qui sera plus tard appelée la famille RUNX ou la famille des facteurs de transcription à domaine runt (Kania et al, 1990). Runt a d’abord été étudié comme un gène de segmentation, mais son rôle s’est ensuite étendu à la détermination sexuelle et à la neurogenèse chez la drosophile. Les travaux de recherche suggèrent que runt peut réguler la transcription, mais à cette époque-là, runt n’avait pas de motif de liaison à l’ADN connu et sa fonction biochimique restait relativement floue. En 1996, un second gène de la drosophile apparenté à runt a été découvert et a été impliqué dans le développement des yeux et des cellules hematopoïétiques : il s’agit de lozenge. AML1 est impliqué dans les leucémies En 1991, un membre de la famille de protéines à domaine runt a été découvert pour la première fois chez l’Homme sous forme d’un gène de fusion : AML1/MTG8(ETO). Le gène AML1 est situé sur le chromosome humain 21q2 et la translocation t(8;21) (q22; q22) est une des anomalies les plus fréquentes du sous-type FAB-M2 (FAB = French-American-British classification) de leucémie myéloïde aiguë (AML) (Miyoshi et al, 1991). Dans cette translocation, le gène MTG8 (ou ETO) est fusionné du côté N-terminal au domaine Runt de AML1 pour donner la protéine chimère AML1-MTG8. Le fait que AML1 soit impliqué dans des translocations chromosomiques de manière récurrente lui a rapidement conféré son activité oncogénique (Miyoshi et al, 1991). A ce moment-là, à part sa fonction clairement oncogénique, la fonction biologique de AML1 n’était pas connue. En 1990 et 1991, le clonage de Runt et AML1 révèle que ces séquences sont homologues et cette observation a immédiatement suggéré que AML1 pouvait être impliqué dans le développement
- 55. 31 embryonnaire des mammifères.Les expériences d’inactivation génique confirmeront des années plus tard cette hypothèse. En 1993, Ogawa et ses collègues mettent en évidence un lien clair entre PEBP2 dans les cellules EC murines, Runt chez la drosophile et AML1 chez l’humain (Ogawa et al, 1993b). Depuis 2004, une terminologie commune a été proposée pour harmoniser l’appellation de PEPB2/PEA2/CBF/Runt/AML. L’ensemble de ces facteurs partage un domaine d’homologie runt et en accord avec les recommandations de la Human Genome Organization, les gènes codant ces facteurs ont été désignés « gènes apparentés à runt » (van Wijnen et al, 2004). Chez les mammifères la dénomination des protéines à domaine runt est Runx. La protéine PEPB2β/CBFβ La caractérisation de PEBP2 en 1990 par Kamachi et ses collègues a révélé en fait deux sous- unités protéiques α et β (Kamachi et al, 1990). En 1993, Ogawa et ses collèges montrent que PEBP2α et PEBP2β forment un hétérodimère qui a une activité de liaison à l’ADN (Ogawa et al, 1993a). La découverte que la liaison de PEBP2α ou l’hétérodimère PEBP2α-β se trouve exactement sur le même site sur l’ADN révèle une nouvelle classe de facteurs de transcription. En effet, les facteurs de transcription dimériques connus jusqu’alors, tels que AP-1 par exemple, reconnaissent la moitié du site de liaison. Pour être fonctionnel, Runx (PEBP2α) se dimérise donc avec la protéine CBFβ (PEPB2β) pour former le facteur de transcription dimérique CBF (Core Binding Factor) (Wang et al, 1996b). Le gène codant pour CBFβ est également impliqué dans des translocations chromosomiques retrouvées dans les leucémies myéloïdes aigues, notamment celle de type M4Eo (monocytaires avec éosinophilie) (Hajra & Collins, 1995). Dans ces translocations, la partie du gène codant pour les 165 premiers acides aminés de CBFβ est associée au gène codant pour la chaîne lourde de la myosine du muscle lisse (SMMHC ou gène MYH11) (Liu et al, 1993). La protéine chimère CBFβ-SMMHC empêche la formation d’un facteur de transcription CBF fonctionnel (Hajra et al, 1995). II. EXPRESSION ET FONCTION DE RUNX1 ET CBFβ II.1 Fonctions biologiques de Runx1 et de la sous-unité CBFβ chez les mammifères Chez les mammifères, il existe trois gènes codant pour trois protéines Runx : Runx1, Runx2 et Runx3 et un seul gène CBFb codant pour l’unique protéine CBFβ. Ces gènes sont des
- 56. Figure 14. Organisationdes différents lignages hématopoïétiques. Toutes les cellules circulant dans le sang périphérique sont dérivées des cellules souches hématopoïétiques totipotentes (ou multipotentes). Cette cellule souche indéterminée peut donner naissance à des cellules myéloïdes ou lymphoïdes en fonction des besoins du corps. L’hématopoïèse constitue l’ensemble des processus assurant le maintien d’un stock de cellules souches hématopoïétiques, leur différenciation et leur maturation de manière à assurer le renouvellement à long terme de l’ensemble des cellules sanguines, myéloïdes et lymphoïdes, globules rouges et plaquettes. Précurseur lymphoïde commun Précurseur myéloïde ErythroblastesMégacaryoblastes ErythrocytesPlaquettesMonocytes Lymphocyte T Lymphocyte B Leucocytes Polynucléaires Précurseur érythroïde PlasmocytesCellules T effectrices Cellule souche hématopoïétique
- 57. 32 régulateurs clés del’expression génique spécifique du lignage cellulaire dans des voies majeures du développement. Ce sont d’ailleurs des gènes qui sont apparus très tôt au cours de l’évolution et qui partagent une grande similitude de structure chez les mammifères (Levanon et al, 2003; Rennert et al, 2003) et pour revue voir (Coffman, 2003)). Les souris doublement inactivées pour Runx1 meurent au jour embryonnaire E12,5 et présentent une hémorragie massive, principalement dans le système nerveux central, suggérant que Runx1 est nécessaire pour la formation des vaisseaux sanguins. De plus, l’hématopoïèse dans le foie fœtal est complètement bloquée. L’hématopoïèse normale se déroule par une succession de vagues de différenciation. La première est appelée hématopoïèse primitive et se déroule dans le sac vitellin où sont formés les érythrocytes nucléés. La seconde vague de différenciation est l’hématopoïèse définitive et produit des cellules d’une multitude de lignages, telles que les cellules lymphoïdes, myéloïdes et érythroïdes (figure 14). Les expériences d’inactivations géniques (KO) ont révélé que Runx1 n’affecte pas l’hématopoïèse primitive, mais est indispensable pour l’hématopoïèse définitive (Okuda et al, 1996; Wang et al, 1996a). Des études complémentaires utilisant des souris transgéniques ont permis d’étudier davantage le rôle de Runx1 au cours de l’hématopoïèse, en inactivant de manière conditionnelle le gène Runx1 (par délétion d’exon) chez la souris adulte. Les phénotypes observés dans ces études diffèrent légèrement en fonction des conditions d’inactivation du gène Runx1, mais tous présentent une réduction du nombre de lymphocytes B et T matures ainsi que des thrombocytes dans le sang périphérique. Plusieurs études ont tenté de caractériser l’étape de maturation des lymphocytes bloquée par l’absence de la protéine Runx1 fonctionnelle. Growney et ses collègues ont ainsi montré que le nombre de progéniteurs lymphocytaires communs (PLC) est diminués de sept fois dans la moelle osseuse par rapport aux souris « contrôle » (Growney et al, 2005). De plus, les pro- et pré-lymphocytes B sont pratiquement indétectables et les lymphocytes B matures sont réduits de 20% en absence de la protéine Runx1 fonctionnelle (Growney et al, 2005). Dans la rate également, le nombre de lymphocytes B mature est diminué au bénéfice des formes immatures (Putz et al, 2005). Dans le thymus, la population de lymphocytes T est retrouvée dans les mêmes proportion que dans la rate : il y a une augmentation des formes très immatures de lymphocytes T (double négatifs CD4- /CD8- ) au détriment des formes matures ou en cours de maturation (Putz et al, 2005). Les groupes de H. Hirai et de D. Gilliland ont montré que le blocage de la maturation des lymphocytes T dans le thymus se fait à la transition DN2 (CD44+ CD25+ ) - DN3 (CD44- CD25+ ) (Growney et al, 2005; Ichikawa et al, 2004). Ces observations expliquent la
- 58. 33 lymphocytopénie observée dansle sang périphérique (Growney et al, 2005; Ichikawa et al, 2004; Putz et al, 2005). Par ailleurs, la perte de la protéine Runx1 fonctionnelle ne modifie pas le taux de globules rouges (érythrocytes) dans le sang circulant ou dans la moelle osseuse, ni le taux de granulocytes neutrophiles (Growney et al, 2005; Ichikawa et al, 2004; Putz et al, 2005). En revanche dans le lignage myéloïde, Runx1 semble indispensable pour la maturation des mégacaryocyte qui donneront plus tard les thrombocytes. En effet, après l’inactivation fonctionnelle du gène Runx1, on observe une diminution dramatique des thrombocytes dans le sang périphérique, concomitante avec une diminution des mégacaryocytes matures dans la moelle osseuse (Growney et al, 2005; Ichikawa et al, 2004; Putz et al, 2005). Au moins deux études ont corrélé la perte de la protéine Runx1 fonctionnelle à un phénotype myéloprolifératif. Le groupe de F. Buchholz note qu’après deux mois d’inactivation fonctionnelle du gène Runx1, la taille de la rate était augmentée de manière significative, suggérant une splénomégalie liée à l’absence prolongée d’une protéine Runx1 fonctionnelle. Les auteurs rapportent que le volume de la pulpe rouge (compartiment myéloïde) est augmenté, au détriment de la pulpe blanche (compartiment lymphoïde) (Putz et al, 2005). Dans la pulpe rouge, la quantité de granulocytes neutrophiles et de monocytes était très augmentée, bien que leur taux reste normal dans le sang périphérique. La splénomégalie observée (en absence de la protéine Runx1 fonctionnelle) serait donc liée à une population plus importante de progéniteurs myéloïdes et non pas à un blocage de la différenciation. De plus, le groupe de D. Gilliland a observé une légère hyperplasie myéloïde dans les tissus hématopoïétiques de la moelle osseuse de souris lorsque le gène Runx1 est fonctionnellement inactivé. Il y a donc une augmentation significative des formes myeloides en maturation et une hypercellularité dans la moelle osseuse (Growney et al, 2005) et dans la rate (Putz et al, 2005). Le rôle de CBFβ dans le développement normal est très lié à celui de Runx1. En effet, la délétion de CBFb chez les souris se traduit par la perte de l’hématopoïèse définitive à partir des cellules précurseurs, comme chez les souris déficientes pour Runx1. CBFβ forme un hétérodimère avec Runx1 pour augmenter son interaction avec l’ADN et la régulation de l’expression de leur gènes cibles. Ceci suggère que l’un des mécanismes par lequel Runx1 est capable de maintenir la différenciation normale implique CBFβ, permettant ainsis de former un hétérodimère CBFβ/Runx1 actif (Sasaki et al, 1996; Wang et al, 1996b).
- 59. Figure 15. Organisationdu gène RUNX1 humain. A) Illustration de la région régulatrice et de la région codante du gène humain RUNX1. Le numéro du chromosome humain où est situé le gène RUNX1 est indiqué à gauche. Les gènes voisins CLIC6 et DSCR1 conservés pour les trois gènes RUNX sont indiqués en aval du gène RUNX1. Les deux promoteurs P1 et P2 sont également représentés ainsi que les codons d’initiation ATG leur correspondant. Les régions 5’UTR sont indiquées en jaune et en orange et le 3’UTR est symbolisé en bleu. B) Schéma de la structure du 5’UTR correspondant au promoteur distal P1. Il contient 4 exons dont les 2 du milieu sont épissés alternativement et désignés « exon/intron ». RR symbolise la position de deux sites de fixation de la protéine Runx. C) Représentation du 5’UTR correspondant au promoteur proximal P2. Cet UTR recouvre un exon qui se termine par un site d’épissage dans l’exon indiqué « AG », précédé du signal de branchement intronique CTRAY. Le 5’UTR du promoteur P2 contient un IRES et est entouré d’un ilôt CpG exceptionnellement large marqué par un nuage gris clair. Figure extraite de Levanon and Groner, Oncogene, 2004. A B C
- 60. 34 Satake et sescollègues ont étudié l’expression de CBFb et Runx1 dans plusieurs tissus de souris âgées de quatre mois. Parmi les tissus observés, Runx1 est particulièrement abondant dans le thymus et dans une moindre mesure dans les poumons. En revanche, la sous-unité CBFβ apparaît exprimée de manière quasi ubiquitaire en montrant une bonne détection de ses transcrits dans le cerveau, les poumons, le cœur, le thymus, le foie et les testicules, et dans une moindre mesure dans la rate et les reins (Satake et al, 1995). Chez les souris adultes, le transcrit de CBFb est également abondant dans le muscle squelettique (Chiba et al, 1997; Zhu et al, 1994). Une autre étude sur les embryons de souris montre, par hybridation in situ, qu’au cours du développement CBFb est présent dans le système nerveux central, la racine dorsale, le nerf crânien, les yeux, les bourgeons des membres, les somites et les côtes (Adya et al, 2000; Wang et al, 1996b). Une autre étude sur des embryons de souris montre que Runx1 est détecté dans l’épithélium des glandes salivaires, des bronches, des muqueuses olfactives et respiratoires de la cavité nasale, du palais, des muqueuses de l’œsophage et de l’estomac (Levanon et al, 2001a). Runx1 est également trouvé dans le mésenchyme, dans la région vacuolaire du cœur, de la ligne médiane thoracique et abdominale, dans le stroma ovarien et les parties génitrices extérieures (Levanon et al, 2001a). II.2 Organisation génomique de Runx1 et CBFb Les gènes codant le domaine runt sont retrouvés en phylogénie dans divers organismes. Les organismes inférieurs contiennent une seule copie du gène Runx et en remontant l’échelle phylogénétique vers les arthropodes et les vertébrés, les gènes Runx se multiplient par duplication du gène original (pour revues voir (Rennert et al, 2003; Robertson et al, 2009; Sullivan et al, 2008)). Les trois protéines Runx1, Runx2 et Runx3 humaines et murines sont codées respectivement sur les chromosomes humains 21q22.2, 6p21 et 1p36.1 ou sur les chromosomes murins 16, 17 et 4 (Avraham et al, 1995; Bae et al, 1995; Calabi et al, 1995; Levanon et al, 1994). L’unique gène codant pour CBFb chez les mammifères est porté sur le chromosome 16q22 chez l’homme ou sur le chromosome 8 chez la souris (Adya et al, 2000). II.2.1 Les deux promoteurs de Runx1 et l’épissage alternatif de son ARNm sont à l’origine de ses nombreuses isoformes Les trois gènes Runx de mammifères ont une structure très conservée qui s’étend au-delà du locus Runx lui-même pour inclure les gènes voisins paralogues CLIC et DSCR. Les éléments similaires entre les trois gènes Runx incluent également les éléments de régulation de leur expression, comme leurs deux promoteurs P1 (distal) et P2 (proximal). Le promoteur P2 est situé dans un grand îlot CpG, contrairement au promoteur P1. En revanche, une autre région
- 61. 35 CpG est rerouvéeen 3’, au niveau du dernier exon des gènes Runx (Bangsow et al, 2001; Levanon et al, 2001b), (figure 15). Ensemble ces deux régions CpG bordant les gènes Runx pourraient être liées à l’expression spécifique de tissu des gènes Runx. Par exemple, le promoteur P2 de Runx3 est hyperméthylé dans les lignées de cancers gastriques (Li et al, 2002). Chaque promoteur (P1 et P2) contient plusieurs sites consensus pour la fixation des protéines Runx, suggérant l’existence de régulations croisées et de boucles d’auto-amplification des gènes Runx. Cependant, les expériences d’inactivation génique de chacun des gènes Runx montrent que l’expression des autres gènes Runx n’est pas perturbée et donc l’hypothèse d’une boucle d’auto-amplification est plus probable qu’une régulation croisée. De manière intéressante, sur les gènes Runx humains et murins, deux sites de fixation de Runx sont disposés de la même manière, au commencement du 5’ UTR du promoteur P1 sur une séquence de 18 paires de bases parfaitement conservée (Bangsow et al, 2001). La présence de deux promoteurs est à l’origine de deux isoformes protéiques majeures de Runx1 qui diffèrent par leur extrémité N-terminale. Pour la protéine Runx1 humaine, l’isoforme de type I produite à partir du promoteur P2, contient le pentapeptide MRIPV à l’extrémité N-terminale et correspond à l’isoforme AML1b humaine (Runx1-P2). La partie N-terminale de l’isoforme II, produite à partir du promoteur P1, est plus longue (entre 19 et 32 résidus) et, est initiée par la séquence MASN /DS et correspond à l’isoforme AML1c humaine (Runx1-P1). En ce qui concerne le gène humain RUNX1, la région 5’ UTR de P1 fait 452 pb et la région 5’ UTR de P2 est particulièrement longue et compte 1631 pb. L’isoforme produite à partir du promoteur proximal P2 est exprimée de manière dominante par rapport à l’isoforme produite à partir du promoteur distal P1. D’ailleurs, lorsque l’on regarde la conservation des gènes Runx entre espèces, on s’aperçoit que chez les invertébrés, tous les gènes Runx connus commencent par une région 5’ UTR longue et une séquence amino-terminale qui ressemble au pentapeptide produit à partir du promoteur P2 chez les vertébrés. Ces données suggèrent que P2 est le promoteur ancestral du gène Runx (pour revue voir (Rennert et al, 2003). De manière intéressante, la transcription du gène Runx1 à partir du promoteur P1 ou P2 varie au cours du développement. Par exemple, dans les cellules souches embryonnaires murines en différenciation, Runx1-P1 a une expression plus tardive par rapport à Runx1-P2 (Fujita et al, 2001). De même, les cellules souches embryonnaires humaines en culture expriment Runx1-P2 mais pas Runx1-P1, alors qu’en cours de différenciation ces cellules expriment Runx1-P1 (Zambidis et al, 2005).
- 62. Figure 16. Structuregénomique et variants d’épissage de CBFβ. Les nombreux produits d’épissage et la structure résultante de l’ADNc de CBFβ sont présentés sous forme de diagramme en dessous de sa structure génomique et les acides aminés bordant chaque exon sont inscrits au-dessus de la bordure de l’exon. Les deux séquences d’acides aminés différentes, codées par l’exon 6 et générées par l’épissage alternatif d’un site donneur à la fin de l’exon 5, sont représentées par un motif différent sur le dernier exon (damier ou stries). Le nombre d’acides aminés et le poids moléculaire (en kDa) sont indiqués à gauche de chaque variant d’épissage entre parenthèses. Figure extraite de Adya et al, Cell Developmental Biology, 2000. Structure génomique de CBFβ
- 63. 36 La traduction del’ARN messager est dépendante de Cap pour le promoteur P1, alors qu’elle est dirigée par un IRES pour le promoteur P2. La traduction passant par l’IRES peut avoir lieu lorsque la traduction par Cap est physiologiquement bloquée, par exemple pendant la mitose, la différenciation ou des conditions de stress (p.e. en présence de protéases virales). Ainsi, les différentes conditions de traduction d’un ARNm codant Runx représentent un niveau de régulation supplémentaire pour l’expression d’une isoforme par rapport à une autre. En plus des deux extrémités N-terminales alternatives des gènes Runx, les ARN messagers sont soumis à un épissage alternatif, générant ainsi de nombreuses isoformes pour chacun des gènes Runx avec différentes fonctions biologiques ((Levanon et al, 2001b) et pour revue voir (Levanon & Groner, 2004)). Par exemple, l’isoforme humaine AML1a, transcrite à partir du promoteur P2, ne possède pas de domaine de transactivation (Miyoshi et al, 1995). II.2.2 La protéine CBFβ et ses isoformes Chez les vertébrés et les invertébrés, la protéine CBFβ est codée par un seul gène, excepté chez la drosophile qui contient deux gènes homologues Brother (Bro) et Big brother (Bgb). Les gènes humains et murins codant pour CBFβ contiennent 6 exons et sont soumis à un épissage alternatif générant au final quatre isoformes (figure 16). Les isoformes longues de 182 et 187 résidus diffèrent par leur partie C-terminale (figure 16). Ces deux isoformes conservent parfaitement les 135 acides aminés nécessaires pour la dimérisation et la stimulation de la liaison à l’ADN de Runx1, bien que l’isoforme CBFβ(187) stimule plus efficacement la transactivation de l’enhancer S3-3MLV (Zaiman et al, 1995). C’est d’ailleurs l’isoforme murine CBFβ(187) que j’ai utilisée dans mes expériences de co-transfection et pour établir la lignée cellulaire surexprimant stablement CBFβ (voir le chapitre « Article de Recherche »). Les isoformes de 148 et 155 résidus sont générées par un épissage alternatif de l’exon 3 et de l’exon 5 respectivement (figure 16). Ces deux dernières isoformes ne se dimérisent pas stablement avec Runx1 (Ogawa et al, 1993a; Wang et al, 1993). La séquence codante de CBFβ est très conservée entre l’Homme et la Souris (93% de conservation) et la séquence en acides aminés également (99% de conservation) (Adya et al, 2000). Chez la souris, le gène CBFb est transcrit à partir d’un promoteur distal qui s’étend des nucléotides -1496 à -1061 et d’un promoteur proximal qui s’étend des nucléotides -1127 à - 251. Le promoteur distal contient trois sites de fixation TRE reconnus par AP-1 et le promoteur proximal contient un site TRE et un site CRE (reconnu par CREB). L’expression de CBFb via son promoteur proximal est entre autre activée par le facteur AP-1 formé de l’homodimère JunB-JunB ou de l’hétérodimère JunB-ATF2. De manière intéressante, les souris déficientes pour JunB meurent à un stade embryonnaire et les phénotypes obtenus
- 64. Figure 17. Structuredu complexe formé du domaine runt de Runx1, CBFβ et l’ADN. L’ADN est représenté en orange et en jaune. CBFβ est représenté en violet et le domaine runt de Runx1 est coloré en cyan. Les boucles du domaine runt en contact avec le grand sillon de l’ADN sont colorées en bleu (boucle C-terminale) et en rouge, alors que la boucle en contact avec le petit sillon de l’ADN est colorée en vert. Figure extraite de Zhang et al., Blood Celles, Molecules and Diseases, 2003.
- 65. 37 pour les sourisdont le gène JunB a été inactivé montre un phénotype étonnamment similaire à celui des souris déficientes en CBFb. Par ailleurs, une étude du transcriptome dans les cellules endothéliales de souris a révélé que CBFb était bien un gène cible de JunB. D’ailleurs dans la moelle osseuse de souris déficientes en JunB, le niveau d’expression de CBFb est diminué de 60% par rapport aux souris contrôles. Ceci montre que la régulation de l’expression de CBFb est hautement dépendante de AP-1, en tout cas dans les cellules endothéliales murines (Licht et al, 2006). II.3 Relation Structure/ Fonction II.3.1 La sous-unité protéique Runx1 Plusieurs domaines de la protéine Runx1 ont été conservés à travers l’évolution. On peut notamment citer le domaine runt, les domaines d’autoinhibition, le domaine VWRPY, les domaines de transactivation et la séquence de localisation nucléaire. II.3.1.1 Le domaine runt de Runx1 : hétérodimérisation avec CBFβ et liaison à l’ADN La famille de protéines à domaine runt est une famille de facteurs de transcription très conservés, incluant Runt et Lozenge exprimés chez la drosophile, SpRunt chez les oursins, Cs-Runt chez l’araignée (Cupiennius salei), Xam1 chez le xénope, Runx1, Runx2 et Runx3 chez les mammifères, RNT-1 (Caenorhabditis elegans). Le domaine runt (RD) est la signature de cette famille de protéines. C’est un motif conservé de 128 acides aminés, responsable à la fois pour la liaison à l’ADN de manière spécifique de séquence et de la dimérisation avec CBFβ (Kagoshima et al, 1993). Le domaine runt de Runx1 interagit avec une région de 135 acides aminés de la protéine CBFβ. La stœchiométrie du complexe [Runx-CBFβ-ADN] prédite et vérifiée est de 1:1:1. (Bravo et al, 2001; Ogawa et al, 1993a; Tang et al, 2000a; Zhang et al, 2003). Des études de fixation de la protéine Runx1 montrent qu’elle a une affinité réduite à l’ADN, par rapport au domaine runt seul, suggérant l’existence de domaine(s) inhibiteur(s) hors du domaine runt. Cette inhibition de fixation à l’ADN est levée par la liaison de CBFβ à Runx1, stimulant ainsi sa fixation à l’ADN d’au moins quarante fois. Au sein du domaine runt, les régions respectivement impliquées dans l’interaction avec CBFβ et la fixation à l’ADN sont distinctes et ne se chevauchent pas (Nagata & Werner, 2001) (figure 17). Comme il sera mentionné dans la section « II.3.1.2 Les domaines d’autoinhibition (NRHn, NRDBn et NRHc », la dimérisation de CBFβ avec Runx1 peut être induite et stimulée par d’autres facteurs de transcription, tel que Ets-1. Cependant, Runx1/CBFβ a un rôle dans des
- 66. Figure 18. Domainesfonctionnels de la protéine Runx1. Représentation schématique des domaines fonctionnels de la protéine Runx1. RD : domaine runt ; AD : domaine d’activation de la transcription ; ID : domaine d’inhibition de la transcription ; TE1, 2 et 3 : éléments d’activation de la transcription ; NLS : séquence de localisation nucléaire ; NRDBn et NRDBc : régions de régulation négative de la fixation à l’ADN, respectivement localisées en N-terminal et C-terminal; NRHn et NRHc : région de régulation négative de l’hétérodimérisation, respectivement localisées en N-terminal et en C-terminal; Association à la matrice nucléaire : région associée étroitement à la matrice nucléaire. Figure adaptée de Ito, Genes to Cells, 1999. Association à la matrice nucléaire 59 70 173 Liaison à l’ADN Hétérodimérisation
- 67. 38 tissus où Ets-1n’est pas exprimé, donc Ets-1 n’est clairement pas le seul facteur à stimuler la formation du dimère Runx1/CBFβ et sa fixation à l’ADN. Il existe d’autres facteurs de transcription connus pour coopérer avec Runx1, incluant par exemple Myb (Hernandez- Munain & Krangel, 1995), C/EBPα (Zhang et al, 1996), MITF (Ogihara et al, 1999) et les facteurs SMADs (Hanai et al, 1999), bien que pour ces facteurs aucune étude n’ait montré leur rôle fonctionnel dans la stimulation de la liaison à l’ADN de Runx1/CBFβ. La séquence consensus de liaison à l’ADN du dimère Runx1/CBFβ est PuT/ACCPuCA (Kamachi et al, 1990). Pour davantage de précisions sur les propriétés de liaison à l’ADN de Runx/CBFβ, voir les travaux des groupes de John Bushweller et Nancy Speck (Crute et al, 1996; Huang et al, 1998b; Huang et al, 1999; Tang et al, 2000a; Tang et al, 2000b), Peter Gergen (Kagoshima et al, 1993) et Yoshiaki Ito (Ogawa et al, 1993b). II.3.1.2 Les domaines d’autoinhibition (NRHn, NRDBn et NRHc) Les protéines Runx contiennent des domaines d’auto-inhibition qui masquent le domaine runt de liaison à l’ADN. En effet, les hétérodimères Runx/CBFβ (CBF) formés à partir des sous-unités sauvages ont une liaison faible pour l’ADN. Cependant, si les régions amino- et carboxy- terminales au domaine runt sont enlevées, le domaine runt « nu » lie l’ADN correctement, suggérant que ces régions adjacentes masquent la surface de liaison à l’ADN du domaine runt. Il a été suggéré que l’hétérodimérisation des sous-unités Runx1 et CBFβ pourrait donc être bloquée aussi par ces régions. La régulation de la dimérisation de ses sous- unités fait partie des mécanismes qui régulent l’activité du facteur de transcription CBF. Sachant que la dimérisation des deux sous-unités est nécessaire pour former un facteur de transcription CBF actif, il est proposé que Runx1 soit synthétisé dans une forme native inerte, au sein de laquelle la régulation négative intramoléculaire de Runx empêche son interaction avec l’ADN ainsi que sa liaison à CBFβ. En se référant à la protéine Runx1 humaine, la région comprenant les acides aminés 1 à 49 représente à la fois le domaine d’inhibition de liaison à l’ADN (NRDBn) et de dimérisation avec CBFβ (NRHn) (figure 18). En effet, si cette région est enlevée, la dimérisation Runx1/CBFβ et la fixation du dimère sur l’ADN augmentent de manière significative. De la même manière, du côté C-terminal, une autre région a été montrée comme inhibant la formation de l’hétérodimère Runx1/CBFβ et s’étend des résidus 372 à 451 (NRHc), bien que le domaine exact d’inhibition n’est pas été précisément délimité (figure 18). D’autres mutants de délétion ont montré que la protéine Runx1 humaine tronquée après le 291ème résidu (1- 291), s’hétérodimérise bien avec CBFβ mais lie faiblement l’ADN, alors que le mutant
- 68. Figure 19. Interactionparticulière entre Runx1 (humain) et Ets-1 sur le site composite PBS (PEBP2 binding site) et les site EBS (Ets binding site). Représentation de la conformation de Runx1 (A), de Ets (B) et du dimère Runx-Ets sur l’ADN (C). Runt : domaine runt; ETS: domaine Ets; Ex;VII : région codée par l’exon 7; N et C: les extrémités N- et C-terminale de la protéine; EI et EII : les région qui intéragissent avec les régions PI et PII de Ets-1; PBS : site de fixation de CBF sur l’ADN; EBS : site de fixation de Ets sur l’ADN; NRDB et NRH : voir figure 17 pour la légende. (Figure extraite de Ito,Genes to Cells, 1999)
- 69. 39 tronqué après le177ème résidus (1-177) s’hétérodimérise avec CBFβ et se lie à l’ADN. Il existe donc une autre région d’inhibition de la fixation à l’ADN comprenant les acides aminés 178 à 291, appelée NRDBc (figure 18). De manière intéressante, Ets-1, une autre protéine qui se fixe sur l’enhancer du polyomavirus Py, possède également un domaine d’auto-inhibition qui limite la liaison à l’ADN du facteur sur son site consensus (Kim et al, 1999). Les sites consensus de Runx1 et Ets-1 (respectivement nommés PBS et EBS) sont retrouvés à proximité dans les régions régulatrices de nombreux gènes, notamment les gènes spécifiques des cellules T, tels que ceux codant les récepteurs α et β (TCRα et TCRβ). La présence de Runx1 et Ets-1 seuls (en absence de CBFβ) suffit pour stimuler leur fixation à l’ADN (figure 19). Dans le cas présent, il est même suggéré que CBFβ ne se lie à Runx1 qu’après la fixation à l’ADN de Runx1 et Ets-1, conférant ainsi à Ets-1 le rôle potentiel de médiateur de l’interaction entre Runx1 et CBFβ. En fait, l’interaction de Runx1 et Ets-1 via leur domaine d’auto-inhibition, permet l’exposition de leur domaine de liaison à l’ADN et l’activation consécutive de TCRα et TCRβ (Kim et al, 1999). Il n’est pas clair si CBFβ lie le complexe Runx1/Ets-1 avant ou après que le complexe soit en contact avec l’ADN. II.3.1.3 Le motif VWRPY Un domaine également conservé dans la famille à domaine runt est un motif de cinq acides aminés dans la partie carboxy-terminale: VWRPY (figure 18). Ce motif est parfaitement conservé chez l’homme, la souris, la drosophile, excepté pour C. elegans qui possède le motif VWRPF. La fonction de ce motif est complètement indépendante de l’activité de dimérisation ou de liaison à l’ADN de Runx/CBFβ. Le motif WVRPY est reconnu et lié par la protéine de drosophile Groucho ou son homologue chez les mammifères, TLE (Aronson et al, 1997; Nishimura et al, 2004). Groucho/TLE sont impliqués dans la répression de la transcription, comme il est décrit dans la section « III- Régulation de l’Activité du Facteur de Transcription CBF ». II.3.1.4 Le domaine d’activation de Runx1 En utilisant un système rapporteur dans la lignée cellulaire Jurkat, des mutants de délétion de Runx1 ont permis d’identifier un domaine d’activation de la transcription en C-terminal par rapport au domaine runt (Kanno et al, 1998). Il existe ainsi un domaine majeur d’activation dans la région 291 à 371 (positions des résidus dans la protéine Runx1-P2 murine). L’activité de transactivation de ce domaine est inhibée par le domaine adjacent allant des résidus 371 à 411, qui est donc un domaine inhibiteur. Une région minimale de transactivation a été
- 70. Figure 20. Changementde conformation de Runx1 après dimérisation avec CBFβ. La dimérisation de CBFβ avec Runx1 permet un changement de conformation de Runx1 et l’exposition du domaine de liaison à l’ADN. Runt: le domaine runt; β: la sous-unité CBFβ; NRDB: domaine de régulation négative de liaison à l’ADN; PBS: site de fixation de CBF sur l’ADN. Pour simplifier cette figure, les domaines d’activation et d'inhibition de la transcription n’ont pas été représentés. (Figure extraite de Ito,Genes to Cells, 1999)
- 71. 40 identifiée en testantd’autres mutants de délétion de Runx1-P2. L’élément de transactivation (TE) minimal s’étend ainsi des résidus 291 à 331 (TE1) et la région adjacente à TE1 qui comprend les résidus 332 à 371 (appelée TE2) augmente significativement la transactivation du mutant de Runx1-P2 (figure 18). Enfin, un autre TE a été identifié car le mutant de délétion TE3 (résidus 243-191) possède, lui aussi une activité de transactivation (Kanno et al, 1998) (figure 18). Il existe également une région d’activation dans la partie amino-terminale de Runx1 mettant en jeu la partie adjacente au domaine runt et l’hélice α du runt domaine lui-même. C’est une région acide de 26 résidus très conservée entre les trois protéines Runx de mammifères (Liu et al, 2006) (figure 18). II.3.1.5 Le signal de localisation nucléaire Les protéines Runx contiennent un signal de localisation nucléaire (NLS) conservé dans la partie C-terminale au domaine runt qui permet la localisation des protéines Runx dans le noyau de la cellule. De plus, les protéines Runx possèdent également une séquence ciblant la matrice nucléaire (NMTS) comprenant les résidus 324-353 chez Runx1-P2 murin (Kanno et al, 1998) ou 351-381 chez son homologue Runx1-P2 humain (Zeng et al, 1997). L’association du facteur CBF à la matrice nucléaire serait un pré-requis pour la transactivation par Runx1- P2 (Zeng et al, 1998), d’ailleurs, la séquence NMTS de Runx1 comprend le domaine d’activation (TE1 et TE2) (Kanno et al, 1998) (figure 18). II.3.2 La sous-unité protéique CBFβ La protéine CBFβ est une petite protéine de 22 kDa environ. Elle ne possède pas de domaines particuliers : pas de NLS, pas de NES, pas de site de liaison à l’ADN. Le rôle le plus important pour CBFβ est de lier le domaine runt et induire un changement de conformation de Runx qui expose ainsi le domaine de liaison à l’ADN (figure 20). La comparaison des constantes de dissociation [Runx-ADN] et [Runx-CBFβ-ADN] montre que CBFβ augmente l’affinité de liaison à l’ADN de Runx. Le mécanisme de stabilisation de la fixation de Runx à l’ADN par CBFβ n’est pas encore clairement défini, en revanche la structure du dimère a été élucidée par le groupe de Bushweller (Huang et al, 1999; Tang et al, 2000a; Zhang et al, 2003). Ce groupe a également montré que les 141 premiers acides aminés (1-141) suffisaient à CBFβ pour se lier au domaine runt avec la même efficacité que la protéine complète (182 ou 187 résidus) (Zhang et al, 2003). Ce fragment N-terminal de 141 résidus est également capable de restaurer l’hématopoïèse terminale dans les cellules souches embryonnaires déficientes en CBFb (Miller et al, 2001). Il est possible que ce domaine soit le
- 72. 41 seul requis pourla fonction de CBFβ in vivo. Finalement, la région minimale pour la dimérisation de CBFβ avec le domaine Runt est située au niveau des 135 premiers acides aminés, et les 117 premiers acides aminés sont nécessaires pour stimuler la liaison à l’ADN de Runx (Kagoshima et al, 1996). Bien que CBFβ ait été décrit à de nombreuses reprises comme un partenaire indispensable à la fonction des protéines Runx, une étude sur l’embryon d’oursin montre que pour l’activation de certains gènes cibles de Runx, SpCBFβ (homologue de CBFβ chez l’oursin) n’est pas indispensable. Selon cette étude, SpCBFβ jouerait un rôle fondentamental avec Runx préférentiellement pour une catégorie de gènes impliqués dans les voies de différenciation cellulaire (Robertson et al, 2006). La dimérisation de Runx avec CBFβ ne fait pas qu’augmenter l’affinité de Runx pour l’ADN. En effet, CBFβ a récemment été montré comme protégeant Runx de sa dégradation par le protéasome (Huang et al, 2001). En effet, Runx1 est soumis à une dégradation protéolytique par la voie ubiquitine/protéasome. Ici encore CBFβ joue un rôle important en protégeant Runx1 de sa dégradation car en se dimérisant avec Runx1, CBFβ stabilise la protéine. Les données sur les souris déficientes pour CBFb soutiennent ces conclusions, puisque le niveau protéique de Runx1 dans ces souris est plus faible que dans les souris sauvages. III. REGULATION DE L’ACTIVITE DU FACTEUR DE TRANSCRIPTION CBF Plusieurs gènes cibles des facteurs de transcription Runx ont été identifiés dans les tissus hématopoïétiques, squelettiques et tumoraux. Depuis les premières publications sur les facteurs de transcription Runx, le nombre de gènes régulés positivement ou négativement par ces facteurs est en constante augmentation. Certains de ces gènes ont des fonctions dans la tumorigenèse, la progression cellulaire ou l’angiogenèse. Bien que la majorité des gènes cibles étudiés de Runx soient activés, la répression transcriptionnelle de certains gènes cibles suggère que les facteurs Runx puissent jouer à la fois le rôle d’activateurs et de répresseurs en fonction du contexte dans lequel ils se fixent à l’ADN. Ce contexte est déterminé par le type cellulaire et la combinaison de différents facteurs de transcription se fixant aux sites au sein d’une région de régulation d’un gène cible (Canon & Banerjee, 2003). La capacité des protéines Runx à agir comme une protéine de charpente dans des complexes activateurs ou répresseurs, leur permet d’agir comme des intégrateurs des différents signaux des diverses
- 73. Figure 21. Runx1associé à ses coactivateurs et ses corépresseurs. Dans l'activation transcriptionnelle, Runx1/CBFβ (CBF) fonctionne comme une protéine charpente qui interagit avec beaucoup de facteurs de transcription spécifiques de tissu, tels que Ets et Myb. De plus, CBF peut recruter des activateurs tels que p300 et P/CAF. Ces protéines possèdent une activité acétyltransférase. CBF interagit également avec des corépresseurs tels que Groucho/TLE-1 (grâce à son motif VWRPY en C-terminal) qui peut se retrouver complexé à des histones désacétylases (HDACs) et mSin3 qui est capable de recruter des HDACs et l’histones méthyltransférase Suv39h1. Runx1 Ets/myb P/CAF Gènes cibles p300 CBFβ Gènes cibles Runx1 CBFβ Groucho /TLE HDAC Gènes cibles Runx1 CBFβ Suv39h Sin3A HDACs ACTIVATION REPRESSION
- 74. 42 voies de signalisation,rendant les facteurs Runx comme des interrupteurs réglables pour les processus clés du développement, de la prolifération et la différenciation cellulaire. C’est finalement le code de combinaison de facteurs liés à des promoteurs particuliers qui détermine le profil d’expression d’un gène. À ce jour, les mécanismes d’action des protéines Runx sont très variés et sont focalisés sur certains gènes cibles spécifiques, dont la nature reflète l’intérêt d’un groupe de recherche en particulier. Ceci rend particulièrement difficile de tirer des conclusions générales sur les différents mécanismes reportés. Ici, je ne vais pas présenter les gènes positivement ou négativement régulés par Runx1, car un même gène va être réprimé ou activé par Runx1 selon le contexte cellulaire dans lequel il est étudié (c’est par exemple le cas du gène p21WAF1/CIP1 ). En lieu, je présente ici quelques interacteurs connus de Runx1 ou de protéines modifiant directement Runx1 pour moduler son activité (figure 21). III.1 Régulation positive de l’activité de transactivation de Runx1 III.2.1 Phosphorylation, acétylation et méthylation de Runx1 Les mécanismes par lesquels les facteurs de transcription Runx activent l’expression génique impliquent le recrutement de protéines coactivatrices telles que les HATs p300, MOZ, la kinase HIPK ou encore l’arginine méthyltransférase PRMT1. Un des premiers co-activateurs de Runx1 identifié est la protéine HAT p300. Dans les cellules myéloïdes L-G, au niveau endogène p300, CBP et Runx1 sont immunoprécipités ensemble (Kitabayashi et al, 1998). De plus, une autre étude précise que p300 acétyle deux résidus lysine très conservés, en positions 24 et 43 de Runx1 (forme humaine) situés dans la partie N-terminale adjacente au domaine runt (Yamaguchi et al, 2004). L’acétylation de Runx1 augmente sa fixation sur sa séquence d’ADN spécifique et stimule l’activation de la transcription. Les auteurs proposent que l’acétylation des deux lysines 24 et 43 situées dans le NRDBn (Negative Regulatory region for DNA Binding N-terminal to the runt domain) pouvait induire un changement de conformation du NRCBn qui dévoilerait le domaine de liaison à l’ADN du domaine runt. Alternativement, cette acétylation pourrait avoir un effet sur les interactions protéine-protéine, permettant à Runx1 de recruter d’autres coactivateurs (Yamaguchi et al, 2004). Une autre acétyltransférase, la protéine MOZ, interagit aussi avec Runx1 et stimule son activité. De manière surprenante, le domaine acétyltransférase de MOZ n’est pas indispensable pour l’interaction avec Runx1 et l’acétylation de Runx1 par MOZ a seulement été observée in vitro (Kitabayashi et al, 2001). La kinase HIPK2 a été identifiée comme un composant du complexe Runx1 (forme humaine) (Kitabayashi et al, 2001). Les protéines HIPKs (homeodomain-interacting protein kinases)
- 75. Figure 22. Cascadede phosphorylation initiée par Runx1/p300. Initiation de la cascade de phosphorylation après la dimérisation de Runx1 avec CBFβ sur un site de liaison fonctionnel sur l’ADN. Cette cascade conduit à l’activation des gènes cibles de CBF. Figure adaptée de WEE et al., Blood, 2008. 5. Recrutement de p300 1. Hétérodimérisation de Runx1/CBFβ 6. Phosphorylation de p300 7. Activation des gènes cibles 3. Recrutement de HIPK2 4. Phosphorylation de Runx1 2. Reconnaissance et fixation sur l’ADN
- 76. 43 sont des kinasesserine/thréonine dont trois membres ont été identifés (HIPK1, HIPK2, HIPK3). La phosphorylation de Runx1 sur les résidus Ser249 et Ser276 par HIPK2 rend la protéine Runx1 active, car dans un système rapporteur, les mutants Runx1 non- phosphorylables ne sont plus capables d’activer la transcription correctement (Aikawa et al, 2006). Les auteurs montrent également que les souris inactivées pour les gènes HIPK1 et HIPK2 n’expriment plus la forme protéique hyperphosphorylée de p300, suggérant que la phosphorylation de p300 est dépendante de HIPK1 et/ou HIPK2. Effectivement, grâce à des expériences de co-transfection, les auteurs montrent que la phosphorylation et l’association de Runx1 avec HIPK1/2 est en fait un pré-requis pour la phosphorylation consécutive de p300. Les modifications post-traductionnelles de p300 et Runx1 sont nécessaires pour activer la transcription (Aikawa et al, 2006). De manière intéressante, MOZ est également phosphorylée par HIPK2 et le trimère Runx1-HIPK2-MOZ semble être indispensable pour la phosphorylation de MOZ (Aikawa et al, 2006). Il est donc proposé que Runx1 agisse comme protéine de structure pour l’interaction physique entre HIPK2 et p300/MOZ, et pourrait constituer une unité de régulation pour contrôler la phosphorylation de p300 (Yoshida & Kitabayashi, 2008). Une étude récente a mis en valeur le rôle de CBFβ, en montrant que l’hétérodimérisation de Runx1 avec CBFβ était nécessaire pour sa phosphorylation par HIPK2 (Wee et al, 2008). La figure ci-contre récapitule les étapes d’activation de Runx1 pour être dans un forme active (figure 22). III.2.2 Modulation de l’activité de Runx1 par la MAP kinase ERK Les cytokines et les facteurs de croissance régulent l’activité transcriptionnelle de Runx1 en contrôlant la phosphorylation de Runx1 par les MAPK (mitogen activated protein kinase). La protéine Runx1 contient 14 sérines (ou thréonines) suivies d’une proline, ce qui constitue la séquence minimale reconnue par les MAPK. Trois de ces sites de phosphorylation sont situés dans la partie amino-terminale de Runx1, les onze autres sites sont distribués dans le domaine de transactivation carboxy-terminal. Le groupe de H. Hirai a montré que le EGF (epithelium growth factor) et l’IL-3 (interleukine-3) stimulent l’activité transcriptionnelle de Runx1 via la phosphorylation de ses sérines Ser-249 et -266 par ERK (Tanaka et al, 1996). La phosphorylation de Ser-249 et -266 module l’activité de Runx1 en induisant la dissociation de Runx1 et mSin3A qui est un corépresseur transcriptionnel (Imai et al, 2004). Inversement, les mutants de Runx1 présentant une délétion des résidus 248 à 287, où sont normalement situés les sites de phosphorylation de ERK, ont une interaction plus forte avec le corépresseur mSin3A (Lutterbach et al, 2000). De plus, d’autres sites de phosphorylation de ERK décrits pour quatre sérines et thréonines rapprochées (Ser-249, -266, -276 et Thr-273), ont également
- 77. 44 un rôle dansla régulation de l’activité de Runx1. En effet, si ces sites sont remplacés par des alanines, l’activité transcriptionnelle est considérablement réduite, alors que s’ils sont remplacés par des acides aspartiques l’activité de Runx1 est augmentée (Zhang et al, 2004). Ces données montrent que la phosphorylation de Runx1 par ERK est nécessaire pour l’activité de Runx1. Cependant, il n’est pas clair si la phosphorylation de Runx1 est nécessaire pour sa dimérisation avec CBFβ. De manière intéressante, ERK ne serait pas seulement impliquée dans la modulation de l’activité de Runx1, mais pourrait également jouer un rôle dans sa dégradation. En effet, Runx1 est dégradé par la voie ubiquitine-protéasome (Huang et al, 2001), et la phosphorylation de Runx1 par ERK pourrait déstabiliser Runx1 (Imai et al, 2004). Ceci pourrait être un moyen d’induire un renouvellement rapide de la protéine une fois qu’elle est phosphorylée et active. La transactivation de Runx1 après avoir été phosphorylé par ERK apparaît ainsi comme transitoire. III.2 Régulation négative de l’activité de Runx1 La répression des gènes dépendante de Runx passe par le recrutement et l’interaction directe avec des protéines co-répresseurs telles que le facteur TLE1/Groucho, mSin3A, les histones désacétylases (HDACs) et les méthyltransférases d’histone (HMTs), grâce à des motifs conservés sur certains domaines spécifiques de la protéine Runx (figure 21). III.2.1 Groucho/TLE La protéine de drosophile Gro et ses homologues humains TLE1-4 sont exprimés de manière ubiquitaire. Ce sont des protéines nucléaires qui ne se fixent pas à l’ADN et comprennent des motifs répétés WD impliqués dans les interactions protéine-protéine. Le mécanisme d’action de Groucho/TLE n’est pas très clair. Par exemple, en ce qui concerne l’homologue de Groucho/TLE chez la levure (Tup1p) le mécanisme d’action rapporté est : (i) le blocage du domaine d’activation des facteurs de transcription, (ii) l’interaction avec la machinerie de transcription et (iii) l’induction d’une structure chromatinienne non-permissive à la transcription avec des interactions directes avec les queues N-terminales des histones H3 et H4 (pour revue voir (Parkhurst, 1998)). TLE est un des premiers co-répresseurs à avoir été décrit comme interagissant avec Runx1. Groucho/TLE induit la répression des gènes cibles de Runx1 en reconnaissant et en interagissant avec le motif VWRPY de Runx1. La répression de l’activation de deux gènes cibles de Runx1 par TLE1, a été montrée au niveau des enhancers de TCRα et TCRβ (Levanon et al, 1998). Une autre étude a montré que TLE1 et TLE2 sont associés à la matrice nucléaire comme Runx1 et par microscopie confocale TLE1 et TLE2
- 78. 45 colocalisent avec Runx1dans les mêmes foci (Javed et al, 2000). De manière intéressante, Groucho, l’homologue de TLE chez la drosophile, s’associe avec l’histone H3 et l’histone désacétylase Rdp3 (Chen et al, 1999; Palaparti et al, 1997), ajoutant ainsi un degré supplémentaire de répression ou une explication sur le mécanisme répresseur de Groucho. III.2.2 mSin3A et les HDACs La répression des gènes cibles de Runx1 n’est pas toujours dépendante de Groucho/TLE. C’est notamment le cas du gène p21WAF1/CIP1 qui est réprimé par Runx1 indépendamment de sa liaison au corépresseur Groucho. Runx1 interagit en fait avec d’autres répresseurs. En particulier, pour la répression de p21WAF1/CIP1 Runx1 interagit directement avec mSin3A. Des mutants de délétion de Runx1 ont permis d’identifier le domaine d’interaction avec mSin3A près de l’extrémité carboxy-terminale, mais sur un site distinct du site de fixation de Groucho. Le site d’interaction de mSin3A avec RUNX1 est situé sur la région C-terminale immédiatement adjacente au domaine runt, puisque le mutant Runx1 humain dont les résidus 208 à 237 ont été délétés n’est plus capable d’interagir avec mSin3A (Lutterbach et al, 2000). La protéine mSin3A est un membre de la famille des corépresseurs mSin3 qui agit souvent en coopération avec les co-répresseurs N-CoR (Nuclear receptor CoRepressor) et SMRT (Silencing Mediator of Retinoic acid and Thyroid hormone receptor) et les histones désacétylases (Torchia et al, 1998). D’ailleurs dans leur étude, les auteurs montrent qu’en traitant les cellules avec un inhibiteur de HDAC, la répression du promoteur de p21WAF1/CIP1 par Runx1 est en partie levée (Lutterbach et al, 2000). Un argument supplémentaire qui met en avant le rôle des HDACs dans la répression médiée par Runx1 est apporté par Imai et ses collègues. Les auteurs ont montré dans une étude antérieure que la transcription de TCRβ induite par Runx1 dépendait de l’état de phosphorylation de Runx1. Notamment, comme je l’ai mentionné avant, un mutant de Runx1 non phosphorylable a une activité réduite pour activer TCRβ. Ici les auteurs montrent que ce mutant retrouve en partie son activité transcriptionnelle en présence d’un inhibiteur des HDACs. Ceci suggère que mSin3A, qui s’associe préférentiellement à Runx1 non-phosphorylé (ou non-phosphorylable), agit en faisant un pont entre Runx1 et les HDACs (Imai et al, 2004). De manière intéressante, dans la même étude les auteurs montrent que mSin3A guide Runx1 dans la matrice nucléaire, car le mutant mimant la phosphorylation constitutive de Runx1 n’interagit plus avec mSin3A et n’est plus localisé dans la matrice nucléaire. Le NMTS et le domaine d’interaction avec mSin3A semblent donc nécessaires pour la localisation de Runx1 dans la matrice nucléaire, en tout cas dans les cellules Cos7 et lorsque les différents partenaires sont surexprimés (Imai et al, 2004).
- 79. 46 Enfin, dans uneétude réalisée par Durst et ses collègues, le lien entre les HDACs et Runx1 a été clairement défini. Grâce à des expériences de co-transfection des HDACs et de Runx1 dans les cellules Cos7, des interactions directes et fortes ont été montrées entre Runx1 et les HDACs 1, 3 et 9 et des interactions plus faibles ont été observées pour les HDACs 2, 5 et 6 (Durst et al, 2003). Ces données suggèrent que les HDACs pourraient interagir avec Runx1 indépendamment de mSin3. III.2.3 HMTs L’interaction de Runx1 avec les HMTs a été découverte après les co-répresseurs précédemment énoncés. En particulier, l’histone méthyltransférase Suv39H1 est associée à la répression épigénétique des gènes cibles de Runx1. Dans leur étude, les auteurs montrent pour la première fois que Runx1 interagit directement avec Suv39h1 in vitro et in vivo, grâce à son domaine runt (Chakraborty et al, 2003). Logiquement, les auteurs remarquent que cette interaction diminue l’affinité de Runx1 pour l’ADN. Une autre étude confirme ces résultats en montrant en plus que Suv39H1, HDAC1 et HDAC3 interagissent avec Runx1 au niveau des mêmes motifs de Runx1 (Reed-Inderbitzin et al, 2006). III.3 Régulation de la formation du dimère fonctionnel CBF par la localisation subcellulaire des sous-unités Runx1 et CBFβ De manière intéressante, bien que fonctionnant ensemble, Runx et CBFβ ne se situent pas dans le même compartiment subcellulaire. En effet, Runx est nucléaire alors que CBFβ est majoritairement cytoplasmique. Les localisations distinctes de CBFβ et Runx constituent un moyen de régulation de la formation de l’hétérodimère CBF actif, et donc un contrôle supplémentaire pour l’activité de CBF. Lu et ses collègues ont testé la localisation de CBFβ en fonction des mutants de Runx2 surexprimés dans les cellules NIH 3T3 (Lu et al, 1995). Lorsque CBFβ et Runx2 sont co- tranfectés, leur localisation est respectivement cytoplasmique et nucléaire. En revanche, un mutant de Runx2 tronqué dans sa partie amino-terminale (94-513), co-transfecté avec CBFβ, entraîne une localisation nucléaire de CBFβ. Ceci suggère que la partie N-terminale de Runx2 empêche la libre association de CBFβ et Runx2, certainement via le NRHn comme il est décrit dans la section précédente, et implique également que l’association passive de CBFβ avec Runx2 suffirait à sa translocation dans le noyau. Un autre mutant de Runx2, tronqué dans sa partie C-terminale, Runx2 (1-224), induit la même colocalisation (Lu et al, 1995). In vivo, la régulation de l’association de la sous-unité Runx avec CBFβ est certainement un
- 80. 47 mécanisme de contrôlede l’activité de transcription du dimère Runx-CBFβ, puisque la protéine Runx seule ne lie que faiblement l’ADN. Une autre étude apporte des précisions sur la localisation cytoplasmique de CBFβ. Dans le muscle squelettique, CBFβ colocalise avec l’α-actinine sur les lignes Z des les myotubes du muscle squelettique montrant ainsi une affinité de CBFβ avec les structures du cytoplasme (Chiba et al, 1997). À partir de cette étude, le groupe de M. Satake a approfondi la localisation de CBFβ dans le cytoplasme. Leur étude montre que CBFβ colocalise avec l’actine-F sur les fibres de stress qui s’étendent dans l’axe le plus long de la cellule et qui logent leurs extrémités dans la membrane cellulaire (Tanaka et al, 1997). Dans le cytoplasme, Yoshida et ses collègues ont montré que CBFβ interagissait avec la filamine A (Yoshida et al, 2005), qui est une protéine qui réticule l’actine corticale. Le domaine de CBFβ responsable de sa localisation cytoplasmique est donc a priori celui qui est responsable de son interaction avec les filamines. Ce domaine est localisé au niveau des résidus 68 à 93 (numérotation sur la protéine CBFβ murine). De plus, dans les cellules déficientes en filamine A, CBFβ est localisé au noyau. Les auteurs montrent de manière très intéressante que lorsqu’on force la localisation de CBFβ dans le noyau (en absence de filamine A), le niveau protéique de Runx1 est nettement augmenté. De fait, la stabilisation du niveau protéique de Runx1 dans la cellule n’est pas dépendante du niveau protéique de CBFβ dans la cellule, mais est strictement dépendante de la quantité de CBFβ transloqué dans le noyau. Ceci met en évidence l’importance de la localisation des deux sous-unités dans la régulation de l’activité du facteur hétérodimérique CBF (Yoshida et al, 2005). IV. CBF DANS LE CONTROLE DE L’EQUILIBRE PROLIFERATION- DIFFERENCIATION IV.1 Régulation croisée entre CBF et les régulateurs du cycle cellulaire IV.1.1 CBF accélère la phase G1 et stimule l’entrée en phase S Il y a de plus en plus de données montrant que Runx1 régule la prolifération cellulaire directement. Sa capacité à promouvoir la prolifération cellulaire dans différents systèmes est cohérente avec son activité oncogénique. Par exemple, la surexpression de Runx1-P2 (AML1b) dans les fibroblastes 3T3 permet la transformation des cellules in vitro et la formation de tumeur chez les souris nude (Kurokawa et al, 1996).
- 81. 48 Plusieurs données suggèrentque Runx1 régule la transition G1/S du cycle cellulaire. Une des premières études à ce sujet concerne l’étude de la protéine chimère CBFβ-SMMHC composée des 165 acides aminés C-terminaux de la protéine CBFβ (soit pratiquement l’intégralité de la protéine native) fusionnée à la partie C-terminale de la chaîne lourde la myosine du muscle lisse (SMMHC). Cette protéine de fusion CBFβ-SMMHC est une oncoprotéine retrouvée dans les leucémies myeloïdes capable de séquestrer Runx1 par multimérisation grâce au domaine SMMHC, et a une fonction inhibitrice sur le cycle cellulaire (Kummalue et al, 2002; Liu et al, 1993). De plus, lorsque l’on génère des souris knock-in où le gène CBFb est remplacé par CBFβ-SMMHC, on obtient un phénotype similaire à celui des souris CBFb-/- , montrant que la protéine de fusion CBFβ-SMMHC est un dominant négatif. Ceci suggère que la protéine native CBFβ pourrait au contraire avoir une fonction positive dans la régulation du cycle cellulaire (Cao et al, 1997). Une seconde étude est allée plus loin en montrant que dans les cellules myéloïdes ou lymphoïdes, l’augmentation de CBFβ-SMMHC inhibe la transition G1/S et la quantité de Rb hypophosphorylé (actif) est augmentée (Xia et al, 2007). De manière intéressante, la surexpression de la protéine Runx1 contrecarre l’effet inhibiteur de CBFβ-SMMHC sur le cycle cellulaire et cet effet n’est pas dépendant du domaine d’interaction de Runx1 avec TLE. En revanche, les mutants de Runx1, dans lesquels un ou les deux domaines de transactivation ont été délétés, ne compensent pas l’effet inhibiteur de CBFβ-SMMHC, au contraire, ils renforcent l’inhibition de l’entrée en phase S en synergie avec CBFβ-SMMHC (Lou et al, 2000). La sous-unité Runx1 est donc impliquée dans la régulation du cycle cellulaire. Lorsque Runx1-P2 (AML1b) humain est exprimé dans les cellules 32D.3 (cellules de moelle osseuse de souris) l’entrée en phase S est accélérée. Il avait déjà été montré que Runx1-P2 est transformant lorsqu’il est exprimé dans les fibroblastes grâce à son domaine de régulation de la transcription en C-terminal (Strom et al, 2000). Le phénotype observé est similaire à celui obtenu lorsqu’on surexprime les cyclines -D (Quelle et al, 1993) ou -E dans ces mêmes cellules. Runx1-P2 est finalement le premier facteur de transcription à qui l’on prête un rôle dans le cycle cellulaire (Strom et al, 2000). À noter que contrairement à E2F qui stimule l’entrée en phase S sans l’aide de signaux coopératifs, comme l’expression de cytokines comme l’interleukine 3 (IL-3), Runx1-P2 nécessite la présence de l’IL-3 pour accélérer la phase G1 du cycle cellulaire. IV.1.2 Régulations croisées entre les régulateurs du cycle cellulaire et Runx1 Trois sites consensus (S/T)PX(R/K) reconnus pour la phosphorylation par les complexes cyclines/Cdks ont été identifiés sur Runx1 : S48, S303 et S424. Les Cdk 1 et 6 phosphorylent
- 82. 49 les résidus deRunx1 dans les cellules hématopoïétiques et la mutation de ces résidus sérines en acides aspartiques (mimant des résidus constitutivement phosphorylés) augmente l’activité de Runx1 (Zhang et al, 2008). Dans les cellules Ba/F3, le triple mutant de Runx1 où les trois sérines Ser48, Ser303 et Ser424 sont remplacées par des acides aspartiques contrecarre l’effet inhibiteur sur la prolifération de CBFβ/SMMHC exprimé dans ces cellules (Zhang et al, 2008). Etonnament, la mutation de ces sérines en alanines augmente également l’affinité pour l’ADN, suggérant que la phosphorylation de Runx1 par les Cdks n’est pas déterminante pour l’activité de liaison à l’ADN de Runx1 (Zhang et al, 2008). Un rôle possible de cette phosphorylation serait plutôt de réguler le taux de Runx1 dans la cellule. En effet, la phosphorylation de S303 induit la dégradation de Runx1 pendant la phase G2/M par le APC (anaphase promoting complex) (Biggs et al, 2006; Biggs et al, 2005; Wang et al, 2007). De manière intéressante, le niveau protéique de Runx1 est régulé au cours du cycle cellulaire, mais le niveau de son ARN messager reste constant. Notamment, la protéine Runx1 est augmentée de 2 à 4 fois en phase S et en G2/M par rapport à la phase G1 et le niveau de liaison à l’ADN du facteur CBF est augmenté lui aussi en même temps que le niveau protéique de Runx1 (Bernardin-Fried et al, 2004). Pour vérifier si cette stabilisation est induite par CBFβ, il serait intéressant de regarder si la localisation de CBFβ (qui est majoritairement cytoplasmique) augmente dans le noyau pendant les phases S et G2/M, au moment où la protéine Runx1 est stabilisée. Inversement, le traitement des cellules par un agent bloquant en phase G1, entraîne en même temps une diminution du niveau protéique de Runx1. La variation de Runx1 endogène au cours du cycle cellulaire correspond en fait à la variation de la stabilisation de Runx1 (Bernardin-Fried et al, 2004). La surexpression de Runx1-P2 dans les cellules myéloïdes accélère l’entrée en phase S en induisant l’expression de Cdk2, Cdk4 et également des cyclines D1 et D2. En fait, des sites de fixation de Runx1 ont été retrouvés sur le promoteur murin de la cycline D2, suggérant un mécanisme direct d’activation de l’expression de cette cycline (Strom et al, 2000). Ce promoteur est également activé par Runx1-P2 dans les cellules Cos7 de singe. Inversement, l’expression de CBFβ-SMMHC ou KRAB-Runx1, deux oncoprotéines chimères formées à partir de CBFβ ou Runx1 et agissant comme des dominants négatifs, et bloquent le passage G1/S en induisant une réduction du transcrit de Cdk4 dans les cellules Ba/F3 (Lou et al, 2000). De manière intéressante, Runx1 possède également un site de fixation sur le promoteur murin de la cycline D3 et active son expression dans la lignée de lymphocytes B murins Ba/F3
- 83. 50 (Peterson et al,2005). Une étude montre que lorsqu’elle est exprimée dans les cellules 293T, la protéine cycline D3 est capable d’entrer en compétition avec CBFβ pour interagir avec Runx1 via son domaine runt et le domaine comprenant les résidus de 213 à 395. Cette interaction diminuerait l’interaction de CBF avec l’ADN. La cycline D3 exercerait ainsi un rétrocontrôle négatif de l’activité de Runx1 sur la prolifération. Un des mécanismes décrit pour expliquer cette observation est la capacité de la cycline D3 à déplacer l’interaction Runx1-CBFβ pour former le dimère Runx1-cycline D3. Cette observation est également vraie pour les cyclines -D1 et -D2, capables elles-aussi d’interagir directement avec Runx1 et déplaçant ainsi l’interaction entre Runx1 et CBFβ (Peterson et al, 2005). L’ensemble des cyclines D interviennent donc pour moduler négativement l’activité de Runx1 dans les cellules en prolifération. La régulation des CKIs par Runx1 peut être négative ou positive selon le type cellulaire. Par exemple le promoteur du gène p21WAF1/CIP1 contient de multiples sites de fixation de Runx1 et dans les fibroblastes murins NIH3T3, Runx1-P2 réprime dix fois le promoteur de p21WAF1/CIP1 (Lutterbach et al, 2000). Ensemble, le fait que Runx1 puisse activer la transcription de Cdk4 et de la cycline D3 et par ailleurs puisse réprimer la transcription de p21WAF1/CIP1 , contribue à la stimulation de la prolifération (Bernardin-Fried et al, 2004; Lutterbach et al, 2000; Petrovick et al, 1998). IV.2 CBF et l’équilibre prolifération-différenciation Runx1 régule le cycle cellulaire, mais en même temps est nécessaire à la différenciation des tissus dans lesquels la protéine est exprimée, comme par exemple la différenciation hématopoïétique définitive. De ce fait, il est probable qu’en plus de leur rôle comme inducteur de la différenciation, les protéines Runx de mammifères soient nécessaires pour stimuler et/ou maintenir la prolifération des cellules précurseurs dans lesquelles elles sont exprimées. Allant de pair avec ce rôle, les protéines Runx interagissent avec les effecteurs nucléaires SMADs de la voie de signalisation TGFβ/BMP (Hanai et al, 1999; Ito & Miyazono, 2003; Zaidi et al, 2002), qui contrôlent à la fois la prolifération et la différenciation dans une grande variété de systèmes au cours du développement (Angerer et al, 2000; Ferguson & Anderson, 1992; Xie & Spradling, 1998). De plus, le facteur de transcription TCF/LEF-1 qui est une cible très en aval de la voie de signalisation Wnt, est connu pour être un partenaire d’interaction important de Runx1 (Robertson et al, 2008), notamment pour activer certains gènes cibles tels que TCRβ et IFNβ dans les lymphocytes T (Carey, 1998; Giese et al, 1995). La voie de signalisation Wnt est une autre voie commune impliquée dans
- 84. 51 diverses réponses biologiquescomme la prolifération et la différenciation, plaçant encore une fois Runx1 en lien avec des grandes voies de signalisation impliquées dans le développement et au cœur du destin cellulaire. Initialement, Runx1 et CBFβ étaient connus pour leur implication dans les leucémies, où ils sont sujets à des translocations multiples et génèrent des protéines Runx1 et CBFβ tronquées et fusionnées à d’autres protéines (Michaud et al, 2003). Le rôle du facteur CBF a été également très étudié dans l’hématopoïèse puisque les expériences d’inactivations géniques de Runx1 et CBFβ compromettent l’hématopoïèse définitive chez la souris (Niki et al, 1997; Okada et al, 1998; Wang et al, 1996a). Cependant, aujourd’hui Runx1/CBFβ s’imposent comme des régulateurs clés du destin cellulaire, et notamment à l’interface de la prolifération et de la différenciation dans de nombreux systèmes cellulaires. Par exemple, dans le système nerveux des mammifères, Runx1 est nécessaire pour maintenir la prolifération des précurseurs des neurones portant les récepteurs olfactifs (ORN). L’absence de Runx1 dans ces cellules induit une sortie du cycle et elles se différencient prématurément. Le fait que les progéniteurs neuronaux se différencient prématurément en absence de Runx1 pourrait signifier que Runx1 agit pour prévenir la différenciation cellulaire en plus de, ou à la place de, son rôle dans la stimulation de la prolifération. Cependant, l’expression exogène de Runx1 dans des cultures primaires de cellules progénitrices neurales corticales augmente le nombre de cellules en prolifération, sans pour autant bloquer leur capacité à se différencier, produisant ainsi un grand réservoir de cellules progénitrices (Theriault et al, 2005). Vu que la différenciation se déroule normalement quand Runx1 est surexprimé dans ces cellules, il semblerait que la différenciation prématurée de Runx1 dans les précurseurs ORN soit due à un effet indirect résultant de l’échec de ces cellules à proliférer. De manière intéressante, p21WAF1/CIP1 est réprimé dans les cellules progénitrices neurales corticales surexprimant Runx1 (Theriault et al, 2005), montrant que Runx1 favoriserait la progression cellulaire en réprimant p21WAF1/CIP1 . D’autres études mettent en évidence le rôle de Runx1 et CBFβ dans la stimulation de la prolifération chez C. elegans. Les auteurs montrent que des mutations de Rnt-1 (l’homologue de Runx1) interfère avec la division des cellules « souches » de C. elegans et résulte en un nombre réduit de cellules aux stades larvaires (Nam et al, 2002; Nimmo et al, 2005). Au contraire, la surexpression de rnt-1 stimule fortement la prolifération et donne des cycles de division supplémentaires (Nimmo et al, 2005), indiquant clairement la fonction de Rnt-1 dans la prolifération cellulaire pendant le développement larvaire de C. elegans. De manière
- 85. 52 intéressante, Xia etses collègues montrent que CBFβ est également impliqué dans la prolifération cellulaire chez C. elegans, mais aussi dans la spécification de ces cellules souches (Xia et al, 2007). Un dernier exemple du rôle de Runx1 à l’interface entre prolifération et différenciation concerne la structure du cheveu et du follicule pileux. Dans ce travail, les auteurs examinent la fonction de Runx1 dans le follicule pileux et montrent que Runx1 est important pour la prolifération du cheveu dans la peau adulte. Les souris qui expriment une protéine Runx1 non-fonctionnelle dans les cellules épithéliales de la peau, présentent un déficit de la prolifération des kératinocytes in vitro et l’expression de facteurs régulant la quiescence du cycle du cheveu sont dérégulés (Osorio et al, 2008).
- 86. 53 Présentation du Projet de Recherche Contexte En2005, le Dr Slimane AIT-SI-ALI m’a proposé un projet de recherche qui avait pour but d’étudier l’équilibre prolifération-différenciation. Pour étudier cet équilibre, il s’appuie sur un modèle de choix très bien décrit dans la littérature et dont le laboratoire est expert : le muscle squelettique. Dans ce système cellulaire, la prolifération et la différenciation sont mutuellement exclusives et la différenciation terminale est orchestrée par le facteur myogénique MyoD. MyoD est décrit comme le « Master Switch » de la différenciation musculaire car il orchestre à la fois la sortie du cycle prolifératif et l’activation des gènes spécifiques du muscle. Pour approfondir et mieux comprendre comment MyoD régule l’équilibre prolifération-différenciation dans les myoblastes, le laboratoire a choisi une stratégie pragmatique qui mettait en jeu des approches différentes mais complémentaires : (i) identification exhaustive des partenaires de MyoD par spectrométrie de masse, (ii) validation fonctionnelle de ces partenaires avec une banque de petits ARN interférants, (iii) étude de la force transactivatrice de MyoD dans des lignées non-musculaires, (iv) identification des gènes cibles de MyoD et enfin (v) caractérisation des modifications épigénétiques associées à l’activation des gènes cibles de MyoD. En mai 2006, j’ai amorcé mon projet de thèse en purifiant MyoD doublement étiquetté Flag et HA dans une lignée HeLa où il était exprimé ectopiquement. Après une purification biochimique par double affinité en tandem de MyoD, les partenaires protéiques ont été analysés par spectrométrie de masse. De cette manière, j’ai identifié pour la première fois les protéines CBFβ et Runx1 au sein du complexe MyoD. Ces dernières années, dans la période même où je conduisais ce projet, de nombreuses nouvelles études ont accordé à Runx1 et CBFβ un rôle beaucoup plus étendu que celui majoritairement étudié jusqu’à maintenant. Au départ essentiellement étudiés pour leur
- 87. 54 implication dans lesleucémies myéloïdes aiguës et l’hématopoïese définitive, Runx1 et CBFβ s’imposent aujourd’hui par des fonctions variées au cours du développement, dans lesquelles leurs rôles se trouvent souvent à l’interface de la prolifération et de la différenciation. Runx1 et CBFβ sont ainsi des candidats particulièrement intéressants pour leur rôle potentiel, de concert avec MyoD, pour réguler l’équilibre prolifération-différenciation dans les myoblastes. Problématique J’ai ainsi posé mon hypothèse principale de travail: « Caractériser la fonction de Runx1/CBFβ, en coopération avec MyoD, dans l’équilibre prolifération-différenciation du muscle squelettique » Cet objectif était doublement intéressant car MyoD et Runx1 sont tous deux décrits au coeur de l’équilibre prolifération-différenciation dans leurs systèmes cellulaires respectifs, avec apparemment pour chacun d’eux un effet dose de la protéine dans la cellule. Ce rôle pivot entre différenciation et prolifération permet d’imaginer ces deux protéines « travaillant » ensemble pour contrôler le destin cellulaire- a fortiori de la cellule musculaire dans cette étude. En étudiant Runx1, et MyoD, tous deux décrits dans des systèmes de différenciation et régulant en partie certaines protéines de cycle cellulaire, le but était d’étudier les deux étapes discrètes de la différenciation musculaire, c’est-à-dire le contrôle de la sortie du cycle prolifératif et l’engagement de la cellule dans la voie de différenciation musculaire terminale.
- 88.
- 89. 55 Article de Recherche The CoreBinding Factor CBF Negatively Regulates Skeletal Muscle Terminal Differentiation PHILIPOT Ophelie and AIT-SI-ALI Slimane* UMR 7216 “Epigénétique et Destin Cellulaire”, Centre National de la Recherche Scientifique (CNRS), Université Paris-Diderot, 35 rue Hélène Brion, F-75013 Paris, France. *: Corresponding author email: slimane.aitsiali@univ-paris-diderot.fr phone: (33)-1-5727-8919 fax: (33)-1-1-5727-8910
- 90. 56 Dans cet article,je présente mes travaux de recherche sur le rôle de Runx1 et CBFβ au cours de la différenciation musculaire terminale, de concert avec MyoD. La stratégie d’étude choisie pour étudier la fonction potentielle de Runx1/CBFβ dans le muscle s’est articulée autour de deux axes. Tout d’abord, j’ai caractérisé l’interaction de Runx1/CBFβ avec MyoD : • Au niveau endogène dans des myoblastes immortalisés, puis dans des myoblastes primaires. • En regardant si cette interaction était directe ou non par GST pull-down et par une combinatoire de transfection transitoire. • En regardant si cette interaction était dépendante de la chromatine. Puis j’ai validé fonctionnellement la relevance biologique de cette interaction dans les myoblastes : • Par gain-de-fonction, en surexprimant CBFβ dans les myoblastes C2C12 ; • Par perte-de-fonction, en utilisant l’ARN interférence (ARNi) contre Runx1 et CBFβ dans les myoblastes C2C12 et les myoblastes primaires. Cette étude montre que l’interaction de MyoD avec Runx1 est directe in vitro et CBFβ n’est co-précipité avec MyoD qu’en présence de Runx1. De plus, Runx1 et CBFβ s’associent à MyoD et à ses gènes cibles, uniquement dans des conditions de prolifération, c’est-à-dire lorsque MyoD est considéré comme inactif. La cinétique de différenciation terminale des myoblastes C2C12 est dépendante du taux d’expression de CBFβ et Runx1 comme le montrent les expériences de perte et gain de fonction. En effet, lorsque CBFβ est surexprimé, la cinétique de différenciation est inhibée. Inversement lorsque Runx1 ou CBFβ sont diminués par ARNi, la cinétique de différenciation est considérablement favorisée. De manière intéressante, Runx1/CBFβ semble agir à l’interface prolifération-différenciation. En effet, la forte expression des marqueurs de différenciation musculaire dans les expériences de perte-de-fonction de Runx1 ou CBFβ, est corrélée à une sortie du cycle cellulaire précoce et une diminution des régulateurs du cycle. Finalement, cette étude propose un nouveau rôle pour Runx1/CBFβ en l’impliquant comme régulateur négatif de la différenciation musculaire terminale.
- 91. The Core BindingFactor CBF Negatively Regulates Skeletal Muscle Terminal Differentiation PHILIPOT Ophelie and AIT-SI-ALI Slimane* UMR7216 Epigénétique et Destin Cellulaire, Centre National de la Recherche Scientifique (CNRS), Université Paris-Diderot, 35 rue Hélène Brion, 75013 Paris, France. Previous address: Institut André Lwoff, CNRS, FRE2944, 7 rue Guy Moquet, 94800 Villejuif; Université Paris-Sud, France Tel: (33)-1-5727-8919, Fax: (33)-1-1-5727-8910 *: Corresponding author, email: slimane.aitsiali@univ-paris-diderot.fr, Running title: CBF in muscle diffeentiation ABSTRACT Core Binding Factor or CBF is a transcription factor composed of two subunits, Runx1/AML-1 and CBF beta or CBFβ. CBF was originally described as a regulator of hematopoiesis. Here we show that CBF is involved in the control of skeletal muscle terminal differentiation. Indeed, downregulation of either Runx1 or CBFβ protein level accelerates cell cycle exit and muscle terminal differentiation. Conversely, overexpression of CBFβ in myoblasts slows terminal differentiation. CBF interacts directly with the master myogenic transcription factor MyoD in proliferating but not in differentiating myoblasts. The MyoD/CBF complex contains several chromatin modifying enzymes that inhibits MyoD activity, such as HDACs. When overexpressed, CBFβ induced an inhibition of histone H3 acetylation at MyoD target promoters. Finally, we show a preferential recruitment of Runx1 protein on MyoD target genes in proliferating myoblasts. Taken together, our data show a new role for Runx1 and CBFβ in the control of the proliferation/differentiation in skeletal myoblasts. Keywords: Differentiation, proliferation, muscle, MyoD, Runx1/CBFβ INTRODUCTION Runx1 (for Runt-related factor, also known as AML1 for Acute Myeloid Leukemia 1, CBFA2 or PEPB2aB) belongs to a family of highly homologous heterodimeric transcription factors named Core Binding Factors or CBF (reviewed in: [1]). To be fully functional as a transcription regulator, DNA binding subunit Runx1 must dimerize with its cofactor CBF- beta (CBFb, a non-DNA-binding subunit that is expressed in a ubiquitous manner [2] Runx1 was originally identified at a breakpoint on human chromosome 21 in the t(8;21) translocation, known as the most common target of chromosomal translocations in human leukemia [3,4]. Genetic studies showed that Runx1 is essential in the developing murine embryo for definitive hematopoiesis of all lineages [5,6]. There is now strong evidence that Runx proteins are also important for differentiation of multiple cell types, including osteoblasts [7], neurons [8,9], hematopoietic cells of all lineages [5,6,10] and skin epidermis and hair follicle stem cells [11,12]. Runx1 is also involved in promoting senescence in primary mouse fibroblasts [13], and in cell cycle regulation [14-16]. Runx proteins have the potential to either activate or repress transcription in a context dependent manner. Runx1 seems to promote proliferation in progenitor cells, whereas in differentiating cells it cooperates with tissue- specific transcription factors to regulate tissue- specific gene expression. For example, Runx1 cooperates with C/EBPα and C/EBPβ to regulate hematopoiesis and osteogenesis, respectively [17,18]. The dual role of Runx1 in regulating proliferation and differentiation could depend on differential interactions with protein partners, specific for each stage of cell development. The molecular mechanisms underlying such a switch in Runx1 function remain however to be deciphered. Runx1 and CBFβ have also been linked to skeletal muscle differentiation [19-21], and prevention of muscle wasting [20]. In skeletal muscle, proliferation and differentiation are
- 92. mutually exclusive. Indeed,skeletal muscle terminal differentiation begins with an irreversible withdrawal from the cell cycle, followed by muscle-specific marker expression [22]. Irreversible cell cycle exit involves a definitive silencing of proliferation-associated genes (reviewed in [23] and references therein). Terminal muscle differentiation is orchestrated by myogenic bHLH transcription factors, such as MyoD and Myf5, two master myogenic determination factors. MyoD is expressed in proliferating myoblasts, but is unable to activate its target genes even when bound to their promoters [24,25]. MyoD therefore has a repressive role at its target genes prior to initiating chromatin remodeling in differentiating cells [24,26,27]. In proliferating myoblasts, MyoD is associated with histone deacetylases (HDACs), the histone methyltransferase Suv39h1 and heterochromatin protein HP1, and might actively inhibit expression of its target genes by inducing a local repressive chromatin structure [24,28,29]. Here we show that CBF associates with MyoD only in proliferating myoblasts, and knockdown of Runx1 or CBFβ accelerates cell cycle exit and terminal differentiation. Conversely, overexpression of CBF slows cell cycle exit and delays muscle differentiation. In proliferating myoblasts, the MyoD/CBF complex contains several chromatin modifying enzymes such as HDACs. In agreement with this, when overexpressed, CBFβ maintains histone H3 deacetylated on MyoD target promoters even in differentiation conditions. Finally, Runx1 is recruited to MyoD target genes only in proliferating myoblasts, when these genes are repressed. Altogether, our data suggest that CBF transcription factor plays a pivotal role as a negative regulator of skeletal muscle terminal differentiation. RESULTS CBF subunits, Runx1 and CBFβ, interact with MyoD in proliferating myoblasts In an attempt to charaterize MyoD protein partners, we carried out double-affinity purification of HA-Flag MyoD stably expressed in HeLa cells (see purification scheme on Supplementary Figure 1). MyoD protein complex composition was then analyzed by mass spectrometry (MS) and western blot (WB). MS analysis of the purified protein complex revealed some already known partners of MyoD (Supplementary Figure 2), such as Id, Pbx1, PC4 and E12/E47, and new partners that had never been described to interact with MyoD. Indeed, MS analysis unveiled CBFβ protein within MyoD complex with a high number of peptides, covering almost 20% of its protein mass and amino acids content (Figure 1A). WB analyses confirmed that result and showed that Runx1 also copurified with MyoD (Figure 1B). We then performed a complementary experiment by transfecting HA-tagged MyoD and/or HA-tagged Runx1 into HeLa cells stably expressing Flag-HA-CBFβ (ectopic, eCBFβ). We showed that, indeed, MyoD co- precipitated with eCBFβ (Figure 1C). Moreover, the simultaneous co-transfection of HA-tagged Runx1 resulted in its co- precipitation with CBFβ and, more importantly, increased the MyoD-CBFβ co- precipitation (Figure 1C). To further investigate the CBF/MyoD interaction, we turned to myogenic cells: the murine myolastic cell line C2C12. Both CBFβ and Runx1 are expressed in the C2C12 myoblasts and their protein level do not vary significantly during differentiation (Supplementary Figure 3). We found that MyoD and CBFβ co-precipitated preferentially in proliferating compared to differentiating C2C12 myoblasts (Figure 1D). To assay whether MyoD has the ability to interact directly with CBF, we performed GST pull-down experiments, which showed that GST-MyoD strongly interacts with Runx1 (Figure 1E, lane 4), but not with CBFβ (Figure 1E, lane 5). The interaction of MyoD with Runx1 was specific; we did not detect any Runx1 signal in the presence of GST protein alone (Figure 1E, lane 8) nor any luciferase signal with GST-MyoD (Figure 1E, lane 7). Interestingly, GST-MyoD interacts with CBFβ only in the presence of Runx1 (Figure 1E, compare lanes 5 and 6), in agreement with our previous findings (Figure 1C). These results show that MyoD interacts directly with heterodimeric transcription factor CBF, via the Runx1 subunit.
- 93. CBF negatively regulatescell cycle exit and terminal differentiation in skeletal myoblasts We used siRNAs to decrease Runx1 level in order to investigate its role in differentiating myoblasts (Figure 2A, see Runx1 quantification). Downregulation of Runx1 resulted in a more efficient differentiation (Figure 2A); both the expression of muscle markers and the proportion of multinucleated cells were higher in Runx1-depleted cells (Figure 2A and Supplementary Figure 4A). In particular, myogenin and MCK (Muscle Creatine Kinase) were expressed at higher levels, and 24 hours earlier, in Runx1-depleted cells (Figure 2A). Interestingly, cyclin D1 level decreased more rapidly when Runx1 is downregulated (Figure 2A). Similarly, CBFβ downregulation induced a more rapid decrease in cyclin D1 and an accelerated differentiation (Figure 2B). Indeed, we could detect MCK expression in CBFβ-depleted myoblasts as soon as 24 h after the induction of differentiation (Figure 2B). These cells moreover exhibited larger myotubes (Supplementary Figure 4B). We confirmed these results in primary myoblasts (Figure 2C). In agreement with our previous results, we have found that Runx1 or CBFβ downregulation led to a significant decrease of S-phase cells proportion concomitant with an increase in G1-phase cells (Figure 2D). This suggests that CBF positively regulates myoblasts proliferation. To complete our analysis, we studied the effect of CBFβ overexpression on terminal differentiation. Overexpression of CBFβ in C2C12 myoblasts (C2C12-CBFβ) was well tolerated and did not lead to morphological abnormality. However, in differentiation conditions, C2C12-CBFβ cells showed a delay in cell cycle exit, as measured by cyclin D1 level that decreased with a 24 to 48 h delay compared to control cells (Figure 2E). This delayed cell cycle exit correlated with delayed expression of muscle markers such as myogenin (48 h delay), MCK (24 h delay), and MHC (Myosin Heavy Chain, not detected at 120 h) (Figure 2E). In contrast to control cells, C2C12-CBFβ cells exhibited smaller and mainly mononucleated myotubes (Supplementary Figure 5) with low expression of MCK and MHC (Figure 2F) in differentiation conditions. This suggests that differentiation kinetics was not completely impaired but greatly delayed when CBFβ was overexpressed. Altogether, these results suggest that CBF plays a dual role during skeletal muscle differentiation by regulating cell cycle withdrawal and expression of muscle markers. CBF transcription factor is located to MyoD early target genes and regulates negatively their expression The fact that CBF is a transcription factor, and that CBF interacts with MyoD preferentialy in proliferation conditions, led us to investigate whether it would be targeted to MyoD target genes to repress their transcription. Using an in silico approach, we first found that on early target gene promoters of MyoD, Runx1- and MyoD- binding sites were adjacent (Supplementary Figure 6A). In order to test the effective recruitment of Runx1 onto MyoD target promoters, we performed ChIP experiments. Our results showed a preferential enrichment in Runx1 on myogenin, p21 and cycD3 promoters in proliferating compared to differentiating myoblasts (Figure 3A). These MyoD target genes are expressed early in differentiating but not in proliferating myoblasts (Supplementary Figure 6B). Our ChIP assays showed that Runx1 was not located on late target genes of MyoD, such as Desmin, MHC and MCK (data not shown), while it was on early muscle differentition genes myogenin, p21 and cyD3. In addition, we did not find Runx1 binding sites adjacent to E-boxes on late MyoD target genes’ promoters. These findings suggest that Runx1 would essentially regulate early events of skeletal muscle termianl differentiation. Taken together, our results strongly suggest that Runx could be recruited onto MyoD early target genes to regulate negatively their expression in proliferating myoblasts. To gain insights into the mechanism of action of CBF on MyoD target genes, we purified CBFβ protein complex from proliferating C2C12-CBFβ cells via its Flag tag. As expected, CBFβ copurified with the the myogenic factor MyoD and with its dimerization partner Runx1 (Figure 3B). The other partners that copurified specifically with CBFβ are proteins known to be involved in
- 94. transcriptional repression: thehistone 3 lysine 9 (H3K9) methyltransferase Suv39h1, the heterochromatin protein HP1β, and the histone deacetylases HDACs 1, 2 and 3 (Figure 3B). These proteins are already known partners of Runx1 on the one hand [30], and repressors of MyoD activity on the other hand [31-33]. Given the association of CBFβ with chromatin-modifying enzymes, we studied the chromatin status of three target gene promoters of MyoD in differentiating C2C12-CBFβ using chromatin immunoprecipitation (ChIP). Our results showed that, in contrast to control cells in which histone H3 acetylation (a mark associated with transcription activation) on myogenin, cyclin D3 and p21 promoters increased in differentiation compared with proliferation conditions, histone H3 acetylation levels at these promoters did not vary in C2C12-CBFβ cells (Figure 3C). This result is an agreement with our previous findings showing that CBF associates with chromatin modifying enzymes, such as HDACs, Suv39h1 and HP1β, which are known to repress MyoD activity in proliferating myoblasts. Thus, CBF has an effect on the chromatin structure of three early target genes of MyoD and contibutes to maintain a repressive chromatin state. DISCUSSION Here we show that CBF transcription factor is expressed in proliferating myoblasts where it interacts with MyoD. We found that modulating the expression levels of either of the CBF subunits, Runx1 or CBFβ, impaired cell cycle exit and terminal myogenic differentiation. Runx1 or CBFβ downregulation in myoblasts induced an accelerated cell cycle exit (cyclin D1 protein disappears 24 hours earlier) in differentiation conditions. In addition, Runx1 or CBFβ downregulation led to a an increase in G1-phase cells, suggesting that CBF positively regulates myoblasts proliferation. Conversely, CBFβ overexpression delayed cyclin D1 disappearance even in differentiation conditions (cyclin D1 is still detectable 72 hours after the induction of differentiation), demonstrating a delayed cell cycle exit. Consequently, entry into terminal differentiation was delayed. In agreement with this, our ChIP results showed that in proliferating myoblasts, Runx1 is recruited to repressd p21 and cyclin D3, which encode cell cycle regulators. Together, these results suggest that CBF regulates positively proliferation, and negatively terminal differentiation, of skeletal myoblasts. Thus, CBF impacts on the proliferation/differentiation switch in myoblasts (see model on Figure 4). Our results revealed that such a role for CBF is likely to be partly mediated through interaction with MyoD. Indeed, we provide evidence that CBF is recruited to early MyoD target genes in proliferating myoblasts, where MyoD is mainly associated with transcriptional repressors [24]. This suggests that CBF may serve for assembly of a transcription repression complex at early MyoD target genes such as p21 and cyclin D3. As for example, such a mechanism could be involved in the repression of the skeletal muscle acetylcholine receptor gene, which contains a repressive E-box that mediates its repression in proliferating myoblasts [34]. In agreement with this, we found that in proliferating myoblasts, CBF associates with many chromatin modifying enzymes, such as HDACs (1, 2 and 3), Suv39h1, and HP1β, which are known to repress MyoD activity in proliferating myoblasts [24,31,35,36]; and already known to interact with Runx1 [30,37,38]. We did not succeed to show the concomitant presence of Runx1 and MyoD on MyoD target genes, given that it has reviously been demonstrated that in proliferating conditions, a small fraction of MyoD contributes to the repressive remodeling of its target genes, prior differentiation. Alternatively, Runx1 could prevent the proper binding of MyoD and the recruitment of the transcriptional machinery. Notably, the displacement of Runx1 in differentiating conditions is concomitant with a strong binding of MyoD to its target promoters (data not shown). Our results showed that Runx1 was not located on late target genes of MyoD, while it is recruited into early muscle differentiation genes. This suggests that Runx1 essentially regulates cell cycle exit and early events of skeletal muscle terminal differentiation. Taken together, our results strongly suggest that CBF could be recruited onto early MyoD
- 95. target genes torepress them in proliferating myoblasts. Interestingly, although MyoD is expressed both in proliferating and differentiating cells, we found that the interaction between MyoD and CBF was lost in differentiating cells. In proliferating myoblasts, a fraction of MyoD could be recruited to its target genes where it acts as a transcriptional repressor, until differentiation starts [24]. We showed that overexpression of CBFβ in myoblasts led to stabilization of Runx1 that could more efficiently repress MyoD transactivating activity, which induces a delay in terminal differentiation. In agreement with this, in myoblasts overexpressing CBFβ, histone H3 acetylation (a mark of active transcription) on MyoD target genes is delayed in differentiation conditions. In summary, we propose that CBF transcription factor might participate in recruiting chromatin modifying enzymes to repress MyoD early target genes by locally inducing a repressive chromatin structure. Our data reveal a new critical role of CBF in the regulation of the balance between proliferation and differentiation in skeletal muscle cells. They also demonstrate a new mechanism of repression of differentiation genes in proliferating myoblasts. MATERIALS AND METHODS Cell culture C2C12 (CRL-1772, ATCC, USA) and HeLa S3 cells (CCL-2.2TM , ATCC, USA) were cultured under standard conditions. C2C12 cells and mouse primary myoblasts (described in: [39]), were cultured and differentiated as described in: [39]. Stable cell lines establishment and plasmid construction A HeLa cell line stably expressing MyoD was established with a transgene encoding for full- length MyoD; and HeLa and C2C12 cell lines expressing CBFβ were established with a transgene encoding for full-length CBFβ. The transgenes were tagged with double-HA (Haemagglutinin) and double-FLAG epitopes at the N-terminus as described in [40]. Control cell lines transduced with the empty vector were also established. Murine CBFβ cDNA (a kind gift from Dr Nancy A. Speck) was amplified by PCR with specific primers with protruding restriction sites (fw-Pspx1: CCGCTCGAGCCGCGCGTCGTCCCGGG, rev-Not1: ATTCTATATGCGGCCGCTAACGAAGTTTGAGATC ATCG, and subcloned into the XhoI-NotI sites in the pREV retroviral vector after Pspx1 and Not1 digestion (Pspx1 is compatible with Xho cloning site in the pRev vector) [40,41]. Protein complex purification Flag-HA-MyoD complex purification from HeLa- MyoD cells was performed as described in: [31]. 3 grams of C2C12-CBFβ cell pellet were used to purify tagged CBFβ using a simple-affinity purification method using Flag resin. Preparation of nuclear extracts Cells were scraped in a minimal volume of PBS and centrifuged 2 min at 400 g. The pellet was resuspended in: 20 mM Hepes pH 7, 0.15 mM EDTA, 0.15 mM EGTA, 10 mM KCl, then lysed by addition of NP-40 up to 4.5%. Nuclei were immediately neutralized with addition sucrose buffer (50 mM HEPES pH 7, 0.25 mM EDTA, 10 M KCl, 70% (m/v) sucrose). After centrifugation (5 min, 2000 g), nuclei were suspended in glycerol buffer (10 mM HEPES pH 8, 0.1 mM EDTA, 100 mM NaCl, 25% glycerol) to remove any trace of cytosolic components and centrifuged again. The nuclei were then resuspended in sucrose buffer n°2 (20 mM Tris pH 7.65; 60 mM NaCl; 15 mM KCl; 0.34 M Sucrose) then lysed in a final concentration of 250 mM NaCl using High Salt Buffer (20 mM Tris pH 7.65; 0.2 mM EDTA; 25 % glycerol; 900 mM NaCl; 1.5 mM MgCl2). The lysates were sonicated 3 times for 15s with the BioRuptor (Diagenode, Liège, Belgium) on “High”, then centrifuged 10 min at 13000 rpm to harvest the total nuclear extracts (supernatants). Protein concentration for each sample was estimated with BCA kit (Perbio, Brebières, France). Transient plasmid transfection and Flag-affinity precipitation of Flag-HA-CBFβ For plasmid transfection, 25 µg of pRcCMV-HA- AML1 (kind gift of Dr I. Kitabayashi, Japan), pCMV-HA-MyoD or pRC-CMV backbone were transfected into HeLa-CBFβ cells, using calcium phosphate pH 7.12, and Flag IPs was performed 24 h post-transfection (results presented on Figure 1C). Each IP was performed with 1.5 mg of total nuclear extracts and with 25 µL stock of ssDNA and BSA- pre-blocked Agarose Flag M2 resin from Sigma. IP was performed on wheel overnight at 4 °C. Resin was then washed 5 times with TEGN buffer (20 mM Tris pH 7.65; 0.1 mM EDTA; 10 % glycerol; 150 mM NaCl; 0.5 % NP-40) and eluted by competition with high-purity Flag peptide at a final concentration of 0.2 mg/ml. The resin-free eluate was retrieved using Clean-up Post reaction columns (Sigma).
- 96. siRNA transfection siRNAs werepurchased from Sigma (Saint-Quentin Fallavier, France) and were transfected using Hi- Perfect reagent (Qiagen, Courtaboeuf, France) according to the manufacturer recommendations. We usually transfect 0.2 µmol of siRNA per 100 mm cell culture dish. CBFβ targeting siRNA sequences used are: C1: CCGGGAAUAUGUCGACUUA, and C2: UAACUUAGGUGGCGGUGAU; Runx1 siRNA: CUGUGAAUGCUUCUGAUUU; and the scrambled siRNA: ACUUAACCGGCAUACCGGCTT. Immunoprecipitation of endogenous proteins For IP, we usually use 2 µg of antibodies, 10 µL protein A/G Sepharose beads from Perbio and 1.2 mg of nuclear extracts from C2C12 cells, or 0.5 mg from primary myoblasts. Elution was performed with 40 µl of 0.1 M glycine pH 2.5, 15 min at 25 °C, the eluate was recovered using Spin cleaning-up post-reaction column (Sigma). Acidity was neutralized with Tris pH 8.0 before adding loading buffer. Western blotting For western blotting, protein samples were resolved on pre-cast NuPage 4-12% bis-Tris acrylamide gradient SDS-PAGE gel (Invitrogen, Cergy- Pontoise, France). Proteins were then transferred onto nitrocellulose membrane during 1 h at 400 mA in transfer buffer (25 mM Tris, 150 mM Glycine, 0.1 % SDS and 20 % methanol). Membranes are blocked 1 hour in PBS-0.2 % Tween, 10 % skimmed milk and incubated overnight at 4°C with primary antibodies. Membranes were incubated with the appropriate secondary antibodies coupled to HRP and revealed using West Dura from Pierce (Perbio, Brebières, France) and ChemiSmart 5000 system (Vilber Lourmat, Marne-La-Vallée, France). Plasmids, GST fusions and GST pull-down GST and GST-MyoD plasmid constructs were expressed in Escherichia coli strain BL21 and purified using glutathione-sepharose beads according to the manufacturer (Sigma, Saint Quentin-Fallavier, France). Purified proteins were quantified by coomassie staining after SDS–PAGE separation. In vitro transcription and translation (TNT) of pcDNA3-AML1b, pcDNA3-CBFβ and luciferase were performed with Riboprobe in vitro transcription systems (Promega, Charbonnières, France) in the presence of 35 S-labelled methionine. Agarose beads coated with equal amounts of GST or GST-MyoD (1 mg) were incubated with 10 µL of radioactive TNT reaction in reaction buffer (50 mM Tris pH 7.6, 150 mM NaCl, 0.1% Triton) during 2 h at 4°C. Beads were washed 5 times with wash buffer (50 mM Tris pH 7.6, 300 mM NaCl, 0.5 % Triton 100), resuspended and proteins resolved by SDS-PAGE gel and revealed by autoradiography. Immunofluorescence Cells were cultured in Labtecks permanox (Falcon) and fixed briefly with 4% formaldehyde in PBS. Residual formaldehyde was neutralized with 0.1 M Glycine pH 8.0, and washed with PBS. Cells were permeabilized and blocked using 1 % BSA, 1 % goat serum, 0.3 % Triton-X100 in PBS. Primary and secondary antibodies were diluted in the permeabilizing/blocking solution and were washed with 0.3% Triton-X100 in PBS. Nuclei are stained with DAPI and the glass lid is fixed using an anti- fading polymerizing media from DakoCytomation (Dako, Trappes, France). Antibodies The C-20 anti-MyoD, M-225 anti-myogenin, C-20 anti-Myf5, FL-182 anti-CBFβ normal rabbit IgG antibodies were purchased from Santa Cruz Biotech (Santa Cruz, CA, USA). Rabbit polyclonal anti- Suv39h1 antibody (ref. 07-550), and rabbit anti- acetyl histone H3 (ref. 06-599) were obtained from Upstate Biotech (Lake Placid, NY, USA). Anti- HP1β (1MOD1A9AS) was from Euromedex (Souffelweyersheim, France). Rabbit polyclonal anti-MCK antibody was developed by Dr H. Ito [42]. Anti-Flag and anti-α-tubulin antibodies were purchased from Sigma (Saint-Quentin Fallavier, France). Rat anti-HA antibody was purchased from Roche (Meylan, France). Mouse anti-AML1 antibody (MAB10062) was purchased from Millipore (Saint Quentin en Yvelines, France) and mouse anti-HDAC3 antibody (611125) from BD Biosciences (Le Pont de Claix, France). Goat anti- rat IgG Alexa-488-conjugated, anti-rabbit IgG Alexa-488 were from Invitrogen (Cergy-Pontoise, France) and anti-mouse IgG TRITC (T7657) were from Sigma (Saint-Quentin Fallavier, France). FACS analysis C2C12 were transfected with the siRNAs as indicated in the Material and Method section. 48 hours post-transfection, cells were washed with PBS, then scraped in 500 µL of PBS. Cells were kept on ice while 4,5 mL of ethanol 70% were added. Then cells are kept at least overnight at - 20°C. Propidium iodide (PI) staining proceeds as follows: cells are centrifuged and the pellet is washed with PBS. Cells are then centrifuged and resuspended in 2mL PI solution (PI, RNase, Triton 0,1%) 30 minutes and kept in the dark. Cells are homogeneized by vortexing before analysis. We worked on a Beckman and Coulter FACS apparatus and we counted at least 3000 events for each condition. Chromatin immunoprecipitation (ChIP)
- 97. ChIP protocol andprimers have been described in: [39]. The yet unpublished primers used are: Myogenin fw: GAATCACATGTAATCCACGGA, rev: ACGCCAACTGCTGGGTGCCA. Cyclin D3 fw: CTGCTTGCCTCTGTCTTCA; rev: GACCCATGTCAGATGACTC. 36B4 fw: ATGTGCAGCTGATAAAGACTGG; rev: CTGTGATGTCGAGCACTTCAG. ACKNOWLEGEMENTS We thank P. Robin, C. Pellentz, L. Fritsch, A. Polesskaya, and A. Marchand for technical help and critical reading of the manuscript. We thank F. Ferri and C. Guillemin for technical help. We thank C. Francastel, J. Weitzman, F. Hubé, C. Rougeulle, V. Mezger and P-A. Defossez for critical reading of the manuscript. The authors warmly thank Drs N. Speck, G. Mouchiroud, I. Kitabayashi, H. Ito, and L. Delva for sharing reagents. This work was supported by the Association Française contre les Myopathies (AFM); the Fondation Bettencourt-Schueller; the Ligue Nationale contre le Cancer; the Association pour la Recherche sur le Cancer (ARC), the CNRS; and the Université Paris-Sud. PO was recipient of fellowships from the Ministère de la Recherche and the ARC. CONFLICT OF INTEREST None of the authors has any commercial affiliations, consultancies, or equity interests, nor patent-licensing arrangements that could be considered to pose a conflict of interest regarding the submitted manuscript. REFERENCES 1. Mikhail FM, Sinha KK, Saunthararajah Y, Nucifora G (2006) Normal and transforming functions of RUNX1: a perspective. J Cell Physiol 207: 582-593. 2. Wang Q, Stacy T, Miller JD, Lewis AF, Gu TL, et al. (1996) The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87: 697-708. 3. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, et al. (1991) t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad Sci U S A 88: 10431- 10434. 4. Golub TR, Barker GF, Bohlander SK, Hiebert SW, Ward DC, et al. (1995) Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 92: 4917-4921. 5. Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe AH, et al. (1996) Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A 93: 3444-3449. 6. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR (1996) AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84: 321- 330. 7. Komori T, Kishimoto T (1998) Cbfa1 in bone development. Curr Opin Genet Dev 8: 494-499. 8. Chen CL, Broom DC, Liu Y, de Nooij JC, Li Z, et al. (2006) Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain. Neuron 49: 365-377. 9. Theriault FM, Nuthall HN, Dong Z, Lo R, Barnabe-Heider F, et al. (2005) Role for Runx1 in the proliferation and neuronal differentiation of selected progenitor cells in the mammalian nervous system. J Neurosci 25: 2050-2061. 10. Ichikawa M, Asai T, Saito T, Seo S, Yamazaki I, et al. (2004) AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med 10: 299- 304. 11. Raveh E, Cohen S, Levanon D, Negreanu V, Groner Y, et al. (2006) Dynamic expression of Runx1 in skin affects hair structure. Mech Dev 123: 842-850. 12. Osorio KM, Lee SE, McDermitt DJ, Waghmare SK, Zhang YV, et al. (2008) Runx1 modulates developmental, but not injury- driven, hair follicle stem cell activation. Development 135: 1059-1068. 13. Wotton SF, Blyth K, Kilbey A, Jenkins A, Terry A, et al. (2004) RUNX1 transformation of primary embryonic fibroblasts is revealed in the absence of p53. Oncogene 23: 5476-5486. 14. Britos-Bray M, Ramirez M, Cao W, Wang X, Liu PP, et al. (1998) CBFbeta-SMMHC, expressed in M4eo acute myeloid leukemia, reduces p53 induction and slows apoptosis in hematopoietic cells exposed to DNA-damaging agents. Blood 92: 4344-4352. 15. Cao W, Adya N, Britos-Bray M, Liu PP, Friedman AD (1998) The core binding factor (CBF) alpha interaction domain and
- 98. the smooth musclemyosin heavy chain (SMMHC) segment of CBFbeta-SMMHC are both required to slow cell proliferation. J Biol Chem 273: 31534-31540. 16. Zhang L, Fried FB, Guo H, Friedman AD (2008) Cyclin-dependent kinase phosphorylation of RUNX1/AML1 on 3 sites increases transactivation potency and stimulates cell proliferation. Blood 111: 1193-1200. 17. Zhang DE, Hohaus S, Voso MT, Chen HM, Smith LT, et al. (1996) Function of PU.1 (Spi-1), C/EBP, and AML1 in early myelopoiesis: regulation of multiple myeloid CSF receptor promoters. Curr Top Microbiol Immunol 211: 137-147. 18. Gutierrez S, Javed A, Tennant DK, van Rees M, Montecino M, et al. (2002) CCAAT/enhancer-binding proteins (C/EBP) beta and delta activate osteocalcin gene transcription and synergize with Runx2 at the C/EBP element to regulate bone-specific expression. J Biol Chem 277: 1316-1323. 19. Gonzalez de Aguilar JL, Niederhauser- Wiederkehr C, Halter B, De Tapia M, Di Scala F, et al. (2008) Gene profiling of skeletal muscle in an amyotrophic lateral sclerosis mouse model. Physiol Genomics 32: 207-218. 20. Wang X, Blagden C, Fan J, Nowak SJ, Taniuchi I, et al. (2005) Runx1 prevents wasting, myofibrillar disorganization, and autophagy of skeletal muscle. Genes Dev 19: 1715-1722. 21. Zhu X, Yeadon JE, Burden SJ (1994) AML1 is expressed in skeletal muscle and is regulated by innervation. Mol Cell Biol 14: 8051-8057. 22. Buckingham M (1996) Skeletal muscle development and the role of the myogenic regulatory factors. Biochem Soc Trans 24: 506-509. 23. Smith RC, Wills KN, Antelman D, Perlman H, Truong LN, et al. (1997) Adenoviral constructs encoding phosphorylation- competent full-length and truncated forms of the human retinoblastoma protein inhibit myocyte proliferation and neointima formation. Circulation 96: 1899-1905. 24. Mal A, Harter ML (2003) MyoD is functionally linked to the silencing of a muscle-specific regulatory gene prior to skeletal myogenesis. Proc Natl Acad Sci U S A 100: 1735-1739. 25. Ohkawa Y, Marfella CG, Imbalzano AN (2006) Skeletal muscle specification by myogenin and Mef2D via the SWI/SNF ATPase Brg1. Embo J 25: 490-501. 26. Zhang CL, McKinsey TA, Olson EN (2002) Association of class II histone deacetylases with heterochromatin protein 1: potential role for histone methylation in control of muscle differentiation. Mol Cell Biol 22: 7302-7312. 27. de la Serna IL, Carlson KA, Imbalzano AN (2001) Mammalian SWI/SNF complexes promote MyoD-mediated muscle differentiation. Nat Genet 27: 187-190. 28. Fulco M, Schiltz RL, Iezzi S, King MT, Zhao P, et al. (2003) Sir2 regulates skeletal muscle differentiation as a potential sensor of the redox state. Mol Cell 12: 51-62. 29. Buckingham M (2001) Skeletal muscle formation in vertebrates. Curr Opin Genet Dev 11: 440-448. 30. Reed-Inderbitzin E, Moreno-Miralles I, Vanden-Eynden SK, Xie J, Lutterbach B, et al. (2006) RUNX1 associates with histone deacetylases and SUV39H1 to repress transcription. Oncogene 25: 5777- 5786. 31. Yahi H, Fritsch L, Philipot O, Guasconi V, Souidi M, et al. (2008) Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. J Biol Chem 283: 23692- 23700. 32. Andreu N, Garcia-Rodriguez M, Volpini V, Frecha C, Molina IJ, et al. (2006) A novel Wiskott-Aldrich syndrome protein (WASP) complex mutation identified in a WAS patient results in an aberrant product at the C-terminus from two transcripts with unusual polyA signals. J Hum Genet 51: 92-97. 33. Ayyanathan K, Lechner MS, Bell P, Maul GG, Schultz DC, et al. (2003) Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation. Genes Dev 17: 1855-1869. 34. Simon AM, Burden SJ (1993) An E box mediates activation and repression of the acetylcholine receptor delta-subunit gene during myogenesis. MolCell Biol 13: 5133-5140. 35. Mal AK (2006) Histone methyltransferase Suv39h1 represses MyoD-stimulated myogenic differentiation. Embo J 25: 3323-3334. 36. Puri PL, Iezzi S, Stiegler P, Chen TT, Schiltz RL, et al. (2001) Class I histone deacetylases sequentially interact with MyoD and pRb during skeletal myogenesis. Mol Cell 8: 885-897. 37. Chakraborty S, Sinha KK, Senyuk V, Nucifora G (2003) SUV39H1 interacts with AML1
- 99. and abrogates AML1transactivity. AML1 is methylated in vivo. Oncogene 22: 5229- 5237. 38. Taniuchi I, Littman DR (2004) Epigenetic gene silencing by Runx proteins. Oncogene 23: 4341-4345. 39. Ait-Si-Ali S, Guasconi V, Fritsch L, Yahi H, Sekhri R, et al. (2004) A Suv39h- dependent mechanism for silencing S- phase genes in differentiating but not in cycling cells. Embo J 23: 605-615. 40. Robin P, Fritsch L, Philipot O, Svinarchuk F, Ait-Si-Ali S (2007) Post-translational modifications of histones H3 and H4 associated with the histone methyltransferases Suv39h1 and G9a. Genome Biol 8: R270. 41. Ouararhni K, Hadj-Slimane R, Ait-Si-Ali S, Robin P, Mietton F, et al. (2006) The histone variant mH2A1.1 interferes with transcription by down-regulating PARP-1 enzymatic activity. Genes Dev 20: 3324- 3336. 42. Ito H, Kamei K, Iwamoto I, Inaguma Y, Kato K (2001) Regulation of the levels of small heat-shock proteins during differentiation of C2C12 cells. Exp Cell Res 266: 213- 221. FIGURE LEGENDS Figure 1: Runx1 and CBFβ interact with MyoD in vitro and in proliferating myoblasts A. Peptide sequences identified by mass spectrometry in the MyoD complex corresponding to CBFβ protein. B. Western blot analysis of double-purified Flag-HA-MyoD (MyoD), or eluate from HeLa control cells (Mock) with the indicated antibodies (Ab). S: soluble; C: chromatin associated. C. HeLa cells stably expressing Flag-HA-CBFβ (CBFβ) or HeLa control cells stably transfected with the empty vector (Ctr) were transiently transfected with expressing vectors for HA-tagged MyoD and/or HA-tagged Runx1. 24 hours post-transfection, cells were harvested and lysates were used for immunoprecipitation (IP) using Flag resin to precipitate Flag-HA-CBFβ. Precipitates were then subjected to western blot using HA Ab (ib α-HA) to simultaneously detect HA-Runx1, HA-MyoD, and Flag-HA-CBFβ (discriminated on the gel by their molecular weight). D. Nuclear extracts from proliferating (prolif.) or differentiating myoblasts (Diff.) were used for IP with antibodies raised against MyoD (lanes 4 and 9) and Myf5 (lanes 2 and 7), with control beads (lanes 3 and 8) or with normal rabbit IgG (lanes 5 and 10) as negative controls. The resulting precipitates were then subjected to western blot analysis for the presence of MyoD, Myf5 and CBFβ. Nuclear extracts (input) were loaded to show endogenous protein levels (lanes 1 and 6). E. Runx1, CBFβ, or luciferase (Luc) were in vitro translated in the presence of 35 S-Methionine (inputs on lanes 1-3, respectively) and incubated with equivalent amounts of GST-MyoD beads (lanes 4-7) or GST beads (lanes 8-11). GST pull-down was then conducted as described in the Material and Methods section, and the radiolabeled proteins were detected by autoradiography. *: CBFβ. Figure 2: Modulation of CBF subunits expression deregulates cell cycle exit and muscle terminal differentiation entry A. C2C12 myoblasts were transfected with scrambled (Scr) or anti-Runx1 siRNAs. 48 h post- transfection (0 h, lanes 1-2), cells were placed in differentiation medium for 24 h (lanes 3-4) or 48 h (lanes 5-6). Cells were then analyzed by western blot with the indicated antibodies (Ab). The differentiation times are indicated in hours (h). Runx1 downregulation has been quantified (indicated as “Runx1 quantif.”) using Bio1D application (Vilber Lourmat). α-tubulin is used as a loading control. B. As in A, except that we used anti-CBFb siRNAs. C. As in A and B, except that we used proliferating primary myoblasts, and combined Runx1 and CBFb siRNAs (lane 4). Note that all the kinetic studies of differentiation were carried out in the same 10 cm diameter cell culture dish for each sample. D. FACS analysis of the cell cycle distribution of C2C12 myoblasts transfected with the indicated siRNAs. Cells were analyzed 48h post-transfection. Scr: scrambled siRNA. E-F. C2C12 cells stably overexpressing Flag-HA-CBFb (C2C12-CBFb) or control cells (C2C12-Ctr) were differentiated at the indicated times (E, in hours), and analyzed by western blotting with the indicated Ab (E) or by immunofluorescence (IF) (10X magnification) (F). The kinetic studies were carried out
- 100. in the same10 cm diameter cell culture dish (E). IF experiments using anti-MCK or anti-MHC Ab were performed 48 h and 72 h respectively after induction of differentiation. Cells were DAPI-stained prior to fluorescent microscopy analysis (63X magnification). Figure 3: CBF acts at the chromatin level to regulate MyoD target genes A. ChIP using anti-Runx1 Ab were performed from either proliferating (grey bars) or differentiating myoblasts (black bars). We quantified copy numbers of the myogenin, p21 and cyclin D3 promoter regions harboring the MyoD and Runx1 target sequences, compared to 36B4 gene, which was used as a reference gene. Results are the mean of 3 independent experiments. B. Western blot analysis of Flag- purified Flag-HA-CBFβ stably expressed in C2C12 cells (CBFβ), or from C2C12 control cells (Ctr). Both inputs are probed in lanes 1-2 and eluates are shown in lanes 3-4. C. Chromatin immunoprecipitation experiments using anti-acetyl H3 antibody were performed from either proliferating (grey bars) or differentiating (black bars) C2C12 control (left) and C2C12-CBFβ (right) cells. We quantified copy numbers of the myogenin (myog.), cyclin D3 and p21 promoter regions harboring the MyoD target sequences. Results are the mean of three measurements. Figure 4: Model of skeletal muscle terminal differentiation regulation by CBF and MyoD. CBF negatively regulates cell cycle exit and early muscle differentiation genes. Upon differentiation, MyoD activates these genes.
- 101. Figure 1, Philipotet al. A B HA-CBF HA-MyoD HA-Runx1 1 2 3 4 5 6 7 8 Input Flag IP pHA-MyoD pHA-Runx1 CtrCBF CtrCBF + + + + + + + + + - + - + - + - HeLa-: CBF Flag C CS Mock MyoD 28 51 MW (kDa) Runx1 S 51 1 2 3 4 ib-HA - C - - MW (kDa) 34 39 51 64 D MyoD CBF Myf-5 Input Input Prolif. Diff. IP Ab Myf-5 beads MyoD IgG IP Ab Myf-5 beads MyoD IgG 1 2 3 4 5 6 7 8 9 10 E Runx1 CBF Luc GST-MyoD GST 1 2 3 4 5 6 7 8 9 10 Runx1 Runx1 CBF CBF Runx1+CBF Luc Runx1+CBF Luc 11 Inputs 22 39 28 51 19 MW (kDa) 28 39 MW (kDa) **
- 102. F Figure 2, Philipotet al. A CBF MCK Myog. -tub. CycD1 Runx1 0 4824Diff.(h) siRNA Scr Runx1 Scr Scr Runx1 Runx1 1 2 3 4 5 6 B Myog. MHC CBF C MCK -tub. Scr siRNA CBF Runx1 Runx1 +CBF MW (kDa) MW (kDa) 39 51 28 39 51 51 19 39 19 51 39 51 28 28 191 28 1 2 3 4 100 58 100 36 100 1Runx1 quantif. Myog. CBF MCK cyc D1 Prolif. Diff. Scr siRNA CBF Scr CBF MW 39 28 39 51 19 28 39 28 1 2 3 4 Flag MCK -tub. MHC Myog. C2C12-Ctr C2C12-CBF 120960 724824Diff.(h) 120960 724824 MyoD Runx1 E 1 2 3 4 5 6 7 8 9 10 11 12 cycD1 MW (kDa) 39 51 39 51 51 191 28 39 28 39 39 28 64 F MCK MHC C2C12-CtrC2C12-CBF 60 71 76 16.5 11 10 23 17 12 10 20 30 40 50 60 70 80 Scr siRNA Runx1 siRNA G1 S G2/M CBF siRNA cellsincellcyclephases(%) D
- 103. CBF Ctr Figure 3, Philipotet al. Flag (CBF ) MyoD HP1 Suv39h1 Runx1 input eluate C2C12- Myf5 HDACs CBF Ctr 2 3 4 1 2 3 B MW (kDa) 39 39 39 51 51 19 28 39 28 64 39 28 64 39 50 100 150 200 250 5 10 15 20 25 C ChIP Acetyl H3 promoterenrichment C2C12-Ctr C2C12-CBF p21myog. cycD3 Proliferation Differentiation p21myog. cycD3promoter 1 p21 prom.relativeenrichment myogenin cycD3 ChIP anti-Runx1 A Proliferation Differentiation 1 2 3 4 5 6 7
- 104. Figure 4, Philipotet al. CBF D3 p21 Myogenin MYOD
- 105. Purification on Flagresin Purification on HA resin SDS-PAGE resolution,mass spec analysis/ western blot Elution against Flag peptide Elution against HA peptide Nuclear soluble or chromatin extracts from HeLa cells expressing Flag-HA-MyoD Supplementary Figure 1, Philipot et al. Schematic representation of the purification protocol used to purify the MyoD complex from HeLa cells.
- 106. Supplementary Figure 2,Philipot et al. MyoD known partners identified by mass spectrometry in the MyoD complex Protein name Reference Pbx1 (Berkes et al, 2004) PC4 (Micheli et al, 2005) Id (Benezra et al, 1990) E12/E47 (Lassar et al, 1991) BRG1 (de la Serna et al, 2001) Prohibitin (Sun et al, 2004) HP1 (Yahi et al, 2008) PRMT5 (Dacwag et al, 2007) REFERENCES Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H (1990) The protein Id: a negative regulator of Helix-Loop-Helix DNA binding proteins. Cell 61: 49-59 Berkes CA, Bergstrom DA, Penn BH, Seaver KJ, Knoepfler PS, Tapscott SJ (2004) Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol Cell 14(4): 465-477 Dacwag CS, Ohkawa Y, Pal S, Sif S, Imbalzano AN (2007) The protein arginine methyltransferase Prmt5 is required for myogenesis because it facilitates ATP-dependent chromatin remodeling. Mol Cell Biol 27(1): 384-394 de la Serna IL, Carlson KA, Imbalzano AN (2001) Mammalian SWI/SNF complexes promote MyoD- mediated muscle differentiation. Nat Genet 27(2): 187-190 Lassar AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova A, Baltimore D, Weintraub H (1991) Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 66(2): 305-315 Micheli L, Leonardi L, Conti F, Buanne P, Canu N, Caruso M, Tirone F (2005) PC4 coactivates MyoD by relieving the histone deacetylase 4-mediated inhibition of myocyte enhancer factor 2C. Mol Cell Biol 25(6): 2242-2259 Sun L, Liu L, Yang XJ, Wu Z (2004) Akt binds prohibitin 2 and relieves its repression of MyoD and muscle differentiation. J Cell Sci 117(Pt 14): 3021-3029 Yahi H, Fritsch L, Philipot O, Guasconi V, Souidi M, Robin P, Polesskaya A, Losson R, Harel-Bellan A, Ait-Si-Ali S (2008) Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. J Biol Chem 283(35): 23692-23700.
- 107. Supplementary Figure 3,Philipot et al. MyoD Runx1 CBF MCK Myog. 0 72 -tub. 0 724824Diff.(h) 1 2 3 4 5 6 51 39 51 19 28 39 51 MW (kDa) 39 51 Expression of Runx1 and CBF proteins during muscle terminal differentiation. Cellular extracts from proliferating or differentiating C2C12 myoblasts (left panel) or from mouse primary myoblasts (right panel) were subjected to western blot analyses for the expression of CBF Runx1,MyoD,myogenin (Myog.) and Muscle Creatine Kinase (MCK). -tubulin is detected as a loading control.Differentiation times are indicated in hours on the top of each panel.
- 108. Supplementary Figure 4,Philipot et al. A Scr Runx1 Proliferation Differentiation siRNA B CBF Proliferation Differentiation Scr siRNA A.C2C12 myoblasts were transfected with control siRNA (Scrambled,Scr) or with Runx1 siRNA as indicated.48 hours post-transfection (Proliferation) cells were placed in differentiation medium (Differentiation) for 86 hours.Cells were then analyzed by microscopy (10X magnification). B.As in A,except that we used CBF siRNA.
- 109. ibCBF ex. end. 0 24 48 72 96 120 0 24 48 72 96 120 C2C12 Ctr C2C12CBF Supplementary Figure 5, Philipot et al. Differentiation (h) C2C12-CBF cells characterization A.Expression level of CBF in C2C12 control (ctr) and in C2C12-CBF in proliferating myoblasts (0 h) or at the indicate differentiation times (in hours),as measured by western blot using anti-CBF antibody. ex.:exogenous; end:endogenous. B.C2C12 cells stably overexpressing Flag-HA-CBF? (C2C12-CBF ) or control cells (C2C12-Ctr) were differentiated for 72 hours and analyzed by light microscopy (10X magnification). 19 39 28 MW (kDa) C2C12-CtrC2C12-eCBF Proliferation Differentiation light microscopy BA
- 110. Supplementary Figure 6,Philipot et al. p21 myogenin cycD3 B Proliferation Differentiation (24 h) 1 2 -tub. MW (kDa) 51 19 28 39 28 28 39 +1 -642 -532 -378 MyoD CATTTG Runx1 TGTGGT MyoD CAGCTG myogenin promoter +1 +187 +209 MyoD CACCTG Runx1 TGTGGT p21 promoter A A.Runx1 binding sites found in silico on MyoD target genes myogenin and p21. B.Western blot analysis (with the indicated antibodies) of cell extracts used for the ChIP experiment presented on Fig 1G. -tubulin ( -tub.) is used a loading control. -8 MyoD CAGTTG
- 111.
- 112. 77 Discussion des Résultats Validation dela stratégie d’approche L’idée originale de notre stratégie était d’opter pour une approche globale dans un système cellulaire artificiel puisque nous avons identifié les partenaires protéiques du facteur myogénique MyoD dans une lignée non-musculaire, la lignée humaine tumorale HeLa. Ce choix était motivé par des raisons pratiques à plusieurs niveaux. Tout d’abord, les cellules HeLa sont des cellules cancéreuses qui supportent relativement bien l’expression constitutive du facteur MyoD, alors que normalement MyoD exprimé ectopiquement est capable d’induire la transdifférenciation des cellules hôtes. Ainsi, ces cellules se transdifférencient au détriment de la prolifération, rendant difficile l’isolement de clones cellulaires surexprimant MyoD tout en continuant à proliférer. Le deuxième avantage d’utiliser les cellules HeLa pour surexprimer MyoD est leur capacité à proliférer en suspension. Ce paramètre non-négligeable nous a permis d’obtenir rapidement de grandes quantités de cellules en cultivant les HeLa dans de grands contenants pouvant contenir jusqu’à trois litres de culture cellulaire. Grâce aux deux étiquettes Flag et Hemaglutinine (HA) portées par MyoD, j’ai pu purifier de manière très stringente le complexe MyoD avec un protocole de double affinité. L’analyse du complexe MyoD purifié par spectrométrie de masse a été réalisée en doublon au laboratoire et dans un laboratoire américain situé à Boston. Le panorama de l’ensemble des partenaires de MyoD a été réalisé après trois purifications et trois analyses par spectrométrie de masse du complexe, nous permettant ainsi de recouper les protéines communes aux trois analyses effectuées. Alors que je partais avec un biais dans ma stratégie en utilisant les cellules HeLa comme système d’expression, un grand nombre de partenaires historiques de MyoD ont été révélés dans le complexe MyoD. Entre autres, les protéines E12, Id1, Brg1, Pbx, prohibitine ont été identifiés au sein de complexe MyoD, validant ainsi notre approche. Identification de Runx1-CBFβ au sein du complexe MyoD Beaucoup de nouveaux partenaires potentiels de MyoD ont été révélés et notamment la protéine CBFβ est apparue avec un grand nombre de peptide. La protéine CBFβ se dimérise avec la protéine Runx1 pour former le facteur de transcription CBF (Core Binding Factor).
- 113. 78 De manière intéressante,bien que Runx1 n’ait pas été révélé par l’analyse de spectrométrie de masse du complexe MyoD, j’ai pu le détecter, ainsi que CBFβ, en réalisant un western blot sur le complexe MyoD purifié. Le choix d’étudier plus en détail le facteur CBF (Runx1-CBFβ) comme partenaire de MyoD n’était pas basé uniquement sur le nombre de peptides abondants trouvé pour CBFβ après l’analyse par spectrométrie de masse. Dans la littérature scientifique, plusieurs publications reliaient Runx1 et CBFβ avec le muscle squelettique. Une des premières études mettant le facteur CBF en lien avec le muscle concerne l’expression de CBFβ in vivo dans le muscle squelettique (Chiba et al, 1997). De plus, dans une étude visant à étudier de façon exhaustive les gènes cibles de MyoD, Runx1 avait déjà été montré comme un gène cible de MyoD (Bergstrom et al, 2002). La région promotrice de Runx1 contient en fait plusieurs boîtes E reconnues pour la fixation des MRFs. Il a ainsi été montré dans cette étude que dans les myoblastes primaires, MyoD et Myf5 activent l’expression des gènes liés à la croissance cellulaire et activent notamment l’expression de Runx1 (Ishibashi et al, 2005). Parmi les publications décrivant Runx1 et CBFβ au niveau du système musculaire, toutes restent très descriptives et à ma connaissance, aucun mécanisme ou rôle n’a été décrit pour la fonction de Runx1 et CBFβ au cours de la différenciation musculaire. MyoD interagit avec CBF via la sous-unité Runx1 J’ai donc investigué davantage sur l’interaction protéique entre MyoD et CBF. Nos résultats montrent que l’interaction entre MyoD et CBF passe par l’interaction directe entre MyoD et la sous-unité Runx1. De manière intéressante, une autre protéine à domaine HLH, la protéine MITF, a été montrée comme interagissant directement avec Runx1 via le domaine de transactivation de Runx1 situé dans la partie C-terminale du domaine runt (Ogihara et al, 1999). Bien que le domaine d’interaction entre ces deux protéines n’ait pas été défini pour MITF, il se peut que ce soit au sein de la région hydrophobe HLH qui est retrouvée également chez la protéine MyoD. Une autre protéine à domaine HLH a également été montrée comme interagissant avec Runx1, il s’agit de la protéine HES (McLarren et al, 2000). Cette fois encore, le domaine d’interaction entre HES et Runx1 n’a pas été mis en évidence et ne permet pas de voir si le domaine d’interaction de HES avec Runx1 est partagé par le facteur MyoD. Je devrais donc affiner mon résultat en étudiant les domaines d’interaction de Runx1 et MyoD. D’ailleurs, j’ai déjà réuni le matériel nécessaire pour la réalisation de ces expériences.
- 114. 79 MyoD et CBFinteragissent dans les myoblastes murins, essentiellement durant leur prolifération Afin d’avoir une relevance biologique de cette interaction étudiée jusqu’à présent de manière artificielle, j’ai testé l’interaction MyoD-CBF dans des myoblastes murins en utilisant la lignée C2C12. Si cette lignée immortalisée reste un outil fiable et pratique plus de trente ans après son isolement, elle connaît des dérives en culture par rapport à des myoblastes fraîchement isolés. J’ai également donc travaillé sur des myoblastes primaires isolés au laboratoire à partir de cellules satellites murines pour confirmer tous les résultats des expériences obtenus avec la lignée de myoblastes immortalisés C2C12. De manière endogène cette fois, j’ai donc détecté dans des myoblastes murins (C2C12 et primaires) les sous-unités Runx1 et CBFβ en immunoprécipitant MyoD. De manière intéressante, l’interaction entre MyoD et Runx1- CBFβ est très forte dans les myoblastes en prolifération, mais n’est presque plus détectable après induction de la différenciation. MyoD est le chef d’orchestre de la différenciation terminale et il est connu pour être associé à des inhibiteurs et des co-répresseurs dans les myoblastes en prolifération. L’interaction préférentielle entre MyoD et CBF dans les myoblastes en prolifération a immédiatement soulevé la possibilité que CBF soit un régulateur négatif de l’activité de MyoD. De plus, une étude extérieure à la nôtre montre qu’à l’instar des régulateurs négatifs de la différenciation musculaire, le transcrit de Runx1 est fortement diminué dans les myoblastes après induction de la différenciation (Delgado et al, 2003). Par ailleurs, étant donné que MyoD et Runx1 sont soumis à des modifications post- traductionnelles, il est tout à fait envisageable que la variation du statut de phosphorylation/acétylation/méthylation de ces deux protéines soit responsable de la variation de leur force d’interaction entre les myoblastes proliférants et les cellules en différenciation. L’utilisation de mutants de MyoD ou Runx1, non phosphorylables/méthylables/acétylables nous permettra de tester in vitro cette éventualité. CBF est recruté sur les gènes cibles de MyoD, préférentiellement dans les cellules musculaires en cours de prolifération, et non en différenciation J’ai affiné le contexte d’interaction de MyoD et CBF en regardant s’il était dépendant de la chromatine. Runx1 est la sous-unité responsable de la fixation de CBF sur l’ADN et reconnaît la séquence consensus TGTGGT (sur le brin complémentaire : ACCACA). De manière intéressante, sur trois promoteurs cibles précoces de MyoD, j’ai localisé la séquence consensus de Runx1, adjacente à la boîte E (CANNTG) reconnue par MyoD. Les résultats obtenus après immunoprécipitation de Runx1 et l’analyse des promoteurs de p21, de la cycline D3 et de la myogénine par PCR quantitative, montrent que Runx1 est effectivement recruté sur ces promoteurs cibles de MyoD. MyoD et CBF interagiraient donc dans un contexte
- 115. 80 dépendant de lachromatine. L’occupation physique de ces promoteurs par Runx1 semble liée à une répression des gènes en question, puisque le produit de ces gènes n’est alors pas détecté par western blot. Par ailleurs, de manière très intéressante, la protéine Runx1 est recrutée préférentiellement sur ces promoteurs dans les cellules musculaires en prolifération et non en différenciation, renforçant ainsi le rôle potentiellement négatif de Runx1/CBFβ sur la différenciation musculaire. De manière intéressante, je n’ai pas détecté de recrutement de Runx1 sur le promoteur de la desmine et l’enhancer de MCK (résultats non présentés), des gènes cibles plus tardifs de MyoD. Le facteur CBF aurait ainsi peut-être un rôle important dans le contrôle de l’induction de la différenciation musculaire et un rôle nul ou partiel dans la régulation des gènes musculaires plus tardifs. Le facteur CBF régule négativement la différenciation musculaire, au profit de la prolifération cellulaire La diminution de l’expression de la sous-unité Runx1 ou CBFβ dans les myoblastes C2C12 ou les myoblastes primaires accélère la différenciation terminale Dans le but de valider le rôle potentiellement négatif de CBF sur la différenciation musculaire, j’ai diminué le niveau protéique de chacune des sous-unités CBFβ et Runx1 par ARN interférence (ARNi) dans les myoblastes C2C12 et dans des myoblastes primaires. L’effet de la diminution des protéines Runx1 et CBFβ a été contrôlée au cours d’une cinétique de différenciation. De manière intéressante, dans les deux cas, l’expression de marqueurs musculaires tels que la myogénine et MCK (créatine kinase musculaire) est beaucoup plus intense et plus rapide pour les cellules déplétées en Runx1 ou CBFβ. Ce résultat confirme nos suspicions sur le rôle de CBF au cours de la différenciation musculaire et lui prête un rôle de régulateur négatif de la différenciation terminale, puisqu’en diminuant le taux protéique de Runx1 ou CBFβ, la différenciation est accélérée. Sachant que la différenciation terminale se décompose en deux étapes discrètes, à savoir la sortie du cycle prolifératif suivie de l’expression des marqueurs de la différenciation musculaire, la question qui se pose alors est la suivante : « l’expression forte et précoce des marqueurs musculaires en absence de Runx1 ou CBFβ, est-elle due à une levée de l’inhibition sur les gènes correspondants ou est-elle une conséquence d’une sortie du cycle cellulaire plus rapide et plus efficace ? » Pour répondre à cette question, j’ai testé l’expression de la cycline D1 qui est un marqueur des cellules en prolifération et dont l’expression inhibe la différenciation musculaire terminale (Rao et al, 1994; Rao & Kohtz, 1995; Skapek et al, 1995). Effectivement, la protéine cycline D1 est diminuée précocement et efficacement dans les myoblastes en absence de Runx1 ou
- 116. 81 CBFβ. La diminutionde Runx1 ou CBFβ dans les myoblastes conduirait donc à une sortie du cycle cellulaire plus efficace et consécutivement à l’expression rapide des marqueurs de la différenciation musculaire terminale. Ce résultat n’est pas surprenant du fait que dans d’autres systèmes cellulaires, Runx1 a été montré comme un régulateur de l’expression des cyclines D (Peterson et al, 2005; Strom et al, 2000) et que la diminution de Runx1 est liée à la sortie du cycle cellulaire dans plusieurs systèmes cellulaires (Osorio et al, 2008; Theriault et al, 2005). En absence de Runx1 dans les myoblastes, il est donc raisonnable de constater une diminution de la protéine cycline D1. J’ai également regardé l’effet de la diminution de Runx1 et CBFβ sur le cycle cellulaire des myoblastes C2C12 par FACS (résultats non présentés). Effectivement, par rapport aux C2C12-contrôle, le pourcentage de C2C12 dans la phase G1 (correspondant à un arrêt du cycle) est plus élevé lorsque CBFβ est diminué. La surexpression de la sous-unité CBFβ dans les myoblastes C2C12 ralentit la différenciation terminale Afin de valider le rôle négatif de CBF sur la différenciation terminale, j’ai établi une lignée de myoblastes C2C12 surexprimant CBFβ et j’ai contrôlé l’effet de la surexpression sur une cinétique de différenciation. Comme attendu, la surexpression de CBFβ induit une stabilisation de la protéine Runx1. Ce résultat est en accord avec la littérature puisqu’il a été décrit que CBFβ protège Runx1 de la dégradation par la voie ubiquitine-protéasome (Huang et al, 2001). L’effet général de la surexpression de CBFβ est le ralentissement de la différenciation musculaire qui se traduit par la faible expression de MCK et la quasi- inexistance de myogénine et de la chaîne lourde de la myosine (MHC). Dans ces mêmes cellules, les expériences d’immunofluorescence montrent que les myotubes formés après 48h et 72h de différenciation sont courts et pour la plupart mono-, ou di-nucléés, suggérant un problème de fusion lorsque CBFβ est surexprimé. Ceci peut être en partie expliqué par la très faible expression de myogénine dans les myoblastes qui surexpriment CBFβ. En effet, la myogénine est un facteur de transcription qui, de concert avec MRF4, active l’expression de gènes plus tardifs de la différenciation terminale et participe à la fusion des myoblastes (Dedieu et al, 2002; Rawls et al, 1998; Vivian et al, 2000). Le retard de différenciation dans ces mêmes cellules est concomitant avec l’expression forte et soutenue de cycline D1, favorisant très certainement la prolifération des myoblastes au détriment de la différenciation. En réalisant l’étude du cycle cellulaire par FACS des C2C12 surexprimant CBFβ, j’ai pu constater un léger enrichissement des cellules dans la phase S par rapport aux C2C12-contrôle (résultats non présentés). Pour établir que la surexpression de
- 117. 82 CBFβ n’inhibe pasla différenciation musculaire uniquement par la stimulation antagoniste du cycle prolifératif, il serait intéressant de diminuer l’expression de la cycline D1 par ARNi dans ces cellules et de voir si l’expression des marqueurs musculaires est toujours autant compromise dans ce cas-là. L’étude de l’effet de la surexpression et la diminution de Runx1 et CBFβ dans les myoblastes, montre une corrélation inverse entre le niveau d’expression de ces deux protéines et l’efficacité de la différenciation musculaire. Encore une fois, Runx1 se retrouve au centre d’un système où son dosage dans la cellule semble en déterminer la destinée. Par exemple, dans le follicule pileux ou les neurones, l’augmentation du niveau de Runx1 favorise la prolifération au détriment de la différenciation. Ces résultats et les nôtres confèrent au facteur Runx1- CBFβ un rôle général dans l’équilibre prolifération-différenciation pour différents systèmes cellulaires. Dans les myoblastes en prolifération, CBFβ est associé à des répresseurs et inhibe le remodelage de chromatine sur les gènes cibles de MyoD après induction de la différenciation Pour essayer d’approcher le mécanisme d’action de CBF, j’ai utilisé la lignée C2C12 surexprimant CBFβ pour étudier les partenaires protéiques de CBFβ dans les myoblastes en prolifération. En purifiant CBFβ, j’ai détecté par western blot la présence concomitante des histones désacétylases HDACs 1, 2 et 3, la présence de l’histone méthyl-transférase Suv39h1 et la protéine de l’hétérochromatine HP1β. Ces partenaires protéiques de CBFβ sont connus pour conférer à la chromatine un état non-permissif à la transcription. Ces protéines sont également des partenaires connus de MyoD et Runx1. Ce résultat suggère que CBF peut réprimer au niveau épigénétique l’expression des gènes cibles de MyoD. J’ai donc analysé l’état d’acétylation (qui est une marque épigénétique d’activation de la transcription) des gènes cibles de MyoD sur lesquels j’ai montré que Runx1 est recruté préférentiellement au cours de la prolifération : p21, myogénine et cycline D3. Pour la lignée C2C12-contrôle, le niveau d’acétylation de ces trois promoteurs augmente très significativement après induction de la différenciation. En revanche, pour les C2C12 surexprimant CBFβ, le taux d’acétylation reste faible et constant. Ceci montre que le retard de différenciation observé précédemment pour ces cellules est lié (au moins en partie) à l’absence ou l’inhibition du remodelage épigénétique de ces trois gènes cibles de MyoD. Au final, les expériences d’immunoprécipitation de la chromatine (ChIPs) ont montré que Runx1 se trouvait sur le promoteur de la myogénine en prolifération, mais pas en différenciation, pouvant potentiellement réguler négativement l’expression de la myogénine. De
- 118. Figure 23. Modélisationdes résultats. A) L’association de CBF avec MyoD se fait préférentiellement au cours de la prolifération. Sur certains gènes cibles précoces de MyoD, CBF possède des sites de liaison et peut recruter des protéines de remodelage de la chromatine, conférant aux gènes cibles de MyoD un état non- permissif à la transcription dans les myoblastes en prolifération. Au cours de la différenciation, l’interaction CBF-MyoD serait levée et CBF ne serait plus présent sur la chromatine, permettant à MyoD de recruter des coactivateurs. B) Double rôle de CBF au cours de la différenciation musculaire terminale : inhibition de la sortie du cycle prolifératif et inhibition de l'expression des gènes spécifiques du muscle. Gènes spécifiques du muscle Machinerie basale de transcription E12 MYOD MEF2 HATs CARM1 p300 PCAF Runx1 CBFβ HDACs MYOD Suv39h1 CBFβ HP1 Runx1 Gènes spécifiques du muscle B A Myotube précoce Myoblastes en prolifération Myocytes alignés Sortie du cycle prolifératif Expression des gènes spécifiques du muscle & fusion PROLIFERATION DIFFERENCIATION
- 119. 83 plus, d’après nosdonnées, le promoteur de la myogénine n’est pas acétylé après 24h de différenciation dans les myoblastes surexprimant CBFβ alors que c’est le cas pour les C2C12 contrôle. Nous observons des résultats similaires pour les promoteurs de la cycline D3 et le promoteur de p21, tous des gènes cibles précoces de MyoD. La surexpression de CBFβ semble donc toucher les étapes précoces de la différenciation musculaire. Il serait intéressant de réaliser des ChIPs anti-Runx1 sur la lignée C2C12 qui surexprime CBFβ pour voir si l’absence d’acétylation est corrélée à une présence continue de Runx1 sur ces trois promoteurs-là après induction de la différenciation, retardant ainsi la différenciation musculaire terminale. Conclusion et modèle Ces résultats nous incitent à penser que le facteur CBF agirait à deux niveaux pour réguler la différenciation musculaire : à la fois sur la sortie du cycle prolifératif, mais aussi sur l’expression des marqueurs de la différenciation musculaire et la fusion des cellules. De plus, du fait de son interaction avec MyoD et sur les gènes cibles de MyoD, préférentiellement au cours de la prolifération cellulaire, il semblerait que le rôle du facteur CBF soit au moins en partie dépendant de MyoD. MyoD est capable d’induire la transdifférenciation de cellules non-musculaires avec une efficace relative et certaines lignées non-musculaire comme la lignée HeLa sont réfractaires à la transdifférenciation induite par MyoD (Choi et al, 1990; Davis et al, 1987; Weintraub et al, 1989). Cette résistance est expliquée en partie par l’expression d’inhibiteurs de la différenciation musculaire, tels que Id et la musculine (Yang et al, 2009b). De même, le facteur Runx1 pourrait inhiber cette conversion dépendante de MyoD. Cependant, à la vue son action connue sur le cycle cellulaire, Runx1/CBFβ pourrait inhiber la différenciation musculaire rien que par sa fonction antagoniste à MyoD, en stimulant la prolifération des myoblastes. Le modèle que je propose pour le rôle du facteur CBF au cours de la différenciation terminale est le suivant (figure 23) : (i) son association avec MyoD se fait préférentiellement au cours de la prolifération. Sur certains gènes cibles précoces de MyoD, Runx1 possède des sites de liaison (ii) et peut recruter des protéines du remodelage de la chromatine conférant aux gènes cibles de MyoD un état non-permissif à la transcription (iii) dans les myoblastes en prolifération (iv). Au cours de la différenciation, l’interaction CBF-MyoD serait levée (v) et CBF ne serait plus présent sur la chromatine (vi), permettant à MyoD de recruter des coactivateurs.
- 120.
- 121. 84 Discussion Générale & Perspectives I. Régulationde la translocation de CBFβ dans le noyau des myoblastes Avant la nôtre, une seule étude s’était penchée sur le rôle de CBFβ dans le muscle squelettique, celle de Chiba et ses collègues. Cette étude renseigne sur la localisation cytoplasmique et nucléaire de CBFβ au cours du développement du muscle squelettique (Chiba et al, 1997). Dans cette étude, les auteurs suivent l’expression et la localisation de la protéine CBFβ dans les myocytes alignés et prêts à fusionner, dans les myotubes néo-formés et dans les myofibres matures caractérisées par l’alignement des myofibrilles et l’apparition des stries Z. Dans les myocytes intercostaux (jour embryonnaire E13,5 chez la souris), l’expression cytoplasmique de CBFβ est faible, et à un stade antérieur où les myocytes sont encore désorganisés, la protéine CBFβ n’est carrément pas détectable. Au jour E16,5, les cellules myogéniques de souris de la région intercostale correspondent à des myotubes avant maturation. Dans ces myotubes, la protéine CBFβ est détectée en abondance dans tout le cytoplasme et de manière intéressante, les auteurs détectent la protéine CBFβ également dans les noyaux. Enfin, l’expression de la protéine CBFβ a été réalisée sur des coupes de myofibres matures dont l’architecture présente des stries Z et l’alignement des myofibrilles d’actine. Le marquage protéique de CBFβ est localisé sur les stries Z dans des coupes de muscle. Plus précisément, les auteurs montrent par microscopie confocale que le marquage de CBFβ se superpose à celui de l’α-actinine, une protéine de structure où sont ancrées les myofibrilles d’actine. En résumé, l’expression de CBFβ augmente donc dans le cytoplasme des cellules musculaires au cours du développement, et n’est détectable dans le noyau qu’au stade myotube, mais plus après la maturation de la fibre musculaire (Chiba et al, 1997). Ceci implique que le facteur de transcription CBF peut se former et aurait un rôle prédominant dans les myotubes. Le mécanisme de translocation de la protéine CBFβ dans le noyau est important à étudier car il permet la formation du facteur de transcription dimérique CBF actif dans le noyau et la
- 122. 85 stabilisation protéique deRunx1. Une étude relativement récente a montré l’importance des filamines dans la localisation cytoplasmique de CBFβ et sa relocalisation dans le noyau (Yoshida et al, 2005). Les filamines sont des protéines réticulant les filaments d’actine corticale de manière orthogonale et ancrent les protéines transmembranaires au cytosquelette d’actine. Dans mes expériences d’immunofluorescence, j’ai constaté qu’effectivement, le marquage de CBFβ était cytoplasmique et dessinait parfaitement les moindres étirements de la membrane cellulaire. Par ailleurs, lorsque j’ai surexprimé CBFβ dans les myoblastes C2C12, j’ai observé une intensification de ce marquage cytoplasmique, avec un recouvrement complet de la cellule comme si la protéine CBFβ tapissait parfaitement toute la membrane cellulaire. Dans une étude utilisant comme modèle une lignée cellulaire n’exprimant que la filamine A (les autres isoformes étant indétectables), la diminution artificielle de la filamine A entraîne la relocalisation spontanée de la protéine CBFβ dans le noyau de ces cellules. Or, dans les fibres musculaires, les trois types de filamines sont exprimées (A, B et C), dont certaines formes de filamines sont d’ailleurs exclusivement retrouvées dans le muscle, soulignant l’importance de ces protéines dans le muscle (Chiang et al, 2000). Les trois types de filamines (A, B et C) ont été montrés comme interagissant avec CBFβ (Yoshida et al, 2005). In vivo, il existe deux mécanismes pouvant reproduire la dissociation des filamines de l’actine : la fusion ou la division cellulaire. Par exemple, au moment de la fusion de deux myoblastes (ou entre un myoblaste compétent et le myotube en formation), l’actine forme localement des pré- vésicules de fusion et devient localement fasciculée au lieu d’être réticulée (Kim et al, 2007), cela implique que les filamines doivent se détacher des fibres d’actine. Si les filamines réticulant l’actine corticale se dissocient de l’actine pour lui laisser adopter une structure en faisceau, cela pourrait être un mécanisme pour la libération potentielle de la protéine CBFβ et sa relocalisation au noyau. Si cette hypothèse est vraie, cela explique en partie pourquoi dans les myotubes en formation, mais pas dans les myoblastes, ni dans les myofibres matures, CBFβ est détecté dans le noyau dans l’étude du groupe de Satake (Chiba et al, 1997). Dans les myotubes en cours de formation, le rôle de CBFβ transloqué au noyau reste en revanche inexpliqué. Dans les myoblastes en prolifération, la division cellulaire pourrait également contribuer à la relocalisation nucléaire de CBFβ et réapprovisionner ainsi le niveau basal de CBFβ dans le noyau des myoblastes en prolifération. Si par immmunofluorescence je n’ai pas mis en évidence la présence de CBFβ dans le noyau des myoblastes en prolifération, j’ai pu détecter la protéine CBFβ dans l’extrait nucléaire de myoblastes proliférants par western blot. Dans
- 123. 86 mon étude, j’aid’ailleurs immunoprécipité CBFβ avec le facteur myogénique MyoD préférentiellement dans les myoblastes en prolifération. Par ailleurs, la présence de Runx1 influe également sur la relocalisation de CBFβ dans le noyau (Lu et al, 1995). De manière intéressante, une étude montre que le transcrit de Runx1 est exprimé dans les myoblastes et dans les myotubes, mais que sa détection dans les myofibres n’est plus possible, à moins que la fibre soit dénervée (Zhu et al, 1994). En reprenant l’ensemble des résultats apportés par cette étude (Zhu et al, 1994) et ceux de Chiba et ses collègues (Chiba et al, 1997), il est possible d’envisager le modèle suivant : (i) au cours du développement l’expression de CBFβ est au début faible et exclusivement cytoplasmique, (ii) puis la protéine CBFβ est ensuite détectée dans les noyaux des myotubes au moment où Runx1 est également exprimé, et (iii) après maturation et innervation de la myofibre, quand Runx1 n’est plus détecté, la protéine CBFβ est à nouveau exclusivement cytoplasmique. Après dénervation de la fibre musculaire, il serait intéressant d’étudier la localisation de CBFβ pour vérifier si la protéine est alors à nouveau présente dans le noyau pour y retrouver son partenaire de dimérisation Runx1 qui s’y trouve réexprimé (Zhu et al, 1994). Ce modèle appuie à la fois la présence de CBFβ dans le noyau en présence de Runx1, mais aussi consécutivement aux fusions permettant la croissance du myotube en formation. Il y aurait donc au moins deux mécanismes stimulant le transfert de CBFβ dans le noyau et ces deux mécanismes restent à valider dans les cellules musculaires. Il y a de toute évidence un contrôle très strict de la transclocation de CBFβ dans le noyau car malgré la surexpression très forte de la protéine dans les myoblastes C2C12, ou la lignée cancéreuse HeLa (résultats non présentés), je n’ai pas observé d’expression plus abondante de de CBFβ dans le noyau. Cependant, la réalité devait être autre car dans les myoblastes C2C12 surexprimant CBFβ, j’ai observé une stabilisation de la protéine Runx1 nucléaire et j’ai obtenu un effet franc sur la différenciation des myoblastes en myotubes. Ceci montre que la moindre variation dans la quantité de CBFβ transloqué au noyau (aussi indétectable soit-elle) suffirait pour stabiliser Runx1 et former un dimère CBF actif capable de bouleverser radicalement la différenciation musculaire. Pour amplifier l’effet du facteur de transcription CBF dans le noyau et évaluer son impact sur la différenciation des myoblastes, il serait judicieux d’établir une lignée de myoblastes surexprimant la sous-unité Runx1. Dans ce cas, je m’attends à une relocalisation plus importante de CBFβ endogène dans le noyau des myoblastes et à un phénotype encore plus marqué sur la différenciation musculaire.
- 124. 87 II. CBFβ dansle cytoplasme : un rôle de senseur ? La question qui vient naturellement en voyant l’abondance de la protéine CBFβ dans le cytoplasme est « A quoi sert une telle abondance cytoplasmique de cette protéine si uniquement une faible partie est transloquée au noyau? ». Le rôle potentiel de CBFβ dans le cytoplasme, indépendamment de sa fonction avec Runx, a été soulevé plusieurs fois (Chiba et al, 1997; Lu et al, 1995; Tanaka et al, 1997). D’autant que dans la fibre mature, le niveau de CBFβ dans le cytoplasme reste élevé en comparaison avec celui de Runx1 qui est indétectable. En effet, suite à la dénervation de la fibre musculaire, le transcrit de Runx1 est augmenté de façon importante mais celui de CBFβ, qui était déjà abondant, augmente peu (Zhu et al, 1994). Dans la fibre musculaire striée notamment, l’importance des protéines de structure et la présence de CBFβ sur ces protéines de structures (stries Z, filamines) dans le cytoplasme pourrait être en lien. Je propose notamment que CBFβ puisse jouer le rôle de senseur au moment des fusions. Au niveau du point de fusion, le relarguage des filamines et/ou la translocation de CBFβ dans le noyau pourrait constituer un signal pour éviter les fusions multiples simultanées des cellules. A noter que dans la lignée de myoblastes C2C12 dans laquelle j’ai surexprimé artificiellement CBFβ, j’ai observé un nombre important de myotubes exceptionnellement courts et souvent seulement dinucléés, soutenant l’hypothèse que CBFβ pourrait avoir un rôle dans la régulation négative de la fusion des myoblastes. À l’inverse, en diminuant le niveau d’expression de CBFβ par ARNi, les myotubes formés étaient particulièrement gros et longs. La comparaison entre les myoblastes surexprimant Runx1 et les myoblastes surexprimant CBFβ permettra de dire si c’est la formation du facteur nucléaire CBF qui est importante dans la différenciation musculaire terminale, ou si c’est la position de CBFβ dans le cytoplasme et son rôle potentiel de senseur qui a un rôle dominant dans le ralentissement de la différenciation musculaire. Ou peut-être une combinaison des deux ! III. Runx1, CBFβ et MyoD : un rôle dans la différenciation ostéoblastique ! Une question que je me suis posée au cours de mon étude est la possible reconversion des myoblastes en cellules de type osseux sous l’influence de Runx1. La protéine Runx1 qui est exprimée dans une grande variété de tissus et qui est impliquée dans différentes voies de différenciation, pourrait-elle induire dans les myoblastes un phénotype autre que musculaire? À l’origine de cette question, il y a plusieurs observations. Premièrement, la protéine Runx1 est impliquée dans le développement squelettique et est nécessaire à la différenciation ostéogénique (Lian et al, 2003). Deuxièmement, MyoD lui-même a été montré comme étant indispensable à la différenciation ostéogénique (Komaki et al, 2004). Enfin, une myriade de
- 125. 88 publications documente latransdifférenciation des myoblastes en os. Un des facteurs de transcription majeurs de la différenciation ostéogénique n’est autre que Runx2, un autre membre de la famille Runx. Runx2 est un régulateur essentiel de la différenciation ostéogénique (Ducy et al, 1997). La nécessité de Runx2 pour la formation de l’os est mise en évidence dans les modèles de souris mutantes ou inactivées pour Runx2, qui ne développent plus de squelette minéralisé (Choi et al, 2001; Komori et al, 1997; Otto et al, 1997). Runx2 est une des cibles de la voie de signalisation TGFβ/BMP (Lee et al, 2000) et interagit directement avec les médiateurs de cette voie, les facteurs SMADs (Zaidi et al, 2002). Une des premières études mettant Runx1 en lien avec la formation du squelette, est une étude conduite par Simeone et ses collègues (Simeone et al, 1995), dans laquelle ils montrent que Runx1 est exprimé dans le cartilage. Dans une étude plus récente, l’expression de Runx1 a été étudiée au cours de la formation du squelette et dans des cellules de l’os. Runx1 est détecté dans des cellules ostéoblastiques matures qui expriment les marqueurs osseux Runx2 et l’ostéocalcine (OCN) (Lian et al, 2003). De plus, par immunofluorescence, la protéine Runx1 a été détectée dans une lignée primaire d’ostéoblastes de rat, dans une lignée humaine d’ostéoblastes et dans une lignée d’ostéoprogéniteurs murins (Lian et al, 2003). Par RT-PCR, l’expression de Runx1 a été mesurée au cours d’une cinétique de différenciation dans une lignée de progéniteurs mésenchymateux, montrant une augmentation du transcrit de Runx1 du stade de prolifération, jusqu’à la confluence, au moment où la phosphatase alcaline (ALP, un marqueur précoce de la différenciation ostéogénique) est activée (Lian et al, 2003). De manière très intéressante, au cours du développement, Runx1 présente un schéma d’expression spatial et temporel durant la formation de l’os qui est différent de celui de Runx2. Runx1 n’est pas exprimé dans les stades tardifs de la différenciation ostéogénique, dans les ostéocytes, alors que l’expression de Runx2 est augmentée durant la formation de l’os et la différenciation des ostéoblastes (Banerjee et al, 2001). Ainsi, l’expression de Runx1 précède celle de Runx2 dans le tissu squelettique (Lian et al, 2003). De manière intéressante, de nombreuses expériences ont démontré la plasticité des myoblastes, qui sous l’influence de certains facteurs peuvent adopter un autre destin cellulaire. Certaines études ont notamment mis en avant la capacité du facteur BMP-2 (bone morphogenetic protein-2) à inhiber la formation de myotubes ainsi que l’expression de troponine T et de la chaîne lourde de la myosine dans les cellules musculaires. Au contraire, BMP-2 stimule l’expression de la protéine inhibitrice de la différenciation musculaire Id-1 et l’expression de marqueurs ostéogéniques, comme OCN et ALP (Katagiri et al, 1994). La protéine BMP-2 fait partie de la superfamille du TGFβ et agit en amont de Runx2. Une
- 126. 89 expérience montre qu’enculture cellulaire les myoblastes C2C12 stimulés avec BMP-2 se mettent à exprimer Runx2 qui, en interaction avec les facteurs SMAD 1 et 5 eux aussi activés par BMP-2, va induire leur transdifférenciation ostéogénique (Nishimura et al, 2002). Une autre étude a évalué l’effet direct de Runx2 sur la transdifférenciation ostéogénique des myoblastes. Il a ainsi été montré que Runx2 inhibe la myogenèse de myoblastes primaires, en inhibant l’expression de MyoD et de la myogénine dans les myoblastes, et en stimulant l’expression des marqueurs de la différenciation ostéogénique, tels que OCN, ALP, BSP (bone sialo protein), Osx et Dlx5 (Gersbach et al, 2004). De manière intéressante, une autre étude montre que l’expression de MyoD est induite transitoirement après les traitements des myoblastes C2C12 par BMP-2 (Komaki et al, 2004). Dans cette étude, les auteurs suggèrent même que Runx2 pourrait être une cible de MyoD, puisqu’en présence de BMP-2 les myoblastes expriment les marqueurs osseux osterix (Osx) et Runx2. Les auteurs montrent notamment qu’en utilisant des cellules musculaires de souris inactivées pour le gène MyoD, il n’est pas possible d’induire la différenciation ostéogénique, à moins de réintroduire MyoD dans ces cellules (Komaki et al, 2004). Ces expériences soulignent l’importance et le rôle de MyoD dans la conversion des myoblastes en ostéoblastes, au moins in vitro. Très récemment, les propriétés à la fois ostéogénique et myogénique des cellules satellites et des cellules progénitrices musculaires (MPCs) ont été caractérisées. L’étude révèle que les MPCs coexpriment ALP, Runx2 et MyoD sans stimulations extérieures et sont capables d’accomplir la différenciation ostéogénique terminale (Hashimoto et al, 2008). Les auteurs montrent ainsi que les MPCs (qui correspondent à des cellules satellites activées) possèdent simultanément des propriétés myogéniques et ostéogéniques (Hashimoto et al, 2008). Par ailleurs, dans les expériences de dénervation de fibre musculaire in vivo, une étude a montré que Runx1 et MyoD étaient fortement induits dès le troisième jour après la dénervation de la fibre, mais également, l’expression de la protéine Runx2, non exprimée dans la fibre musculaire en conditions normales, était induite dans la fibre dénervée et en régénération (Zhu et al, 1994). Dans mes expériences, je montre que la surexpression de CBFβ entraîne une stabilisation de Runx1 et un ralentissement/blocage de la différenciation musculaire terminale. Il serait intéressant de tester si en situation de crise (blocage de la différenciation musculaire terminale), les myoblastes sont capables de s’orienter vers une autre voie de différenciation, en l’occurrence la différenciation ostéogénique. À noter que dans plusieurs cas de maladie du muscle squelettique, comme par exemple la dystrophie musculaire de Duchenne, l’activité de la phosphatase alcaline a été détectée spontanément dans le muscle en régénération. Ceci
- 127. 90 montre l’expression invivo et sans stimulation extérieure d’un marqueur osseux dans la fibre musculaire en régénération. En connaissance de ses informations-là, il serait intéressant de tester si dans les myoblastes surexprimant CBFβ, l’augmentation de l’activité du dimère Runx1/CBFβ concomitante avec l’expression de MyoD, pourrait induire l’expression de la protéine Runx2. Si tel est le cas, cela pourrait suffire à induire la différenciation ostéogénique (Gersbach et al, 2004), au détriment de la différenciation musculaire. IV. Les variants d’épissage de Runx1 pourraient être à l’origine d’une double fonction : le contrôle de la prolifération et de la différenciation musculaire Une des caractéristiques des gènes Runx de mammifères et de l’oursin est la génération de variants d’épissages. À une ou deux exceptions près, l’ensemble des transcrits qui codent les protéines Runx gardent le domaine runt intact et diffèrent principalement par leur extrémité C-terminale. Dans l’hématopoïèse, un processus au cours duquel la fonction de Runx1 a bien été caractérisée, un certain nombre de variants ont été caractérisés. Ces variants d’épissage sont co-exprimés différemment en fonction du lignage cellulaire, cependant leur spécificité n’est pas encore bien comprise. Néanmoins, certaines fonctions ont été attribuées à certains variants de Runx1 grâce à des expériences en culture cellulaire où une isoforme peut être surexprimée par rapport à une autre (Tanaka et al, 1995). Par exemple, une étude suggère que l’isoforme humaine la plus courte, Runx1-P2 de 26 kDa (appelée également AML1a) et dont l’extrémité C-terminale est presque intégralement manquante, favorise la prolifération au détriment de la différenciation dans la lignée murine de cellules myéloïdes. De manière intéressante, l’isoforme plus longue Runx1-P2 de 49 kDa (appelée également AML1b) a un effet opposé en stimulant la différenciation et en bloquant la prolifération (Tanaka et al, 1995). Une autre étude plus récente s’est intéressée au rôle différentiel de AML1a et AML1b dans les cellules de moelle osseuse. L’expression forcée de AML1 dans ces cellules augmente leur potentiel de greffe puisque le nombre de cellules surexprimant AML1a s’amplifie rapidement chez les receveurs. Inversement, la surexpression d’AML1b abolit complètement la capacité de greffe de ces cellules. De plus, AML1b stimule la différenciation alors que AML1a stimule la prolifération des progéniteurs capables de greffe lymphomyéloïde (Tsuzuki et al, 2007). Ensemble, ces études et d’autres (Tanaka et al, 1995) suggèrent que les différentes isoformes de Runx1 peuvent avoir des rôles opposés dans la prolifération et la différenciation. Le niveau d’expression relatif des différentes isoformes de Runx1 pourrait ainsi affecter le choix de la cellule dans sa décision de proliférer ou de se différencier.
- 128. 91 Dans mon étude,je n’ai pas mis l’accent sur les rôles respectifs des différentes isoformes de Runx1 au cours de la différenciation musculaire. Chez la souris, j’ai recensé quatre isoformes : deux « longues » isoformes se situant environ à 56-58 kDa (poids moléculaire apparent sur le gel) transcrites alternativement à partir du promoteur distal et du promoteur proximal et deux isoformes « courtes » de 46-48 kDa, dont 64 acides aminés immédiatement positionnés en C- terminal du domaine runt subissent un épissage alternatif. De manière intéressante, les deux couples d’isoformes protéiques, longues et courtes, sont retrouvés avec la même intensité d’expression dans les myoblastes en prolifération et en différenciation (résultats non présentés). Dans mon étude, je n’ai pas étudié l’importance relative de ces isoformes sur la différenciation musculaire en surexprimant l’une ou l’autre dans les myoblastes C2C12. En revanche, dans mes expériences d’ARN interférence, j’ai testé un oligonucléotide ciblant uniquement les deux isoformes longues de Runx1, mais pas les deux courtes. De manière surprenante, alors que les ARNi visant l’ensemble des quatre isoformes donne un phénotype stimulant la différenciation musculaire, les ARNi ciblant uniquement les isoformes longues ne stimulent pas la différenciation. Le phénotype de ces myoblastes est un blocage de la prolifération observé en culture cellulaire. D’ailleurs, il est fort probable que l’absence de différenciation soit notamment dû au fait que les myoblastes n’arrivent jamais à confluence pour entrer efficacement dans le programme de différenciation terminale et fusionner entre eux. L’analyse du cycle cellulaire de ces mêmes myoblastes par FACS, révèle en effet que la diminution des deux isoformes longues se traduit par une accumulation significative des cellules en phase G1, montrant que la transition G1/S est bloquée dans ces cellules (résultats non présentés). De ce fait, dans les myoblastes murins C2C12, les isoformes longues stimuleraient particulièrement la prolifération cellulaire et la diminution de l’ensemble des isoformes permettrait malgré tout aux myoblastes de continuer à proliférer jusqu’à atteindre la confluence. Il n’est pas exclu qu’en plus de stimuler la prolifération des myoblastes, le couple d’isoformes longues puisse également intervenir pour inhiber l’expression des marqueurs musculaires. Pour valider cela, il serait judicieux de diminuer les deux isoformes longues par ARNi lorsque les myoblastes sont déjà subconfluents et pratiquement sortis du cycle cellulaire pour contrôler l’effet de la diminution de ces isoformes longues de Runx1 sur l’expression des marqueurs musculaires. De plus, il serait intéressant d’établir des lignées de myoblastes exprimant soit l’isoforme longue, soit l’isoforme courte de Runx1 et définir indépendamment leur rôle sur la prolifération des myoblastes et sur leur différenciation terminale. De même, il serait intéressant d’étudier le recrutement plus ou moins efficace de la protéine CBFβ en fonction d’une isoforme ou d’une autre pour la formation d’un facteur de
- 129. 92 transcription CBF actif.La purification et l’identification des partenaires protéiques de CBF constitué de l’une ou l’autre des isoformes de Runx1 apporterait des informations indispensables pour comprendre le rôle différentiel d’une isoforme par rapport à une autre. Enfin, dans mon étude j’ai montré l’interaction de MyoD et Runx1 et il serait intéressant de voir si une isoforme interagit préférentiellement avec MyoD et sur les gènes cibles de MyoD dans les myoblastes en prolifération. L’objectif ici serait de discriminer le rôle de CBF clairement associé à la prolifération des myoblastes et son rôle clairement associé à la différenciation musculaire, s’il y a lieu.
- 130. Figure 24. Représentationdes rôles possibles pour MyoD, Runx1 et CBFβ dans le muscle présentés dans la discussion. A) MyoD et CBF pourraient stimuler ensemble la transdifférenciation des myoblastes en ostéoblastes. B) MyoD et CBF auraient une fonction antagoniste sur la prolifération cellulaire et enfin, C) CBF inhiberait l’activation des gènes spécifiques du muscle au cours de la différenciation terminale. ostéoblaste Myotube précoce Myoblastes en prolifération Myocytes alignés Sortie du cycle prolifératif Expression des gènes spécifiques du muscle & fusion Runx1 CBFβ MYOD Transdifférenciationostéogénique A B C
- 131. 93 Modélisation & Conclusion L’ensemble desrésultats de mon étude confrontés à la littérature, me permet d’envisager plusieurs rôles pour le facteur dimérique CBF. Tout d’abord, il pourrait y avoir une fonction antagoniste entre Runx1 et MyoD au cours du cycle cellulaire. Le premier favorisant la prolifération cellulaire, l’autre stimulant la différenciation des myoblastes. Au cours de la différenciation musculaire terminale, Runx1 aurait également un rôle répresseur pour l’activation des gènes cibles de MyoD, bloquant ainsi la différenciation musculaire à deux niveau : au moment de la sortie du cycle cellulaire et pour l’expression des gènes spécifiques du muscle. Pour affiner ce double rôle, il serait intéressant d’étudier l’expression des différentes isoformes de Runx1 et voir si certaines isoformes régulent préférentiellement une étape ou une autre de la différenciation musculaire terminale. Par ailleurs, Runx1 et MyoD étant impliqués dans la différenciation ostéogénique, il serait intéressant de voir si lorsque la différenciation musculaire est bloquée par la surexpression de la sous-unité CBFβ, Runx2 pourrait être exprimé en stimulant ainsi la différenciation ostéogénique. Ce modèle est présenté dans la figure 24. Ce modèle fait de Runx1/CBFβ un régulateur puissant de l’équilibre prolifération-différenciation dans le muscle et du destin cellulaire en général. Pour tester ce modèle, les expériences proposées dans les parties « Discussion des Résultats » et « Discussion Générale & Perspectives » devront être réalisées. L’élucidation du rôle du facteur CBF reste un petit pas dans l’avancée des recherches qui permettront de décrypter comment l’équilibre prolifération-différenciation est régulé dans le muscle. En effet, les partenaires protéiques de MyoD, directs ou indirects, restent nombreux à caractériser. Il est donc important de replacer mon projet de thèse dans le cadre d’un projet plus général à l’initiative du Dr Slimane Ait-Si-Ali au laboratoire. Ce projet beaucoup plus ambitieux vise à proposer un système intégré reprenant les différents éléments de la différenciation musculaire squelettique, en incorporant les différents partenaires de MyoD et en analysant leurs fonctions sur l’activation de l’ensemble des gènes cibles de MyoD (figure 25).
- 132. Figure 25. Diagrammedu projet de recherche proposé par le Dr Slimane AIT-SI-ALI en 2005. Résine anti-HA Élution par compétition avec le peptide Flag Flag epitope HA epitope MyoD Analyse des partenaires protéiques de MyoD par spectrométrie de masse Purification TAP-TAG du complexe MyoD Analyse des gènes cibles de MyoD par TA-cloning Validation fonctionnelle par ARN interférence dans les myoblastes C2C12 Résine anti-Flag Élution par compétition avec le peptide HA Cartographie épigénétique des gènes cibles de MyoD au cours de la différenciation musculaire Caractérisation du rôle des protéines candidates dans les myoblastes C2C12 Validation des candidats dans la transdifférenciation de cellules non- musculaires Cartographie épigénétique des gènes cibles de MyoD au cours de la transdifférenciation de cellules non-musculaires Identification des protéines indispensables au remodelage épigénétique des gènes cibles de MyoD
- 133. 94 En revenant ànotre objectif de départ sur l’identification et la compréhension du rôle des partenaires de MyoD au cours de la différenciation musculaire, la poursuite de cette étude passe par l’investigation des autres partenaires potentiels de MyoD identifiés par spectrométrie de masse. Une autre étude de notre groupe a d’ailleurs été publiée, suite à l’identification des trois isoformes la protéine HP1 (Heterochromatin Protein 1) du sein du complexe MyoD et la validation de leurs rôles respectifs au cours de la différenciation musculaire (Yahi et al, 2008). D’ailleurs, pour un certain nombre de partenaires potentiels de MyoD, nous avons constitué une banque de ARN interférents, pour valider (ou invalider) leur rôle dans le système musculaire. Au cours de mes années de thèse, j’ai ainsi notamment amorcé et préparé un projet de recherche sur l’étude du rôle du complexe de remodelage de la chromatine SWI/SNF au cours de la différenciation musculaire. La prochaine étape de ce projet mettra l'accent sur la sous-unité SNF5 (en parallèle des autres sous-unités du complexe SWI/SNF), car j’ai obtenu des résultats préliminaires intéressants au cours de la différenciation et la transdifférenciation musculaire (ce travail sera terminé par une autre personne après mon départ du laboratoire). Un autre volet de recherche que j’ai amorcé lors de ma thèse est la cartographie épigénétique des gènes cibles de MyoD au cours de la différenciation et de la transdifférenciation musculaire. Le but ici est de comprendre au niveau épigénétique la « force » de transactivation de MyoD dans différents contextes cellulaires. Pour cela, j’ai constitué un panel de lignées cellulaires exprimant MyoD de manière inductible. En collaboration avec le laboratoire du Dr El-Osta (Australie), j’ai commencé à établir une cartographie épigénétique de la transdifférenciation musculaire. À plus long terme, l’objectif est de voir si les partenaires de MyoD validés dans le système musculaire sont également indispensables lors de la transdifférenciation de cellules non-musculaires. Ensemble, ces axes de recherche apportent des informations différentes mais complémentaires qui doivent être analysées dans leur ensemble pour permettre de proposer un système intégré reprenant l’ensemble des coactivateurs et corépresseurs de MyoD pour réguler la transition prolifération-différenciation dans le muscle squelettique.
- 134. 95 Références Bibliographiques Adya N, CastillaLH, Liu PP (2000) Function of CBFbeta/Bro proteins. Semin Cell Dev Biol 11(5): 361-368 Aikawa Y, Nguyen LA, Isono K, Takakura N, Tagata Y, Schmitz ML, Koseki H, Kitabayashi I (2006) Roles of HIPK1 and HIPK2 in AML1- and p300-dependent transcription, hematopoiesis and blood vessel formation. Embo J 25(17): 3955-3965 Angerer LM, Oleksyn DW, Logan CY, McClay DR, Dale L, Angerer RC (2000) A BMP pathway regulates cell fate allocation along the sea urchin animal-vegetal embryonic axis. Development 127(5): 1105-1114 Arber S, Halder G, Caroni P (1994) Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79(2): 221-231 Aronson BD, Fisher AL, Blechman K, Caudy M, Gergen JP (1997) Groucho-dependent and - independent repression activities of Runt domain proteins. Mol Cell Biol 17: 5581 - 5587 Aurade F, Pinset C, Chafey P, Gros F, Montarras D (1994) Myf5, MyoD, myogenin and MRF4 myogenic derivatives of the embryonic mesenchymal cell line C3H10T1/2 exhibit the same adult muscle phenotype. Differentiation 55(3): 185-192 Avraham KB, Levanon D, Negreanu V, Bernstein Y, Groner Y, Copeland NG, Jenkins NA (1995) Mapping of the mouse homolog of the human runt domain gene, AML2, to the distal region of mouse chromosome 4. Genomics 25(2): 603-605 Bae SC, Takahashi E, Zhang YW, Ogawa E, Shigesada K, Namba Y, Satake M, Ito Y (1995) Cloning, mapping and expression of PEBP2 alpha C, a third gene encoding the mammalian Runt domain. Gene 159(2): 245-248 Banerjee C, Javed A, Choi JY, Green J, Rosen V, van Wijnen AJ, Stein JL, Lian JB, Stein GS (2001) Differential regulation of the two principal Runx2/Cbfa1 n-terminal isoforms in response to bone morphogenetic protein-2 during development of the osteoblast phenotype. Endocrinology 142(9): 4026-4039 Bangsow C, Rubins N, Glusman G, Bernstein Y, Negreanu V, Goldenberg D, Lotem J, Ben- Asher E, Lancet D, Levanon D, Groner Y (2001) The RUNX3 gene--sequence, structure and regulated expression. Gene 279: 221 - 232 Batt J, Bain J, Goncalves J, Michalski B, Plant P, Fahnestock M, Woodgett J (2005) Differential gene expression profiling of short and long term denervated muscle. FASEB J: 04- 3640fje Benezra R, Davis RL, Lassar A, Tapscott S, Thayer M, Lockshon D, Weintraub H (1990a) Id: a negative regulator of helix-loop-helix DNA binding proteins. Control of terminal myogenic differentiation. Ann N Y Acad Sci 599: 1-11 Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H (1990b) The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61(1): 49-59
- 135. 96 Bergstrom DA, PennBH, Strand A, Perry RL, Rudnicki MA, Tapscott SJ (2002) Promoter- specific regulation of MyoD binding and signal transduction cooperate to pattern gene expression. Mol Cell 9(3): 587-600 Bergstrom DA, Tapscott SJ (2001) Molecular distinction between specification and differentiation in the myogenic basic helix-loop-helix transcription factor family. Mol Cell Biol 21(7): 2404-2412 Berkes CA, Bergstrom DA, Penn BH, Seaver KJ, Knoepfler PS, Tapscott SJ (2004) Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol Cell 14(4): 465-477 Bernardin-Fried F, Kummalue T, Leijen S, Collector MI, Ravid K, Friedman AD (2004) AML1/RUNX1 increases during G1 to S cell cycle progression independent of cytokine- dependent phosphorylation and induces cyclin D3 gene expression. J Biol Chem 279(15): 15678-15687 Biggs JR, Peterson LF, Zhang Y, Kraft AS, Zhang DE (2006) AML1/RUNX1 phosphorylation by cyclin-dependent kinases regulates the degradation of AML1/RUNX1 by the anaphase-promoting complex. Mol Cell Biol 26(20): 7420-7429 Biggs JR, Zhang Y, Peterson LF, Garcia M, Zhang DE, Kraft AS (2005) Phosphorylation of AML1/RUNX1 regulates its degradation and nuclear matrix association. Mol Cancer Res 3(7): 391-401 Black BL, Martin JF, Olson EN (1995) The mouse MRF4 promoter is trans-activated directly and indirectly by muscle-specific transcription factors. J Biol Chem 270(7): 2889-2892 Black BL, Olson EN (1998) TRANSCRIPTIONAL CONTROL OF MUSCLE DEVELOPMENT BY MYOCYTE ENHANCER FACTOR-2 (MEF2) PROTEINS. Annual Review of Cell and Developmental Biology 14(1): 167-196 Blackwell TK, Weintraub H (1990) Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science 250(4984): 1104-1110 Blau HM, Pavlath GK, Hardeman EC, Chiu CP, Silberstein L, Webster SG, Miller SC, Webster C (1985) Plasticity of the differentiated state. Science 230(4727): 758-766 Borisov AB, Dedkov EI, Carlson BM (2005) Abortive myogenesis in denervated skeletal muscle: differentiative properties of satellite cells, their migration, and block of terminal differentiation. Anat Embryol (Berl) 209(4): 269-279 Bour BA, O'Brien MA, Lockwood WL, Goldstein ES, Bodmer R, Taghert PH, Abmayr SM, Nguyen HT (1995) Drosophila MEF2, a transcription factor that is essential for myogenesis. Genes Dev 9(6): 730-741 Braun T, Arnold HH (1996) Myf-5 and myoD genes are activated in distinct mesenchymal stem cells and determine different skeletal muscle cell lineages. Embo J 15(2): 310-318 Braun T, Buschhausen-Denker G, Bober E, Tannich E, Arnold HH (1989) A novel human muscle factor related to but distinct from MyoD1 induces myogenic conversion in 10T1/2 fibroblasts. EMBO J 8(3): 701-709 Bravo J, Li Z, Speck NA, Warren AJ (2001) The leukemia-associated AML1 (Runx1)--CBF beta complex functions as a DNA-induced molecular clamp. Nat Struct Biol 8(4): 371 - 378 Breitschopf K, Bengal E, Ziv T, Admon A, Ciechanover A (1998) A novel site for ubiquitination: the N-terminal residue, and not internal lysines of MyoD, is essential for conjugation and degradation of the protein. Embo J 17(20): 5964-5973
- 136. 97 Brennan TJ, ChakrabortyT, Olson EN (1991) Mutagenesis of the myogenin basic region identifies an ancient protein motif critical for activation of myogenesis. Proc Natl Acad Sci U S A 88(13): 5675-5679 Buckingham M (2001) Skeletal muscle formation in vertebrates. Curr Opin Genet Dev 11(4): 440- 448 Buckingham M (2007) Skeletal muscle progenitor cells and the role of Pax genes. Comptes Rendus Biologies 330(6-7): 530-533 Calabi F, Rhodes M, Williamson P, Boyd Y (1995) Identification and chromosomal mapping of a third mouse runt-like locus. Genomics 26(3): 607-610 Canon J, Banerjee U (2003) In vivo analysis of a developmental circuit for direct transcriptional activation and repression in the same cell by a Runx protein. Genes Dev 17(7): 838-843 Cao W, Britos-Bray M, Claxton DF, Kelley CA, Speck NA, Liu PP, Friedman AD (1997) CBF beta-SMMHC, expressed in M4Eo AML, reduced CBF DNA-binding and inhibited the G1 to S cell cycle transition at the restriction point in myeloid and lymphoid cells. Oncogene 15(11): 1315 - 1327 Caretti G, Di Padova M, Micales B, Lyons GE, Sartorelli V (2004) The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes Dev 18(21): 2627-2638 Caretti G, Schiltz RL, Dilworth FJ, Di Padova M, Zhao P, Ogryzko V, Fuller-Pace FV, Hoffman EP, Tapscott SJ, Sartorelli V (2006) The RNA helicases p68/p72 and the noncoding RNA SRA are coregulators of MyoD and skeletal muscle differentiation. Dev Cell 11(4): 547-560 Carey M (1998) The enhanceosome and transcriptional synergy. Cell 92(1): 5-8 Carlson BM, Faulkner JA (1988) Reinnervation of long-term denervated rat muscle freely grafted into an innervated limb. Exp Neurol 102(1): 50-56 Cenciarelli C, De Santa F, Puri PL, Mattei E, Ricci L, Bucci F, Felsani A, Caruso M (1999) Critical role played by cyclin D3 in the MyoD-mediated arrest of cell cycle during myoblast differentiation. Mol Cell Biol 19(7): 5203-5217 Chakraborty S, Sinha KK, Senyuk V, Nucifora G (2003) SUV39H1 interacts with AML1 and abrogates AML1 transactivity. AML1 is methylated in vivo. Oncogene 22(34): 5229-5237 Chan HM, Krstic-Demonacos M, Smith L, Demonacos C, La Thangue NB (2001) Acetylation control of the retinoblastoma tumour-suppressor protein. Nat Cell Biol 3(7): 667-674 Charge SB, Rudnicki MA (2004) Cellular and molecular regulation of muscle regeneration. Physiol Rev 84(1): 209-238 Chellappan SP, Hiebert S, Mudryj M, Horowitz JM, Nevins JR (1991) The E2F transcription factor is a cellular target for the RB protein. Cell 65(6): 1053-1061 Chen G, Fernandez J, Mische S, Courey AJ (1999) A functional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development. Genes Dev 13(17): 2218-2230 Chen SL, Loffler KA, Chen D, Stallcup MR, Muscat GE (2002) The coactivator-associated arginine methyltransferase is necessary for muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J Biol Chem 277(6): 4324-4333 Cheng TC, Wallace MC, Merlie JP, Olson EN (1993) Separable regulatory elements governing myogenin transcription in mouse embryogenesis. Science 261(5118): 215-218
- 137. 98 Chiang W, GreaserML, Lyons GE (2000) Filamin isogene expression during mouse myogenesis. Dev Dyn 217(1): 99-108 Chiba N, Watanabe T, Nomura S, Tanaka Y, Minowa M, Niki M, Kanamaru R, Satake M (1997) Differentiation dependent expression and distinct subcellular localization of the protooncogene product, PEBP2beta/CBFbeta, in muscle development. Oncogene 14(21): 2543-2552 Choi J, Costa ML, Mermelstein CS, Chagas C, Holtzer S, Holtzer H (1990) MyoD converts primary dermal fibroblasts, chondroblasts, smooth muscle, and retinal pigmented epithelial cells into striated mononucleated myoblasts and multinucleated myotubes. Proc Natl Acad Sci U S A 87(20): 7988-7992 Choi JY, Pratap J, Javed A, Zaidi SK, Xing L, Balint E, Dalamangas S, Boyce B, van Wijnen AJ, Lian JB, Stein JL, Jones SN, Stein GS (2001) Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc Natl Acad Sci U S A 98(15): 8650-8655 Clayton AL, Rose S, Barratt MJ, Mahadevan LC (2000) Phosphoacetylation of histone H3 on c- fos- and c-jun-associated nucleosomes upon gene activation. EMBO J 19(14): 3714-3726 Coffman JA (2003) Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell Biology International 27(4): 315-324 Cox DM, Du M, Marback M, Yang EC, Chan J, Siu KW, McDermott JC (2003) Phosphorylation motifs regulating the stability and function of myocyte enhancer factor 2A. J Biol Chem 278(17): 15297-15303 Crameri RM, Langberg H, Magnusson P, Jensen CH, Schroder HD, Olesen JL, Suetta C, Teisner B, Kjaer M (2004) Changes in satellite cells in human skeletal muscle after a single bout of high intensity exercise. J Physiol 558(Pt 1): 333-340 Crescenzi M, Fleming TP, Lassar AB, Weintraub H, Aaronson SA (1990) MyoD induces growth arrest independent of differentiation in normal and transformed cells. Proc Natl Acad Sci U S A 87(21): 8442-8446 Crute BE, Lewis AF, Wu Z, Bushweller JH, Speck NA (1996) Biochemical and Biophysical Properties of the Core-binding Factor alpha 2 (AML1) DNA-binding Domain. J Biol Chem 271(42): 26251-26260 Cserjesi P, Olson EN (1991) Myogenin induces the myocyte-specific enhancer binding factor MEF-2 independently of other muscle-specific gene products. Mol Cell Biol 11(10): 4854- 4862 Dacwag CS, Ohkawa Y, Pal S, Sif S, Imbalzano AN (2007) The Protein Arginine Methyltransferase Prmt5 Is Required for Myogenesis because It Facilitates ATP- Dependent Chromatin Remodeling. Mol Cell Biol 27(1): 384-394 Davis RL, Cheng PF, Lassar AB, Weintraub H (1990) The MyoD DNA binding domain contains a recognition code for muscle-specific gene activation. Cell 60(5): 733-746 Davis RL, Weintraub H, Lassar AB (1987) Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51(6): 987-1000 De Falco G, Comes F, Simone C (2006) pRb: master of differentiation. Coupling irreversible cell cycle withdrawal with induction of muscle-specific transcription. Oncogene 25(38): 5244- 5249 de la Serna IL, Carlson KA, Imbalzano AN (2001a) Mammalian SWI/SNF complexes promote MyoD-mediated muscle differentiation. Nat Genet 27(2): 187-190
- 138. 99 de la SernaIL, Ohkawa Y, Berkes CA, Bergstrom DA, Dacwag CS, Tapscott SJ, Imbalzano AN (2005) MyoD targets chromatin remodeling complexes to the myogenin locus prior to forming a stable DNA-bound complex. Mol Cell Biol 25(10): 3997-4009 de la Serna IL, Roy K, Carlson KA, Imbalzano AN (2001b) MyoD can induce cell cycle arrest but not muscle differentiation in the presence of dominant negative SWI/SNF chromatin remodeling enzymes. J Biol Chem 276(44): 41486-41491 Dedieu S, Mazeres G, Cottin P, Brustis JJ (2002) Involvement of myogenic regulator factors during fusion in the cell line C2C12. Int J Dev Biol 46(2): 235-241 Delgado I, Huang X, Jones S, Zhang L, Hatcher R, Gao B, Zhang P (2003) Dynamic gene expression during the onset of myoblast differentiation in vitro. Genomics 82(2): 109-121 Dilworth FJ, Seaver KJ, Fishburn AL, Htet SL, Tapscott SJ (2004) In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47- dependent transactivation. Proc Natl Acad Sci U S A 101(32): 11593-11598 Dressel U, Bailey PJ, Wang SC, Downes M, Evans RM, Muscat GE (2001) A dynamic role for HDAC7 in MEF2-mediated muscle differentiation. J Biol Chem 276(20): 17007-17013 Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G (1997) Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89(5): 747 - 754 Duquet A, Polesskaya A, Cuvellier S, Ait-Si-Ali S, Hery P, Pritchard LL, Gerard M, Harel-Bellan A (2006) Acetylation is important for MyoD function in adult mice. EMBO Rep 7(11): 1140-1146 Durst KL, Lutterbach B, Kummalue T, Friedman AD, Hiebert SW (2003) The inv(16) fusion protein associates with corepressors via a smooth muscle myosin heavy-chain domain. Mol Cell Biol 23(2): 607-619 Edmondson DG, Cheng TC, Cserjesi P, Chakraborty T, Olson EN (1992) Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol Cell Biol 12(9): 3665-3677 Edmondson DG, Olson EN (1989) A gene with homology to the myc similarity region of MyoD1 is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev 3(5): 628-640 Edmondson DG, Olson EN (1993) Helix-loop-helix proteins as regulators of muscle-specific transcription. J Biol Chem 268(2): 755-758 El Messaoudi S, Fabbrizio E, Rodriguez C, Chuchana P, Fauquier L, Cheng D, Theillet C, Vandel L, Bedford MT, Sardet C (2006) Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive regulator of the Cyclin E1 gene. Proc Natl Acad Sci U S A 103(36): 13351-13356 Ferguson EL, Anderson KV (1992) Decapentaplegic acts as a morphogen to organize dorsal- ventral pattern in the Drosophila embryo. Cell 71(3): 451-461 Floyd ZE, Trausch-Azar JS, Reinstein E, Ciechanover A, Schwartz AL (2001) The nuclear ubiquitin-proteasome system degrades MyoD. J Biol Chem 276(25): 22468-22475 Franklin DS, Xiong Y (1996) Induction of p18INK4c and its predominant association with CDK4 and CDK6 during myogenic differentiation. Mol Biol Cell 7(10): 1587-1599 Fujimura FK, Deininger PL, Friedmann T, Linney E (1981) Mutation near the polyoma DNA replication origin permits productive infection of F9 embryonal carcinoma cells. Cell 23(3): 809-814
- 139. 100 Fujita Y, NishimuraM, Taniwaki M, Abe T, Okuda T (2001) Identification of an Alternatively Spliced Form of the Mouse AML1/RUNX1 Gene Transcript AML1c and Its Expression in Early Hematopoietic Development. Biochemical and Biophysical Research Communications 281(5): 1248-1255 Fulco M, Schiltz RL, Iezzi S, King MT, Zhao P, Kashiwaya Y, Hoffman E, Veech RL, Sartorelli V (2003) Sir2 regulates skeletal muscle differentiation as a potential sensor of the redox state. Mol Cell 12(1): 51-62 Furukawa K, Yamaguchi Y, Ogawa E, Shigesada K, Satake M, Ito Y (1990) A ubiquitous repressor interacting with an F9 cell-specific silencer and its functional suppression by differentiated cell-specific positive factors. Cell Growth Differ 1(3): 135-147 Gerber AN, Klesert TR, Bergstrom DA, Tapscott SJ (1997) Two domains of MyoD mediate transcriptional activation of genes in repressive chromatin: a mechanism for lineage determination in myogenesis. Genes Dev 11(4): 436-450 Gersbach CA, Byers BA, Pavlath GK, Garcia AJ (2004) Runx2/Cbfa1 stimulates transdifferentiation of primary skeletal myoblasts into a mineralizing osteoblastic phenotype. Exp Cell Res 300(2): 406-417 Giacinti C, Bagella L, Puri PL, Giordano A, Simone C (2006) MyoD recruits the cdk9/cyclin T2 complex on myogenic-genes regulatory regions. J Cell Physiol 206(3): 807-813 Giese K, Kingsley C, Kirshner JR, Grosschedl R (1995) Assembly and function of a TCR alpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein- protein interactions. Genes Dev 9(8): 995-1008 Gilmour BP, Fanger GR, Newton C, Evans SM, Gardner PD (1991) Multiple binding sites for myogenic regulatory factors are required for expression of the acetylcholine receptor gamma-subunit gene. J Biol Chem 266(30): 19871-19874 Gong XQ, Li L (2002) Dermo-1, a Multifunctional Basic Helix-Loop-Helix Protein, Represses MyoD Transactivation via the HLH Domain, MEF2 Interaction, and Chromatin Deacetylation. J Biol Chem 277(14): 12310-12317 Gonzalez de Aguilar JL, Niederhauser-Wiederkehr C, Halter B, De Tapia M, Di Scala F, Demougin P, Dupuis L, Primig M, Meininger V, Loeffler JP (2008) Gene profiling of skeletal muscle in an amyotrophic lateral sclerosis mouse model. Physiol Genomics 32(2): 207-218 Gossett LA, Kelvin DJ, Sternberg EA, Olson EN (1989) A new myocyte-specific enhancer- binding factor that recognizes a conserved element associated with multiple muscle- specific genes. Mol Cell Biol 9(11): 5022-5033 Growney JD, Shigematsu H, Li Z, Lee BH, Adelsperger J, Rowan R, Curley DP, Kutok JL, Akashi K, Williams IR, Speck NA, Gilliland DG (2005) Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype. Blood 106(2): 494 - 504 Gu W, Schneider JW, Condorelli G, Kaushal S, Mahdavi V, Nadal-Ginard B (1993) Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation. Cell 72(3): 309-324 Guo K, Walsh K (1997) Inhibition of myogenesis by multiple cyclin-Cdk complexes. Coordinate regulation of myogenesis and cell cycle activity at the level of E2F. J Biol Chem 272(2): 791-797
- 140. 101 Guo K, WangJ, Andres V, Smith RC, Walsh K (1995) MyoD-induced expression of p21 inhibits cyclin-dependent kinase activity upon myocyte terminal differentiation. Mol Cell Biol 15(7): 3823-3829 Hajra A, Collins FS (1995) Structure of the leukemia-associated human CBFB gene. Genomics 26(3): 571-579 Hajra A, Liu PP, Speck NA, Collins FS (1995) Overexpression of core-binding factor alpha (CBF alpha) reverses cellular transformation by the CBF beta-smooth muscle myosin heavy chain chimeric oncoprotein. Mol Cell Biol 15(9): 4980-4989 Halevy O, Novitch BG, Spicer DB, Skapek SX, Rhee J, Hannon GJ, Beach D, Lassar AB (1995) Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD. Science 267(5200): 1018-1021 Hamamori Y, Wu HY, Sartorelli V, Kedes L (1997) The basic domain of myogenic basic helix- loop-helix (bHLH) proteins is the novel target for direct inhibition by another bHLH protein, Twist. Mol Cell Biol 17(11): 6563-6573 Hanai J-i, Chen LF, Kanno T, Ohtani-Fujita N, Kim WY, Guo W-H, Imamura T, Ishidou Y, Fukuchi M, Shi M-J, Stavnezer J, Kawabata M, Miyazono K, Ito Y (1999) Interaction and Functional Cooperation of PEBP2/CBF with Smads. SYNERGISTIC INDUCTION OF THE IMMUNOGLOBULIN GERMLINE Calpha PROMOTER. J Biol Chem 274(44): 31577-31582 Hashimoto N, Kiyono T, Wada MR, Umeda R, Goto Y, Nonaka I, Shimizu S, Yasumoto S, Inagawa-Ogashiwa M (2008) Osteogenic properties of human myogenic progenitor cells. Mech Dev 125(3-4): 257-269 Helin K (1998) Regulation of cell proliferation by the E2F transcription factors. Curr Opin Genet Dev 8(1): 28-35 Hernandez-Munain C, Krangel MS (1995) c-Myb and core-binding factor/PEBP2 display functional synergy but bind independently to adjacent sites in the T-cell receptor delta enhancer. Mol Cell Biol 15(6): 3090-3099 Hollenberg SM, Cheng PF, Weintraub H (1993) Use of a conditional MyoD transcription factor in studies of MyoD trans-activation and muscle determination. Proc Natl Acad Sci U S A 90(17): 8028-8032 Huang G, Shigesada K, Ito K, Wee HJ, Yokomizo T, Ito Y (2001) Dimerization with PEBP2beta protects RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. Embo J 20(4): 723 - 733 Huang J, Weintraub H, Kedes L (1998a) Intramolecular regulation of MyoD activation domain conformation and function. Mol Cell Biol 18(9): 5478-5484 Huang X, Crute BE, Sun C, Tang Y-Y, Kelley Iii JJ, Lewis AF, Hartman KL, Laue TM, Speck NA, Bushweller JH (1998b) Overexpression, Purification, and Biophysical Characterization of the Heterodimerization Domain of the Core-binding Factor beta †Subunit. J Biol Chem 273(4): 2480-2487 Huang X, Peng JW, Speck NA, Bushweller JH (1999) Solution structure of core binding factor beta and map of the CBF alpha binding site. Nat Struct Biol 6(7): 624-627 Ichikawa M, Asai T, Saito T, Seo S, Yamazaki I, Yamagata T, Mitani K, Chiba S, Ogawa S, Kurokawa M, Hirai H (2004) AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med 10(3): 299-304
- 141. 102 Imai Y, KurokawaM, Yamaguchi Y, Izutsu K, Nitta E, Mitani K, Satake M, Noda T, Ito Y, Hirai H (2004) The corepressor mSin3A regulates phosphorylation-induced activation, intranuclear location, and stability of AML1. Mol Cell Biol 24(3): 1033-1043 Ishibashi J, Perry RL, Asakura A, Rudnicki MA (2005) MyoD induces myogenic differentiation through cooperation of its NH2- and COOH-terminal regions. J Cell Biol 171(3): 471-482 Ishido M, Kami K, Masuhara M (2004) In vivo expression patterns of MyoD, p21, and Rb proteins in myonuclei and satellite cells of denervated rat skeletal muscle. Am J Physiol Cell Physiol 287(2): C484-493 Ito T, Ikehara T, Nakagawa T, Kraus WL, Muramatsu M (2000) p300-mediated acetylation facilitates the transfer of histone H2A-H2B dimers from nucleosomes to a histone chaperone. Genes Dev 14(15): 1899-1907 Ito Y (2008) RUNX genes in development and cancer: regulation of viral gene expression and the discovery of RUNX family genes. Adv Cancer Res 99: 33 - 76 Ito Y, Miyazono K (2003) RUNX transcription factors as key targets of TGF-beta superfamily signaling. Curr Opin Genet Dev 13(1): 43-47 Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA, Stifani S, Stein JL, Lian JB, van Wijnen AJ, Stein GS (2000) Groucho/TLE/R-esp proteins associate with the nuclear matrix and repress RUNX (CBF(alpha)/AML/PEBP2(alpha)) dependent activation of tissue-specific gene transcription. J Cell Sci 113(12): 2221-2231 Jen Y, Weintraub H, Benezra R (1992) Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins. Genes Dev 6(8): 1466-1479 Kagoshima H, Akamatsu Y, Ito Y, Shigesada K (1996) Functional dissection of the alpha and beta subunits of transcription factor PEBP2 and the redox susceptibility of its DNA binding activity. J Biol Chem 271(51): 33074 - 33082 Kagoshima H, Shigesada K, Satake M, Ito Y, Miyoshi H, Ohki M, Pepling M, Gergen P (1993) The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet 9(10): 338-341 Kamachi Y, Ogawa E, Asano M, Ishida S, Murakami Y, Satake M, Ito Y, Shigesada K (1990) Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer. J Virol 64(10): 4808 - 4819 Kania MA, Bonner AS, Duffy JB, Gergen JP (1990) The Drosophila segmentation gene runt encodes a novel nuclear regulatory protein that is also expressed in the developing nervous system. Genes Dev 4(10): 1701-1713 Kanno T, Kanno Y, Chen L-F, Ogawa E, Kim W-Y, Ito Y (1998) Intrinsic Transcriptional Activation-Inhibition Domains of the Polyomavirus Enhancer Binding Protein 2/Core Binding Factor alpha †Subunit Revealed in the Presence of the beta †Subunit. Mol Cell Biol 18(5): 2444-2454 Kassar-Duchossoy L, Gayraud-Morel B, Gomes D, Rocancourt D, Buckingham M, Shinin V, Tajbakhsh S (2004) Mrf4 determines skeletal muscle identity in Myf5:Myod double- mutant mice. Nature 431(7007): 466-471 Katagiri T, Yamaguchi A, Komaki M, Abe E, Takahashi N, Ikeda T, Rosen V, Wozney JM, Fujisawa-Sehara A, Suda T (1994) Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J Cell Biol 127(6 Pt 1): 1755-1766
- 142. 103 Kiess M, GillRM, Hamel PA (1995) Expression of the positive regulator of cell cycle progression, cyclin D3, is induced during differentiation of myoblasts into quiescent myotubes. Oncogene 10(1): 159-166 Kim S, Shilagardi K, Zhang S, Hong SN, Sens KL, Bo J, Gonzalez GA, Chen EH (2007) A critical function for the actin cytoskeleton in targeted exocytosis of prefusion vesicles during myoblast fusion. Dev Cell 12(4): 571-586 Kim WY, Sieweke M, Ogawa E, Wee HJ, Englmeier U, Graf T, Ito Y (1999) Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains. EMBO J 18(6): 1609-1620 Kitabayashi I, Aikawa Y, Nguyen LA, Yokoyama A, Ohki M (2001) Activation of AML1- mediated transcription by MOZ and inhibition by the MOZ-CBP fusion protein. Embo J 20(24): 7184-7196 Kitabayashi I, Yokoyama A, Shimizu K, Ohki M (1998) Interaction and functional cooperation of the leukemia-associated factors AML1 and p300 in myeloid cell differentiation. Embo J 17(11): 2994-3004 Kitzmann M, Fernandez A (2001) Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell Mol Life Sci 58(4): 571-579 Kitzmann M, Vandromme M, Schaeffer V, Carnac G, Labbe JC, Lamb N, Fernandez A (1999) cdk1- and cdk2-mediated phosphorylation of MyoD Ser200 in growing C2 myoblasts: role in modulating MyoD half-life and myogenic activity. Mol Cell Biol 19(4): 3167-3176 Knoepfler PS, Bergstrom DA, Uetsuki T, Dac-Korytko I, Sun YH, Wright WE, Tapscott SJ, Kamps MP (1999) A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with pbx- Meis1/Prep1. Nucleic Acids Res 27(18): 3752-3761 Komaki M, Asakura A, Rudnicki MA, Sodek J, Cheifetz S (2004) MyoD enhances BMP7-induced osteogenic differentiation of myogenic cell cultures. J Cell Sci 117(Pt 8): 1457-1468 Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T (1997) Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89(5): 755 - 764 Kong Y, Flick MJ, Kudla AJ, Konieczny SF (1997) Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD. Mol Cell Biol 17(8): 4750-4760 Kouzarides T (1995) Transcriptional control by the retinoblastoma protein. Semin Cancer Biol 6(2): 91-98 Kuang S, Charge SB, Seale P, Huh M, Rudnicki MA (2006) Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J Cell Biol 172(1): 103-113 Kuang S, Gillespie MA, Rudnicki MA (2008) Niche regulation of muscle satellite cell self-renewal and differentiation. Cell Stem Cell 2(1): 22-31 Kujawa M, Baran W, Jankowska-Steifer E (2004) Morphometric ultrastructural analysis of satellite cells in denervated rat soleus muscle. Exp Mol Pathol 76(2): 166-172 Kujawa M, Baran W, Jankowska-Steifer E (2005) Quantitative ultrastructural changes in satellite cells of rats immobilized after soleus muscle denervation. Exp Mol Pathol 78(1): 78-85 Kummalue T, Lou J, Friedman AD (2002) Multimerization via its myosin domain facilitates nuclear localization and inhibition of core binding factor (CBF) activities by the CBFbeta-
- 143. 104 smooth muscle myosinheavy chain myeloid leukemia oncoprotein. Mol Cell Biol 22(23): 8278-8291 Kurokawa M, Tanaka T, Tanaka K, Ogawa S, Mitani K, Yazaki Y, Hirai H (1996) Overexpression of the AML1 proto-oncoprotein in NIH3T3 cells leads to neoplastic transformation depending on the DNA-binding and transactivational potencies. Oncogene 12(4): 883-892 Lassar AB, Thayer MJ, Overell RW, Weintraub H (1989) Transformation by activated ras or fos prevents myogenesis by inhibiting expression of MyoD1. Cell 58(4): 659-667 Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, Goldberg AL (2004) Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 18(1): 39-51 Lee KS, Kim HJ, Li QL, Chi XZ, Ueta C, Komori T, Wozney JM, Kim EG, Choi JY, Ryoo HM, Bae SC (2000) Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol 20(23): 8783-8792 Leibham D, Wong MW, Cheng TC, Schroeder S, Weil PA, Olson EN, Perry M (1994) Binding of TFIID and MEF2 to the TATA element activates transcription of the Xenopus MyoDa promoter. Mol Cell Biol 14(1): 686-699 Lemercier C, To RQ, Carrasco RA, Konieczny SF (1998) The basic helix-loop-helix transcription factor Mist1 functions as a transcriptional repressor of myoD. EMBO J 17(5): 1412-1422 Lenormand JL, Benayoun B, Guillier M, Vandromme M, Leibovitch MP, Leibovitch SA (1997) Mos activates myogenic differentiation by promoting heterodimerization of MyoD and E12 proteins. Mol Cell Biol 17(2): 584-593 Levanon D, Brenner O, Negreanu V, Bettoun D, Woolf E, Eilam R, Lotem J, Gat U, Otto F, Speck N, Groner Y (2001a) Spatial and temporal expression pattern of Runx3 (Aml2) and Runx1 (Aml1) indicates non-redundant functions during mouse embryogenesis. Mech Dev 109: 413 - 417 Levanon D, Glusman G, Bangsow T, Ben-Asher E, Male DA, Avidan N, Bangsow C, Hattori M, Taylor TD, Taudien S, Blechschmidt K, Shimizu N, Rosenthal A, Sakaki Y, Lancet D, Groner Y (2001b) Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene 262: 23 - 33 Levanon D, Glusman G, Bettoun D, Ben-Asher E, Negreanu V, Bernstein Y, Harris-Cerruti C, Brenner O, Eilam R, Lotem J, Fainaru O, Goldenberg D, Pozner A, Woolf E, Xiao C, Yarmus M, Groner Y (2003) Phylogenesis and regulated expression of the RUNT domain transcription factors RUNX1 and RUNX3. Blood Cells Mol Dis 30(2): 161 - 163 Levanon D, Goldstein RE, Bernstein Y, Tang H, Goldenberg D, Stifani S, Paroush Z, Groner Y (1998) Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc Natl Acad Sci U S A 95(20): 11590 - 11595 Levanon D, Groner Y (2004) Structure and regulated expression of mammalian RUNX genes. Oncogene 23: 4211 - 4219 Levanon D, Negreanu V, Bernstein Y, Bar-Am I, Avivi L, Groner Y (1994) AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization. Genomics 23(2): 425-432
- 144. 105 Li QL, ItoK, Sakakura C, Fukamachi H, Inoue K, Chi XZ, Lee KY, Nomura S, Lee CW, Han SB, Kim HM, Kim WJ, Yamamoto H, Yamashita N, Yano T, Ikeda T, Itohara S, Inazawa J, Abe T, Hagiwara A, Yamagishi H, Ooe A, Kaneda A, Sugimura T, Ushijima T, Bae SC, Ito Y (2002) Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 109: 113 - 124 Lian JB, Balint E, Javed A, Drissi H, Vitti R, Quinlan EJ, Zhang L, Van Wijnen AJ, Stein JL, Speck N, Stein GS (2003) Runx1/AML1 hematopoietic transcription factor contributes to skeletal development in vivo. J Cell Physiol 196(2): 301-311 Licht AH, Pein OT, Florin L, Hartenstein B, Reuter H, Arnold B, Lichter P, Angel P, Schorpp- Kistner M (2006) JunB is required for endothelial cell morphogenesis by regulating core- binding factor {beta}. J Cell Biol 175(6): 981-991 Lilly B, Zhao B, Ranganayakulu G, Paterson BM, Schulz RA, Olson EN (1995) Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila. Science 267(5198): 688-693 Liu H, Carlsson L, Grundstrom T (2006) Identification of an N-terminal Transactivation Domain of Runx1 That Separates Molecular Function from Global Differentiation Function. J Biol Chem 281(35): 25659-25669 Liu P, Tarle SA, Hajra A, Claxton DF, Marlton P, Freedman M, Siciliano MJ, Collins FS (1993) Fusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia. Science 261(5124): 1041-1044 Lou J, Cao W, Bernardin F, Ayyanathan K, Rauscher IF, Friedman AD (2000) Exogenous cdk4 overcomes reduced cdk4 RNA and inhibition of G1 progression in hematopoietic cells expressing a dominant-negative CBF - a model for overcoming inhibition of proliferation by CBF oncoproteins. Oncogene 19(22): 2695-2703 Lu J, Maruyama M, Satake M, Bae SC, Ogawa E, Kagoshima H, Shigesada K, Ito Y (1995) Subcellular localization of the alpha and beta subunits of the acute myeloid leukemia- linked transcription factor PEBP2/CBF. Mol Cell Biol 15(3): 1651-1661 Lu J, McKinsey TA, Zhang CL, Olson EN (2000) Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol Cell 6(2): 233-244 Lu J, Webb R, Richardson JA, Olson EN (1999) MyoR: a muscle-restricted basic helix-loop-helix transcription factor that antagonizes the actions of MyoD. Proc Natl Acad Sci U S A 96(2): 552-557 Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E, Hiebert SW (2000) A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J Biol Chem 275(1): 651-656 Magenta A, Cenciarelli C, De Santa F, Fuschi P, Martelli F, Caruso M, Felsani A (2003) MyoD stimulates RB promoter activity via the CREB/p300 nuclear transduction pathway. Mol Cell Biol 23(8): 2893-2906 Magnusson C, Svensson A, Christerson U, Tagerud S (2005) Denervation-induced alterations in gene expression in mouse skeletal muscle. Eur J Neurosci 21(2): 577-580 Mal A, Harter ML (2003) MyoD is functionally linked to the silencing of a muscle-specific regulatory gene prior to skeletal myogenesis. Proc Natl Acad Sci U S A 100(4): 1735-1739
- 145. 106 Mal A, SturnioloM, Schiltz RL, Ghosh MK, Harter ML (2001) A role for histone deacetylase HDAC1 in modulating the transcriptional activity of MyoD: inhibition of the myogenic program. Embo J 20(7): 1739-1753 Mal AK (2006) Histone methyltransferase Suv39h1 represses MyoD-stimulated myogenic differentiation. Embo J 25(14): 3323-3334 Martelli F, Cenciarelli C, Santarelli G, Polikar B, Felsani A, Caruso M (1994) MyoD induces retinoblastoma gene expression during myogenic differentiation. Oncogene 9(12): 3579- 3590 Martens JA, Winston F (2003) Recent advances in understanding chromatin remodeling by Swi/Snf complexes. Current Opinion in Genetics & Development 13(2): 136-142 McKinsey TA, Zhang CL, Olson EN (2000) Activation of the myocyte enhancer factor-2 transcription factor by calcium/calmodulin-dependent protein kinase-stimulated binding of 14-3-3 to histone deacetylase 5. Proc Natl Acad Sci U S A 97(26): 14400-14405 McKinsey TA, Zhang CL, Olson EN (2001) Identification of a signal-responsive nuclear export sequence in class II histone deacetylases. Mol Cell Biol 21(18): 6312-6321 McLarren KW, Lo R, Grbavec D, Thirunavukkarasu K, Karsenty G, Stifani S (2000) The Mammalian Basic Helix Loop Helix Protein HES-1 Binds to and Modulates the Transactivating Function of the Runt-related Factor Cbfa1. J Biol Chem 275(1): 530-538 Megeney LA, Kablar B, Garrett K, Anderson JE, Rudnicki MA (1996) MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev 10(10): 1173-1183 Mesires NT, Doumit ME (2002) Satellite cell proliferation and differentiation during postnatal growth of porcine skeletal muscle. Am J Physiol Cell Physiol 282(4): C899-906 Michaud J, Scott HS, Escher R (2003) AML1 interconnected pathways of leukemogenesis. Cancer Invest 21(1): 105 - 136 Miller JD, Stacy T, Liu PP, Speck NA (2001) Core-binding factor beta (CBFbeta), but not CBFbeta-smooth muscle myosin heavy chain, rescues definitive hematopoiesis in CBFbeta-deficient embryonic stem cells. Blood 97(8): 2248-2256 Mittnacht S (1998) Control of pRB phosphorylation. Curr Opin Genet Dev 8(1): 21-27 Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, Yokoyama K, Soeda E, Ohki M (1995) Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res 23(14): 2762-2769 Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohki M (1991) t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad Sci U S A 88: 10431 - 10434 Molkentin JD, Black BL, Martin JF, Olson EN (1995) Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 83(7): 1125-1136 Molkentin JD, Olson EN (1996) Combinatorial control of muscle development by basic helix- loop-helix and MADS-box transcription factors. Proc Natl Acad Sci U S A 93(18): 9366- 9373 Mulligan G, Jacks T (1998) The retinoblastoma gene family: cousins with overlapping interests. Trends Genet 14(6): 223-229 Murre C, McCaw, P S., Vaessin, H., Gaudy, M.. Jan, L. Y., Jan, Y. N., , Cabrera CV, Buskin, J. N., Hauschka, S. D., Lassar, A. B., Wein- , traub H, and Baltimore, D. (1989) Interactions
- 146. 107 between heterologous helix-loop-helixproteins generate complexes that bind specifically to a common DNA sequence. Cell 58(3): 537-544 Mussini I, Favaro G, Carraro U (1987) Maturation, dystrophic changes and the continuous production of fibers in skeletal muscle regenerating in the absence of nerve. J Neuropathol Exp Neurol 46(3): 315-331 Nagata T, Werner MH (2001) Functional mutagenesis of AML1/RUNX1 and PEBP2 beta/CBF beta define distinct, non-overlapping sites for DNA recognition and heterodimerization by the Runt domain. J Mol Biol 308(2): 191-203 Naidu PS, Ludolph DC, To RQ, Hinterberger TJ, Konieczny SF (1995) Myogenin and MEF2 function synergistically to activate the MRF4 promoter during myogenesis. Mol Cell Biol 15(5): 2707-2718 Nam S, Jin YH, Li QL, Lee KY, Jeong GB, Ito Y, Lee J, Bae SC (2002) Expression pattern, regulation, and biological role of runt domain transcription factor, run, in Caenorhabditis elegans. Mol Cell Biol 22(2): 547-554 Nguyen DX, Baglia LA, Huang SM, Baker CM, McCance DJ (2004) Acetylation regulates the differentiation-specific functions of the retinoblastoma protein. Embo J 23(7): 1609-1618 Niki M, Okada H, Takano H, Kuno J, Tani K, Hibino H, Asano S, Ito Y, Satake M, Noda T (1997) Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc Natl Acad Sci U S A 94(11): 5697-5702 Nimmo R, Antebi A, Woollard A (2005) mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage. Development 132(22): 5043 - 5054 Nishimura M, Fukushima-Nakase Y, Fujita Y, Nakao M, Toda S, Kitamura N, Abe T, Okuda T (2004) VWRPY motif-dependent and -independent roles of AML1/Runx1 transcription factor in murine hematopoietic development. Blood 103: 562 - 570 Nishimura R, Hata K, Harris SE, Ikeda F, Yoneda T (2002) Core-binding factor alpha 1 (Cbfa1) induces osteoblastic differentiation of C2C12 cells without interactions with Smad1 and Smad5. Bone 31(2): 303-312 Norton JD, Deed RW, Craggs G, Sablitzky F (1998) Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol 8(2): 58-65 Novitch BG, Mulligan GJ, Jacks T, Lassar AB (1996) Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J Cell Biol 135(2): 441-456 Novitch BG, Spicer DB, Kim PS, Cheung WL, Lassar AB (1999) pRb is required for MEF2- dependent gene expression as well as cell-cycle arrest during skeletal muscle differentiation. Curr Biol 9(9): 449-459 Nurse P (1994) Ordering S phase and M phase in the cell cycle. Cell 79(4): 547-550 Ogawa E, Inuzuka M, Maruyama M, Satake M, Naito-Fujimoto M, Ito Y, Shigesada K (1993a) Molecular Cloning and Characterization of PEBP2[beta], the Heterodimeric Partner of a Novel Drosophila runt-Related DNA Binding Protein PEBP2[alpha]. Virology 194(1): 314-331 Ogawa E, Maruyama M, Kagoshima H, Inuzuka M, Lu J, Satake M, Shigesada K, Ito Y (1993b) PEBP2/PEA2 represents a family of transcription factors homologous to the products of
- 147. 108 the Drosophila runtgene and the human AML1 gene. Proc Natl Acad Sci USA 90(14): 6859 - 6863 Ogihara H, Kanno T, Morii E, Kim DK, Lee YM, Sato M, Kim WY, Nomura S, Ito Y, Kitamura Y (1999) Synergy of PEBP2/CBF with mi transcription factor (MITF) for transactivation of mouse mast cell protease 6 gene. Oncogene 18(32): 4632-4639 Okada H, Watanabe T, Niki M, Takano H, Chiba N, Yanai N, Tani K, Hibino H, Asano S, Mucenski ML, Ito Y, Noda T, Satake M (1998) AML1(-/-) embryos do not express certain hematopoiesis-related gene transcripts including those of the PU.1 gene. Oncogene 17(18): 2287 - 2293 Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR (1996) AML1, the Target of Multiple Chromosomal Translocations in Human Leukemia, Is Essential for Normal Fetal Liver Hematopoiesis. Cell 84(2): 321-330 Olson EN, Perry M, Schulz RA (1995) Regulation of muscle differentiation by the MEF2 family of MADS box transcription factors. Dev Biol 172(1): 2-14 Ontell M, Kozeka K (1984a) Organogenesis of the mouse extensor digitorum logus muscle: a quantitative study. Am J Anat 171(2): 149-161 Ontell M, Kozeka K (1984b) The organogenesis of murine striated muscle: a cytoarchitectural study. Am J Anat 171(2): 133-148 Osorio KM, Lee SE, McDermitt DJ, Waghmare SK, Zhang YV, Woo HN, Tumbar T (2008) Runx1 modulates developmental, but not injury-driven, hair follicle stem cell activation. Development: dev.012799 Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ (1997) Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89(5): 765 - 771 Palaparti A, Baratz A, Stifani S (1997) The Groucho/transducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3. J Biol Chem 272(42): 26604-26610 Paoni NF, Peale F, Wang F, Errett-Baroncini C, Steinmetz H, Toy K, Bai W, Williams PM, Bunting S, Gerritsen ME, Powell-Braxton L (2002) Time course of skeletal muscle repair and gene expression following acute hind limb ischemia in mice. Physiol Genomics 11(3): 263-272 Parker SB, Eichele G, Zhang P, Rawls A, Sands AT, Bradley A, Olson EN, Harper JW, Elledge SJ (1995) p53-independent expression of p21Cip1 in muscle and other terminally differentiating cells. Science 267(5200): 1024-1027 Parkhurst SM (1998) Groucho: making its Marx as a transcriptional co-repressor. Trends Genet 14(4): 130-132 Peterson LF, Boyapati A, Ranganathan V, Iwama A, Tenen DG, Tsai S, Zhang DE (2005) The hematopoietic transcription factor AML1 (RUNX1) is negatively regulated by the cell cycle protein cyclin D3. Mol Cell Biol 25(23): 10205-10219 Petrovick MS, Hiebert SW, Friedman AD, Hetherington CJ, Tenen DG, Zhang DE (1998) Multiple functional domains of AML1: PU.1 and C/EBPalpha synergize with different regions of AML1. Mol Cell Biol 18(7): 3915-3925
- 148. 109 Piette J, YanivM (1987) Two different factors bind to the alpha-domain of the polyoma virus enhancer, one of which also interacts with the SV40 and c-fos enhancers. EMBO J 6(5): 1331-1337 Polesskaya A, Duquet A, Naguibneva I, Weise C, Vervisch A, Bengal E, Hucho F, Robin P, Harel-Bellan A (2000) CREB-binding protein/p300 activates MyoD by acetylation. J Biol Chem 275(44): 34359-34364 Polesskaya A, Harel-Bellan A (2001) Acetylation of MyoD by p300 requires more than its histone acetyltransferase domain. J Biol Chem 276(48): 44502-44503 Polesskaya A, Naguibneva I, Duquet A, Bengal E, Robin P, Harel-Bellan A (2001a) Interaction between acetylated MyoD and the bromodomain of CBP and/or p300. Mol Cell Biol 21(16): 5312-5320 Polesskaya A, Naguibneva I, Fritsch L, Duquet A, Ait-Si-Ali S, Robin P, Vervisch A, Pritchard LL, Cole P, Harel-Bellan A (2001b) CBP/p300 and muscle differentiation: no HAT, no muscle. EMBO J 20(23): 6816-6825 Pownall ME, Gustafsson MK, Emerson CP, Jr. (2002) Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu Rev Cell Dev Biol 18: 747- 783 Puri PL, Bhakta K, Wood LD, Costanzo A, Zhu J, Wang JY (2002) A myogenic differentiation checkpoint activated by genotoxic stress. Nat Genet 32(4): 585-593 Puri PL, Iezzi S, Stiegler P, Chen TT, Schiltz RL, Muscat GE, Giordano A, Kedes L, Wang JY, Sartorelli V (2001) Class I histone deacetylases sequentially interact with MyoD and pRb during skeletal myogenesis. Mol Cell 8(4): 885-897 Puri PL, Sartorelli V, Yang XJ, Hamamori Y, Ogryzko VV, Howard BH, Kedes L, Wang JY, Graessmann A, Nakatani Y, Levrero M (1997) Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol Cell 1(1): 35-45 Puri PL, Wu Z, Zhang P, Wood LD, Bhakta KS, Han J, Feramisco JR, Karin M, Wang JY (2000) Induction of terminal differentiation by constitutive activation of p38 MAP kinase in human rhabdomyosarcoma cells. Genes Dev 14(5): 574-584 Putz G, Rosner A, Nuesslein I, Schmitz N, Buchholz F (2005) AML1 deletion in adult mice causes splenomegaly and lymphomas. Oncogene 25(6): 929-939 Quelle DE, Ashmun RA, Shurtleff SA, Kato JY, Bar-Sagi D, Roussel MF, Sherr CJ (1993) Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev 7(8): 1559-1571 Racki LR, Narlikar GJ (2008) ATP-dependent chromatin remodeling enzymes: two heads are not better, just different. Curr Opin Genet Dev 18(2): 137-144 Rao SS, Chu C, Kohtz DS (1994) Ectopic expression of cyclin D1 prevents activation of gene transcription by myogenic basic helix-loop-helix regulators. Mol Cell Biol 14(8): 5259-5267 Rao SS, Kohtz DS (1995) Positive and negative regulation of D-type cyclin expression in skeletal myoblasts by basic fibroblast growth factor and transforming growth factor beta. A role for cyclin D1 in control of myoblast differentiation. J Biol Chem 270(8): 4093-4100 Rawls A, Valdez MR, Zhang W, Richardson J, Klein WH, Olson EN (1998) Overlapping functions of the myogenic bHLH genes MRF4 and MyoD revealed in double mutant mice. Development 125(13): 2349-2358
- 149. 110 Reed-Inderbitzin E, Moreno-MirallesI, Vanden-Eynden SK, Xie J, Lutterbach B, Durst- Goodwin KL, Luce KS, Irvin BJ, Cleary ML, Brandt SJ, Hiebert SW (2006) RUNX1 associates with histone deacetylases and SUV39H1 to repress transcription. Oncogene 25(42): 5777-5786 Rennert J, Coffman JA, Mushegian AR, Robertson AJ (2003) The evolution of Runx genes I. A comparative study of sequences from phylogenetically diverse model organisms. BMC Evol Biol 3: 4 Reynaud EG, Leibovitch MP, Tintignac LA, Pelpel K, Guillier M, Leibovitch SA (2000) Stabilization of MyoD by direct binding to p57(Kip2). J Biol Chem 275(25): 18767-18776 Rhodes SJ, Konieczny SF (1989) Identification of MRF4: a new member of the muscle regulatory factor gene family. Genes Dev 3(12B): 2050-2061 Robertson AJ, Coluccio A, Knowlton P, Dickey-Sims C, Coffman JA (2008) Runx expression is mitogenic and mutually linked to Wnt activity in blastula-stage sea urchin embryos. PLoS ONE 3(11): e3770 Robertson AJ, Dickey-Sims C, Ransick A, Rupp DE, McCarthy JJ, Coffman JA (2006) CBFbeta is a facultative Runx partner in the sea urchin embryo. BMC Biol 4: 4 Robertson AJ, Larroux C, Degnan BM, Coffman JA (2009) The evolution of Runx genes II. The C-terminal Groucho recruitment motif is present in both eumetazoans and homoscleromorphs but absent in a haplosclerid demosponge. BMC Res Notes 2: 59 Roy K, de la Serna IL, Imbalzano AN (2002) The myogenic basic helix-loop-helix family of transcription factors shows similar requirements for SWI/SNF chromatin remodeling enzymes during muscle differentiation in culture. J Biol Chem 277(37): 33818-33824 Rudnicki MA, Braun T, Hinuma S, Jaenisch R (1992) Inactivation of MyoD in mice leads to up- regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell 71(3): 383-390 Rudnicki MA, Schnegelsberg PNJ, Stead RH, Braun T, Arnold H-H, Jaenisch R (1993) MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75(7): 1351-1359 Sartorelli V, Huang J, Hamamori Y, Kedes L (1997) Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS box of MEF2C. Mol Cell Biol 17(2): 1010-1026 Sartorelli V, Puri PL, Hamamori Y, Ogryzko V, Chung G, Nakatani Y, Wang JY, Kedes L (1999) Acetylation of MyoD directed by PCAF is necessary for the execution of the muscle program. Mol Cell 4(5): 725-734 Sasai Y, Kageyama R, Tagawa Y, Shigemoto R, Nakanishi S (1992) Two mammalian helix-loop- helix factors structurally related to Drosophila hairy and Enhancer of split. Genes Dev 6(12B): 2620-2634 Sasaki K, Yagi H, Bronson RT, Tominaga K, Matsunashi T, Deguchi K, Tani Y, Kishimoto T, Komori T (1996) Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta. Proc Natl Acad Sci U S A 93(22): 12359-12363 Satake M, Nomura S, Yamaguchi-Iwai Y, Takahama Y, Hashimoto Y, Niki M, Kitamura Y, Ito Y (1995) Expression of the Runt domain-encoding PEBP2 alpha genes in T cells during thymic development. Mol Cell Biol 15(3): 1662-1670 Schmalbruch H, Lewis DM (2000) Dynamics of nuclei of muscle fibers and connective tissue cells in normal and denervated rat muscles. Muscle Nerve 23(4): 617-626
- 150. 111 Schneider JW, GuW, Zhu L, Mahdavi V, Nadal-Ginard B (1994) Reversal of terminal differentiation mediated by p107 in Rb-/- muscle cells. Science 264(5164): 1467-1471 Schultz E, Jaryszak DL, Valliere CR (1985) Response of satellite cells to focal skeletal muscle injury. Muscle Nerve 8(3): 217-222 Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA (2000) Pax7 is required for the specification of myogenic satellite cells. Cell 102(6): 777-786 Sekikawa K, Levine AJ (1981) Isolation and characterization of polyoma host range mutants that replicate in nullipotential embryonal carcinoma cells. Proc Natl Acad Sci U S A 78(2): 1100-1104 Sherr CJ (1994) G1 phase progression: cycling on cue. Cell 79(4): 551-555 Sherr CJ, Roberts JM (1995) Inhibitors of mammalian G1 cyclin-dependent kinases. Genes Dev 9(10): 1149-1163 Sherr CJ, Roberts JM (1999) CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 13(12): 1501-1512 Simeone A, Daga A, Calabi F (1995) Expression of runt in the mouse embryo. Dev Dyn 203: 61 - 70 Simone C, Bagella L, Bellan C, Giordano A (2002a) Physical interaction between pRb and cdk9/cyclinT2 complex. Oncogene 21(26): 4158-4165 Simone C, Forcales SV, Hill DA, Imbalzano AN, Latella L, Puri PL (2004) p38 pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat Genet 36(7): 738- 743 Simone C, Giordano A (2001) New insight in cdk9 function: from Tat to MyoD. Front Biosci 6: D1073-1082 Simone C, Stiegler P, Bagella L, Pucci B, Bellan C, De Falco G, De Luca A, Guanti G, Puri PL, Giordano A (2002b) Activation of MyoD-dependent transcription by cdk9/cyclin T2. Oncogene 21(26): 4137-4148 Skapek SX, Rhee J, Kim PS, Novitch BG, Lassar AB (1996) Cyclin-mediated inhibition of muscle gene expression via a mechanism that is independent of pRB hyperphosphorylation. Mol Cell Biol 16(12): 7043-7053 Skapek SX, Rhee J, Spicer DB, Lassar AB (1995) Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase. Science 267(5200): 1022-1024 Solhonne B, Lenormand JL, Pelpel K, Leibovitch MP, Leibovitch SA (1999) MyoD binds to Mos and inhibits the Mos/MAP kinase pathway. FEBS Lett 461(1-2): 107-110 Song A, Wang Q, Goebl MG, Harrington MA (1998) Phosphorylation of nuclear MyoD is required for its rapid degradation. Mol Cell Biol 18(9): 4994-4999 Sorrentino V, Pepperkok R, Davis RL, Ansorge W, Philipson L (1990) Cell proliferation inhibited by MyoD1 independently of myogenic differentiation. Nature 345(6278): 813- 815 Spicer DB, Rhee J, Cheung WL, Lassar AB (1996) Inhibition of myogenic bHLH and MEF2 transcription factors by the bHLH protein Twist. Science 272(5267): 1476-1480 Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403(6765): 41-45
- 151. 112 Strom DK, NipJ, Westendorf JJ, Linggi B, Lutterbach B, Downing JR, Lenny N, Hiebert SW (2000) Expression of the AML-1 oncogene shortens the G(1) phase of the cell cycle. J Biol Chem 275(5): 3438 - 3445 Sullivan J, Sher D, Eisenstein M, Shigesada K, Reitzel A, Marlow H, Levanon D, Groner Y, Finnerty J, Gat U (2008) The evolutionary origin of the Runx/CBFbeta transcription factors - Studies of the most basal metazoans. BMC Evolutionary Biology 8(1): 228 Sun L, Trausch-Azar JS, Ciechanover A, Schwartz AL (2005) Ubiquitin-proteasome-mediated degradation, intracellular localization, and protein synthesis of MyoD and Id1 during muscle differentiation. J Biol Chem 280(28): 26448-26456 Tajbakhsh S, Rocancourt D, Cossu G, Buckingham M (1997) Redefining the Genetic Hierarchies Controlling Skeletal Myogenesis: Pax-3 and Myf-5 Act Upstream of MyoD. Cell 89(1): 127-138 Tanaka T, Kurokawa M, Ueki K, Tanaka K, Imai Y, Mitani K, Okazaki K, Sagata N, Yazaki Y, Shibata Y, Kadowaki T, Hirai H (1996) The extracellular signal-regulated kinase pathway phosphorylates AML1, an acute myeloid leukemia gene product, and potentially regulates its transactivation ability. Mol Cell Biol 16(7): 3967-3979 Tanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, Shibata Y, Yazaki Y, Hirai H (1995) An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms. Embo J 14(2): 341-350 Tanaka Y, Watanabe T, Chiba N, Niki M, Kuroiwa Y, Nishihira T, Satomi S, Ito Y, Satake M (1997) The protooncogene product, PEBP2beta/CBFbeta, is mainly located in the cytoplasm and has an affinity with cytoskeletal structures. Oncogene 15(6): 677-683 Tang Y-Y, Crute BE, Kelley JJ, Huang X, Yan J, Shi J, Hartman KL, Laue TM, Speck NA, Bushweller JH (2000a) Biophysical characterization of interactions between the core binding factor [alpha] and [beta] subunits and DNA. FEBS Letters 470(2): 167-172 Tang Y-Y, Shi J, Zhang L, Davis A, Bravo J, Warren AJ, Speck NA, Bushweller JH (2000b) Energetic and Functional Contribution of Residues in the Core Binding Factor beta (CBFbeta ) Subunit to Heterodimerization with CBFalpha. J Biol Chem 275(50): 39579- 39588 Taya Y (1997) RB kinases and RB-binding proteins: new points of view. Trends Biochem Sci 22(1): 14-17 Thayer MJ, Tapscott SJ, Davis RL, Wright WE, Lassar AB, Weintraub H (1989) Positive autoregulation of the myogenic determination gene MyoD1. Cell 58(2): 241-248 Theriault FM, Nuthall HN, Dong Z, Lo R, Barnabe-Heider F, Miller FD, Stifani S (2005) Role for Runx1 in the proliferation and neuronal differentiation of selected progenitor cells in the mammalian nervous system. J Neurosci 25(8): 2050-2061 Thomson S, Clayton AL, Hazzalin CA, Rose S, Barratt MJ, Mahadevan LC (1999) The nucleosomal response associated with immediate-early gene induction is mediated via alternative MAP kinase cascades: MSK1 as a potential histone H3/HMG-14 kinase. EMBO J 18(17): 4779-4793 Tintignac LA, Leibovitch MP, Kitzmann M, Fernandez A, Ducommun B, Meijer L, Leibovitch SA (2000) Cyclin E-cdk2 phosphorylation promotes late G1-phase degradation of MyoD in muscle cells. Exp Cell Res 259(1): 300-307
- 152. 113 Torchia J, GlassC, Rosenfeld MG (1998) Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 10(3): 373-383 Trausch-Azar JS, Lingbeck J, Ciechanover A, Schwartz AL (2004) Ubiquitin-Proteasome- mediated degradation of Id1 is modulated by MyoD. J Biol Chem 279(31): 32614-32619 Tsuzuki S, Hong D, Gupta R, Matsuo K, Seto M, Enver T (2007) Isoform-specific potentiation of stem and progenitor cell engraftment by AML1/RUNX1. PLoS Med 4(5): e172 Ustanina S, Carvajal J, Rigby P, Braun T (2007) The Myogenic Factor Myf5 Supports Efficient Skeletal Muscle Regeneration by Enabling Transient Myoblast Amplification. Stem Cells 25(8): 2006-2016 van Wijnen AJ, Stein GS, Gergen JP, Groner Y, Hiebert SW, Ito Y, Liu P, Neil JC, Ohki M, Speck N (2004) Nomenclature for Runt-related (RUNX) proteins. Oncogene 23(24): 4209- 4210 Vasseur M, Kress C, Montreau N, Blangy D (1980) Isolation and characterization of polyoma virus mutants able to develop in embryonal carcinoma cells. Proc Natl Acad Sci U S A 77(2): 1068-1072 Veldman GM, Lupton S, Kamen R (1985) Polyomavirus enhancer contains multiple redundant sequence elements that activate both DNA replication and gene expression. Mol Cell Biol 5(4): 649-658 Venuti JM, Morris JH, Vivian JL, Olson EN, Klein WH (1995) Myogenin is required for late but not early aspects of myogenesis during mouse development. J Cell Biol 128(4): 563-576 Vivian JL, Olson EN, Klein WH (2000) Thoracic Skeletal Defects in Myogenin- and MRF4- Deficient Mice Correlate with Early Defects in Myotome and Intercostal Musculature. Developmental Biology 224(1): 29-41 Voronova A, Baltimore D (1990) Mutations that disrupt DNA binding and dimer formation in the E47 helix-loop-helix protein map to distinct domains. Proc Natl Acad Sci U S A 87(12): 4722-4726 Wang J, Helin K, Jin P, Nadal-Ginard B (1995) Inhibition of in vitro myogenic differentiation by cellular transcription factor E2F1. Cell Growth Differ 6(10): 1299-1306 Wang K, Wang C, Xiao F, Wang H, Wu Z (2008) JAK2/STAT2/STAT3 are required for myogenic differentiation. J Biol Chem: M803012200 Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe AH, Speck NA (1996a) Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A 93(8): 3444 - 3449 Wang Q, Stacy T, Miller JD, Lewis AF, Gu TL, Huang X, Bushweller JH, Bories JC, Alt FW, Ryan G, Liu PP, Wynshaw-Boris A, Binder M, Marin-Padilla M, Sharpe AH, Speck NA (1996b) The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell 87(4): 697-708 Wang S, Wang Q, Crute BE, Melnikova IN, Keller SR, Speck NA (1993) Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol Cell Biol 13(6): 3324-3339 Wang S, Zhang Y, Soosairajah J, Kraft AS (2007) Regulation of RUNX1/AML1 during the G2/M transition. Leuk Res 31(6): 839-851
- 153. 114 Wang X, BlagdenC, Fan J, Nowak SJ, Taniuchi I, Littman DR, Burden SJ (2005) Runx1 prevents wasting, myofibrillar disorganization, and autophagy of skeletal muscle. Genes Dev 19(14): 1715-1722 Wasserman WW, Fickett JW (1998) Identification of regulatory regions which confer muscle- specific gene expression. J Mol Biol 278(1): 167-181 Wee H-J, Voon DC-C, Bae S-C, Ito Y (2008) PEBP2{beta}/CBF{beta}-dependent phosphorylation of RUNX1 and p300 by HIPK2: Implications for leukemogenesis. Blood: blood-2008-2001-134122 Wei L, Jamonnak N, Choy J, Wang Z, Zheng W (2008) Differential binding modes of the bromodomains of CREB-binding protein (CBP) and p300 with acetylated MyoD. Biochemical and Biophysical Research Communications 368(2): 279-284 Weintraub H, Davis R, Lockshon D, Lassar A (1990) MyoD binds cooperatively to two sites in a target enhancer sequence: occupancy of two sites is required for activation. Proc Natl Acad Sci U S A 87(15): 5623-5627 Weintraub H, Dwarki VJ, Verma I, Davis R, Hollenberg S, Snider L, Lassar A, Tapscott SJ (1991) Muscle-specific transcriptional activation by MyoD. Genes Dev 5(8): 1377-1386 Weintraub H, Tapscott SJ, Davis RL, Thayer MJ, Adam MA, Lassar AB, Miller AD (1989) Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc Natl Acad Sci U S A 86(14): 5434-5438 Wong MW, Pisegna M, Lu MF, Leibham D, Perry M (1994) Activation of Xenopus MyoD transcription by members of the MEF2 protein family. Dev Biol 166(2): 683-695 Wright WE, Sassoon DA, Lin VK (1989) Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56(4): 607-617 Wu Z, Woodring PJ, Bhakta KS, Tamura K, Wen F, Feramisco JR, Karin M, Wang JY, Puri PL (2000) p38 and extracellular signal-regulated kinases regulate the myogenic program at multiple steps. Mol Cell Biol 20(11): 3951-3964 Xia D, Zhang Y, Huang X, Sun Y, Zhang H (2007) The C. elegans CBF[beta] homolog, BRO-1, regulates the proliferation, differentiation and specification of the stem cell-like seam cell lineages. Developmental Biology 309(2): 259-272 Xie T, Spradling AC (1998) decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell 94(2): 251-260 Xu Q, Yu L, Liu L, Cheung CF, Li X, Yee SP, Yang XJ, Wu Z (2002) p38 Mitogen-activated protein kinase-, calcium-calmodulin-dependent protein kinase-, and calcineurin-mediated signaling pathways transcriptionally regulate myogenin expression. Mol Biol Cell 13(6): 1940-1952 Yablonka-Reuveni Z, Paterson BM (2001) MyoD and myogenin expression patterns in cultures of fetal and adult chicken myoblasts. J Histochem Cytochem 49(4): 455-462 Yaffe D, Saxel O (1977) Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 270(5639): 725-727 Yahi H, Fritsch L, Philipot O, Guasconi V, Souidi M, Robin P, Polesskaya A, Losson R, Harel- Bellan A, Ait-Si-Ali S (2008) Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. J Biol Chem: M802647200 Yamaguchi Y, Kurokawa M, Imai Y, Izutsu K, Asai T, Ichikawa M, Yamamoto G, Nitta E, Yamagata T, Sasaki K, Mitani K, Ogawa S, Chiba S, Hirai H (2004) AML1 Is Functionally
- 154. 115 Regulated through p300-mediatedAcetylation on Specific Lysine Residues. J Biol Chem 279(15): 15630-15638 Yang Y, Xu Y, Li W, Wang G, Song Y, Yang G, Han X, Du Z, Sun L, Ma K (2009a) STAT3 induces muscle stem cell differentiation by interaction with myoD. Cytokine 46(1): 137- 141 Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ (2009b) MyoD and E-protein heterodimers switch rhabdomyosarcoma cells from an arrested myoblast phase to a differentiated state. Genes Dev 23(6): 694-707 Yoshida H, Kitabayashi I (2008) Chromatin regulation by AML1 complex. Int J Hematol 87(1): 19-24 Yoshida N, Ogata T, Tanabe K, Li S, Nakazato M, Kohu K, Takafuta T, Shapiro S, Ohta Y, Satake M, Watanabe T (2005) Filamin A-bound PEBP2beta/CBFbeta is retained in the cytoplasm and prevented from functioning as a partner of the Runx1 transcription factor. Mol Cell Biol 25(3): 1003-1012 Yu YT, Breitbart RE, Smoot LB, Lee Y, Mahdavi V, Nadal-Ginard B (1992) Human myocyte- specific enhancer factor 2 comprises a group of tissue-restricted MADS box transcription factors. Genes Dev 6(9): 1783-1798 Yuan W, Condorelli G, Caruso M, Felsani A, Giordano A (1996) Human p300 protein is a coactivator for the transcription factor MyoD. J Biol Chem 271(15): 9009-9013 Zabludoff SD, Csete M, Wagner R, Yu X, Wold BJ (1998) p27Kip1 is expressed transiently in developing myotomes and enhances myogenesis. Cell Growth Differ 9(1): 1-11 Zaidi SK, Sullivan AJ, van Wijnen AJ, Stein JL, Stein GS, Lian JB (2002) Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites. Proc Natl Acad Sci U S A 99(12): 8048-8053 Zaiman AL, Lewis AF, Crute BE, Speck NA, Lenz J (1995) Transcriptional activity of core binding factor-alpha (AML1) and beta subunits on murine leukemia virus enhancer cores. J Virol 69(5): 2898-2906 Zambidis ET, Peault B, Park TS, Bunz F, Civin CI (2005) Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development. Blood 106(3): 860-870 Zeman RJ, Zhao J, Zhang Y, Zhao W, Wen X, Wu Y, Pan J, Bauman WA, Cardozo C (2009) Differential skeletal muscle gene expression after upper or lower motor neuron transection. Pflugers Arch Zeng C, McNeil S, Pockwinse S, Nickerson J, Shopland L, Lawrence JB, Penman S, Hiebert S, Lian JB, van Wijnen AJ, Stein JL, Stein GS (1998) Intranuclear targeting of AML/CBFalpha regulatory factors to nuclear matrix-associated transcriptional domains. Proc Natl Acad Sci U S A 95(4): 1585-1589 Zeng C, van Wijnen AJ, Stein JL, Meyers S, Sun W, Shopland L, Lawrence JB, Penman S, Lian JB, Stein GS, Hiebert SW (1997) Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBF-alpha transcription factors. Proc Natl Acad Sci U S A 94(13): 6746-6751 Zetser A, Gredinger E, Bengal E (1999) p38 Mitogen-activated Protein Kinase Pathway Promotes Skeletal Muscle Differentiation. PARTICIPATION OF THE MEF2C TRANSCRIPTION FACTOR. J Biol Chem 274(8): 5193-5200
- 155. 116 Zhang CL, McKinseyTA, Olson EN (2002) Association of class II histone deacetylases with heterochromatin protein 1: potential role for histone methylation in control of muscle differentiation. Mol Cell Biol 22(20): 7302-7312 Zhang DE, Hetherington CJ, Meyers S, Rhoades KL, Larson CJ, Chen HM, Hiebert SW, Tenen DG (1996) CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol 16(3): 1231-1240 Zhang JM, Zhao X, Wei Q, Paterson BM (1999a) Direct inhibition of G(1) cdk kinase activity by MyoD promotes myoblast cell cycle withdrawal and terminal differentiation. Embo J 18(24): 6983-6993 Zhang L, Fried FB, Guo H, Friedman AD (2008) Cyclin-dependent kinase phosphorylation of RUNX1/AML1 on 3 sites increases transactivation potency and stimulates cell proliferation. Blood 111(3): 1193-1200 Zhang L, Lukasik SM, Speck NA, Bushweller JH (2003) Structural and functional characterization of Runx1, CBF beta, and CBF beta-SMMHC. Blood Cells Mol Dis 30(2): 147-156 Zhang P, Wong C, Liu D, Finegold M, Harper JW, Elledge SJ (1999b) p21(CIP1) and p57(KIP2) control muscle differentiation at the myogenin step. Genes Dev 13(2): 213-224 Zhang Y, Biggs JR, Kraft AS (2004) Phorbol ester treatment of K562 cells regulates the transcriptional activity of AML1c through phosphorylation. J Biol Chem 279(51): 53116- 53125 Zhao M, New L, Kravchenko VV, Kato Y, Gram H, di Padova F, Olson EN, Ulevitch RJ, Han J (1999) Regulation of the MEF2 Family of Transcription Factors by p38. Mol Cell Biol 19(1): 21-30 Zhu X, Yeadon JE, Burden SJ (1994) AML1 is expressed in skeletal muscle and is regulated by innervation. Mol Cell Biol 14(12): 8051-8057
- 156.
- 157. Annexe 1 Article derevue 1 Philipot, O*, Yahi, H*, Guasconi, V, Fritsch, L, Ait-Si-Ali, S. Chromatin modification and muscle differentiation. Expert Opin Ther Targets 2006, 10(6) : 923-34. Review. (*equal contribution)
- 158. Author Proof Review 10.1517/14728222.10.6.xxx ©2006 Informa UK Ltd ISSN 1472-8222 1 General Chromatin modification and muscle differentiation Hakima Yahi*, Ophélie Philipot*, Valentina Guasconi, Lauriane Fritsch & Slimane Ait-Si-Ali† †Institut André Lwoff, Laboratoire ‘Epigénétique et Cancer’, FRE 2944, CNRS, 7 rue Guy Moquet, 94800 Villejuif, France. *These authors contibuted equally to this manuscript. Skeletal muscle differentiation is a multistep process, which begins with the commitment of multi-potent mesodermal precursor cells to the muscle fate. These committed cells, the myoblasts, then differentiate and fuse into multi- nucleated myotubes. The final step of muscle differentiation is the maturation of differentiated myotubes into myofibres. Skeletal muscle development requires the coordinated expression of various transcription factors like the members of the myocyte enhancer binding-factor 2 family and the muscle regulatory factors. These transcription factors, in collaboration with chromatin-remodelling complexes, act in specific combinations and within complex transcriptional regulatory networks to achieve skeletal myogenesis. Additional factors involved in the epigenetic regulation of this process con- tinue to be discovered. In this review, the authors discuss the recent discoveries in the epigenetic regulation of myogenesis. They also summarise the role of chromatin-modifying enzymes regulating muscle gene expression. These dif- ferent factors are often involved in multiple steps of muscle differentiation and have redundant activities. Altogether, the recent findings have allowed a better understanding of myogenesis and have raised new hopes for the pharmacological development of new therapies aimed at muscle degeneration diseases, such as myotonic dystrophy or Duchenne muscular dystrophy. Keywords: chromatin remodelling, differentiation, skeletal muscle Expert Opin. Ther. Targets (2006) 10(6):xxx-xxx 1. Introduction Skeletal muscles derive from muscle precursor cells (MPCs) that engage in a multistep differentiation programme in which mesoderm progenitors become com- mitted to a skeletal muscle fate, then proliferate and migrate to specific locations, and finally differentiate into multinucleated myotubes to form myofibres [1]. Among the different factors expressed in the embryo structures, members of the Wnts family and Sonic Hedgehog (Shh) factor are positive regulators of myo- genesis [2-7]. These factors induce the production of Myf5 and MyoD, the determi- nation factors of myogenesis. Many other regulatory factors involved in these different steps have been identified, including the early markers Pax3, c-Met, the members of the MEF2 family and the muscle regulatory factors (MRFs): MyoD, myogenin, Myf5, and MRF4 (Table 1). The MEF2 and MRFs transcription factors are the key regulators of the latest steps of myogenesis. The ectopic expression of an individual MRF in a variety of non-muscle cells results in the activation of the skel- etal muscle differentiation programme [8,9]. These transcription factors, in collabo- ration with chromatin remodelling complexes, act in specific combinations and within complex transcriptional regulatory networks to achieve skeletal myogenesis. 1. Introduction 2. The specification factors of embryonic myogenesis 3. Transcriptional regulation of muscle differentiation 4. Chromatin remodelling enzymes in proliferating myoblasts 5. Chromatin remodelling enzymes in differentiating myotubes 6. Insights from muscle regeneration studies 7. Pharmacological triggering of the transcription regulators of skeletal muscle differentiation 8. Conclusion 9. Expert opinion
- 159. Author Proof Chromatin modificationand muscle differentiation 2 Expert Opin. Ther. Targets (2006) 10(6) 2. The specification factors of embryonic myogenesis In the embryo, a number of factors are implicated in the sur- vival, delamination and migration of the MPCs from the dermomyotome to sites of muscle formation in the body and limbs (Figure 1). Several homeodomain transcription factors are involved. Thus, Pax3 and Pax7 mark cells in the dermomyo- tome and in newly forming muscle masses, such as the myo- tome in the mature somite. Pax3 is essential for the formation and migration of the MPCs. Pax3 gene acts upstream of the myogenic programme and is necessary for MyoD activation in the absence of Myf-5 [10,11]. Most of the functions of Pax3 can be replaced by its paralogue Pax7 [12]. Msx1 is a homeodo- main protein that can inhibit myogenesis, with an antagonist effect of Pax3 and the MRFs. The Six family (homeobox pro- teins) are transcription factors with notably Six1 and Six4 that are expressed in MPCs and can bind the MEF-3 element located in myogenin promoter. Lbx1 is also a homeobox pro- tein necessary for a correct migration of the MPCs [13]. Finally, the proto-oncogene c-met is a marker of the MPCs delaminating and migrating from the lateral dermomyotome. The c-met gene encodes a tyrosine kinase receptor and its lig- and is the hepatocyte growth factor, also called scatter factor because it delineates the migratory route of MPCs. During migration, the MPCs express all these specification factors, but do not yet express the determination factors, such as MyoD and Myf-5 (Figure 1). 3. Transcriptional regulation of muscle differentiation The development of skeletal muscle is an ordered multistep process requiring the sequential activation of essentially two groups of myogenic transcription factors (Figures 1 and 2, Table 1). The first group is composed of the basic helix-loop-helix (bHLH) transcription factors family. The second group includes the MEF2 family of transcription factors. 3.1 The myogenic bHLH transcription factors family The myogenic bHLH family comprises MyoD, Myf5, myo- genin and MRF4, which belong to the Class II of the tis- sue-specific bHLH transcription factors family. Targeted gene disruption of any of the four bHLH family members, MyoD, Myf5, myogenin and Mrf4, in mice has shown that they play central roles in myogenesis [14-16]. Progenitor cells remain multi-potent in the absence of these factors, they do not locate correctly to sites of myogenesis and adopt other cell fates [17,18]. Moreover, in the absence of MyoD and Myf5, myogenin and MRF4 are not observed [19-21]. On the con- trary, it has been shown that mice lacking myogenin or MRF4 still develop skeletal muscle, although double knockout mice totally lack skeletal muscle fibres and myoblasts [19-21] (for review see [16]). Further experiments have pointed out the compensatory roles of Myf5 and MyoD. Inactivation of Myf5 gene results in delayed myotome formation and aberrant migration of Figure 1. Sequential expression of major markers of skeletal muscle differentiation and illustration of the different stages of myogenesis, from the somitic cells to mature myofibres. The committed cells in the somite are characterised by the expression of Pax3, which will further lead to the migration of the MPCs, along with c-Met. The expression of MyoD and Myf5 in the MPCs leads to their determination into proliferating myoblasts. The concomitant expression of MyoD, Myf5, Mfr4 and the MEF2 factors, will induce these myoblasts to exit from the cell cycle and to enter terminal differentiation. Late-stage markers of differentiation, such as MCK and MHC, are expressed in the multinucleated myotubes. The latter finally fuse to form mature and functional myofibres. MCK: Muscle creatine kinase; MEF: Myocyte enhancer factor; MHC: Myosin heavy chain; MPC: Muscle precursor cell; MRF: Muscle regulator factory; MyoD: Myogenic determination. Maturation Committed myoblasts at the site of muscle formation Myotubes, at site of muscle formation. Permanent cell cycle exit Mature myofibers Uncommitted cells of the somite DifferentiationDetermination Terminally differentiatedProliferative Specification Muscle cell precursors Pax3, Pax7 Wnt, Shh Six1, Six4 c-met, lbx1, msx1 Myf5, MyoD, MRF4 MEF2 MyoD, MRF4, Myogenin MCK, MHC Troponin1 AchR MEF2
- 160. Author Proof Yahi, Philipot,Guasconi, Fritsch & Ait-Si-Ali Expert Opin. Ther. Targets (2006) 10(6) 3 muscle precursors into the adjacent tissues, dermis and sclerotome, where they acquire non-muscle fates [22]. This early defect in myogenesis is, however, compensated by the later expression of MyoD, leading to essentially normal muscles at birth. Similarly, disruption of the MyoD gene, which is normally expressed two days after Myf5, does not alter muscle formation. Indeed, homozygous MyoD-/- mice are normal, fertile and do not show abnormal skeletal mus- cles [23]. To understand this compensatory role, analysis of the mRNA of newborn mice shows an increased level of Myf5 expression, both in homozygous and heterozygous MyoD+/- mice. This suggests that Myf5 replaces MyoD in these mice and, thus, there is functional overlap between these two genes. MyoD positively auto-regulates its own expression, and activates that of myogenin (Figure 2). Myogenin is expressed in nonproliferating myoblasts as they enter the differentiation pathway. Myogenin seems to be implicated in later steps of muscle cell differentiation and triggers differentiation with activation of muscle specific genes, such as muscle creatine kinase (MCK) and myosin heavy chain (MHC). Both MyoD and myogenin are expressed during skeletal muscle differentiation and it is likely that, together, they reg- ulate the late expression of MRF4, which contributes to fibres’ maturation and to the maintenance of their differen- tiated state (Figure 2). But Mrf4 is not only playing a role in the late stages of muscle differentiation. Indeed, it was recently shown that Mrf4 is expressed in MPCs, such as MyoD and Myf5 [11,24,25]. Actually, Myf5 and MRF4 act upstream of MyoD to direct embryonic multi-potent cells into the myogenic lineage. Moreover, Myf5/MyoD double null mice are able to form skeletal muscles if Mrf4 expres- sion is not compromised [11]. Thus, MRF4 has roles in both muscle determination and differentiation. 3.2 Molecular mechanisms The bHLH transcription factors have a basic region and a helix-loop-helix domain. These muscle-specific transcription factors can either homodimerise, or heterodimerise with class I bHLH transcription factors, which are quasi-ubiquitous E proteins (such as HEB/HTF4, E2-2/ITF-2 and E12/E47). The MRFs act on muscle-specific promoters where they can interact with each other and with other transcription factors, such as MEF2. In addition, they interact with chromatin-modifying proteins, such as histone deacetylases (HDACs), histone acetyl- transferases (HATs) and members of the SWI/SNF ATP-dependent chromatin remodelling complex (Figure 3). Each of the MRF members has been shown to heterodimer- ise in vitro, and in vivo with quasi-ubiquitous E proteins that are the alternatively spliced products of the E2A gene: E12 and E47 [26-28]. Basically, dimers formed from bHLH proteins dif- fer in their abilities to bind to DNA. For example, MyoD-E47 heterodimer forms efficiently and binds strongly to DNA, whereas MyoD homodimers only poorly bind DNA. These Table 1. The different maturation stages and genes/proteins potentially involved at each stage of skeletal muscle formation. Myogenic stage Associated genetic factors Delamination Pax3, c-Met Migration c-Met/HGF, Lbx1, Msx1 Proliferation Pax, c-Met, Mox3, Six, (Myf5, MyoD) Determination MRFs: Myf5, MyoD, MRF4 Differentiation MRFs (MyoD, myogenin, MRF4) MEF2 (MEF2 A, B, C, D) HGF: Hepatocyte growth factor; MEF: Myocyte enhancer factor; MRF: Muscle regulatory factor; Myf: Myogenic factor; MyoD: Myogenic determination. Figure 2. The MRFs functional network during muscle differentiation. MyoD, Myf5 and MRF4 are necessary for the commitment of the somitic cells to the myogenic lineage. They are also called the myogenic determination factors. Myf5 is a positive regulator of MyoD expression and has a direct or indirect role in myogenin gene activation. Myogenin, in turn, stimulates MyoD expression, and both MyoD and myogenin are necessary for the late expression of MRF4 in terminal differentiation. Finally, MRF4, MyoD and myogenin promote the expression of late stage markers such as muscle creatine kinase and myosin heavy chain. MCK: Muscle creatine kinase; MEF: Myocyte enhancer factor; MHC: Myosin heavy chain; MRF: Muscle regulatory factor; MyoD: Myogenic determination. External signals MRF4 Growth factors MyoD Myf5 Determination Differentiation MRF4Myogenin Muscle-specific genes (MCK, MHC…) Maturation
- 161. Author Proof Chromatin modificationand muscle differentiation 4 Expert Opin. Ther. Targets (2006) 10(6) Figure 3. Role of chromatin remodelling proteins at muscle specific loci in proliferating and in differentiating myoblasts. A. In proliferating myoblasts HDAC1 interacts with, and deacetylates, MyoD. MEF2 binds HDAC5 and this interaction leads to the deacetylated state of histones H3 and H4. HDACs at muscle-specific loci lead to the recruitment of the HMTs and the subsequent methylation of H3K9 is recognised by heterochromatin protein 1 to silence efficiently muscle-specific genes in proliferating myoblasts. B. Rb competes with MyoD for HDAC1 to silence proliferation genes, which liberates MyoD from HDAC1. The calcium-dependant kinase phosphorylates HDAC5 on two serine residues, which leads to its exclusion to the cytoplasm by the protein chaperone 14-3-3. C. The HATs then bind to MEF2 and MyoD on the promoter of muscle-specific genes, and acetylate histone H3, H4 and MyoD itself. CARM1 methylates histones on arginine residues and contributes to the transcriptionally active state of muscle specific genes in differentiating myoblasts. CamK: Ca2+/calmodulin-dependent protein kinase; CARM: Coactivator-associated arginine methyltransferase; HAT: Histone acetyltransferase; HDAC: Histone deacetylase; HMT: Histone methyltranferase; HP; Heterochromatin protein; MEF: Myocyte enhancer factor; MyoD: Myogenic determination; PCAF: p300/CBP-associated factor; Rb: Retinoblastoma protein. A. Chromatin structure non-permissive to transcription MyoD HMTs HDAC1 MeH3K9 MeH3K27 HP1 HP1 Mef2 HDAC5 HP1MeH3K9 MyoD HMTs HDAC1 MeH3K9 MeH3K27 HP1 HP1 Mef2 HDAC5 HP1MeH3K9 Rb HATs CamK P-Ser P-Ser C. Chromatin structure permissive to transcription CARM1 Basal transcriptional machinery MyoD Ac H3 Ac H4 p300/PCAF Ac-Lys Ac-Lys Ac-Lys E47Mef2 SWI/SNF Me-Arg Chromatin remodelling Acetylation of MyoD and histones B. Intermediate state of chromatin remodelling MyoD HMTs HDAC1 HP1 HP1 MEF2 HDAC5 HP1 MyoD HMTs HDAC1 HP1 HP1 MEF2 HDAC5 HP1 Rb HATs CamK CARM1 Basal transcriptional machinery MyoD p300/PCAF E47MEF2 SWI/SNF
- 162. Author Proof Yahi, Philipot,Guasconi, Fritsch & Ait-Si-Ali Expert Opin. Ther. Targets (2006) 10(6) 5 heterodimers bind to the consensus sequence CANNTG, the so-called E-boxes (reviewed in [29,30]). The E-boxes are located in the regulatory regions of muscle-specific genes, such as MCK, Desmin and Tropinin I [31,32]. E-boxes occur frequently on the genome and not only in the regulatory region of muscle genes. Thus, intermolecular interactions appear to be necessary for MyoD to activate muscle gene transcription. Binding sites for factors such as MEF2 can functionally substitute for the second E-box, indicating that the cooperative interactions with adjacent factors are crucial for establishing a stable and functional transcriptional complex [33]. 3.3 MyoD, the major player MyoD is considered as the major player in triggering muscle terminal differentiation, even if Myf5 has a redundant role in muscle development and adult myogenesis [34]. The abil- ity of MyoD to convert non-muscle cells into skeletal muscle strongly indicates that it might have a central role in myo- genesis [35,36]. These findings provided the first direct evi- dence that a single gene can initiate a complex programme of differentiation, acting as a ‘master switch’ as named by S Tapscott [37]. The role of MyoD in the cell-cycle arrest and in triggering muscle differentiation will be discussed below, as well as the repressive complexes that inhibit MyoD activ- ity. Indeed, the myogenic activity of the bHLHs and MEF2 factors is both positively and negatively regulated by differ- ent chromatin remodelling enzymes [38] and ATP-dependent chromatin remodelling complexes, which play a pivotal role in transcriptional regulation. For example, both families of proteins associate with HATs and HDACs, which act in an opposing manner to control the acetylation state on nucleosomal histones (and of the proteins themselves), in proliferating and differentiating myoblasts. 3.4 The myocyte enhancer binding factor 2 family The MEF-2 family is part of the MADS-box-containing pro- teins (MCM1, agamous, deficiens, serum response factor). In vertebrates, the four genes of the MEF-2 family are Mef2: A, B, C and D [39], and their alternative splicing gives rise to the MEF2 proteins. These transcription factors bind to A/T-rich sequences found at a number of muscle-specific promoters [39]. MEF2 proteins contain the highly conserved MADS, and the adjacent MEF2 domains, involved in DNA binding and dimerisation [40]. MEF2 factors can directly interact with, and help, MyoD to bind to E boxes (recognised by the bHLH fac- tors). Indeed, in many muscle-specific genes, the MEF2 bind- ing sites and E boxes are juxtaposed [41]. Moreover, activation of muscle gene expression by myogenic bHLH proteins depends on their association with members of the MEF2 family [15], as documented by experiments of loss-of-function on Mef2 that inhibited differentiation [42,43]. The four Mef2 genes’ expression profile corresponds to that of myogenin, suggesting that MEF2 proteins are implicated in the final steps of muscle differentiation [44]. The Mef2c gene is the first member of the MEF2 factors to be expressed at the onset of differentiation of skeletal muscle lineage in vivo, followed by the expression of the other Mef2 genes, and its expression is maintained throughout skeletal muscle develop- ment. It has been shown that Mef2c is a direct transcriptional target for MEF2 and myogenic bHLH proteins [45]. 4. Chromatin remodelling enzymes in proliferating myoblasts It is interesting to take a glance at MyoD expression through- out the cell cycle, because MyoD is expressed in proliferating myoblasts without triggering muscle differentiation. MyoD levels increase during G1 phase until a restriction point where MyoD becomes phosphorylated on serine 200 and is then ubiquitinylated to be finally degraded. After the S phase, MyoD levels start increasing again, but at the onset of mitosis MyoD is phosphorylated on serines 5 and 200 by cyclin/CDK1 complexes and is further ubiquitinylated then degraded [46-49]. In proliferating myoblasts, MyoD actually represses its target genes. Indeed, class I and II HDACs are expressed in proliferating myoblasts, providing a potential explanation for the inability of MyoD, and MEF2, to activate their target genes prior to differentiation. There would be at least 17 HDACs, which are organised in three classes: I, II and III. Class I HDACs are expressed ubiquitously, whereas class II HDACs are highly enriched in heart, skeletal muscle and brain. Thus, in proliferating myoblasts, MyoD is associ- ated with class I HDACs through its bHLH region [38,50,51] (Figure 3A). This interaction represses the transcriptional activ- ity of MyoD, in part, by deacetylating MyoD itself [51], and by deacetylating histones on its target gene promoters [50-52]. The dimerisation of MyoD with its co-activators E12 and E47 is also prevented as they are heterodimerised with antimyogenic Id protein [53]. Furthermore, the activity of MEF2 proteins is repressed by association with class II HDACs (HDAC4 and HDAC5), resulting in histone deacetylation on, and transcriptional repression of, muscle genes [54]. Finally, the class III histone deacetylase Sir2, a NAD+-dependent deacetylase, inhibits myogenesis by form- ing a complex with the HAT p300/CBP-associated factor (PCAF) and MyoD and, when overexpressed, retards muscle differentiation. Conversely, cells with decreased Sir2 differ- entiate prematurely [52]. Moreover, the recruitment of the HDAC complexes to deacetylate histones on the muscle promoters before differen- tiation contributes to H3K9 methylation by histone methyl- transferases (HMTs) on these same promoters. H3K9 surrounding a MEF2 binding site in the inactive myogenin promoter is, indeed, highly methylated in proliferating myob- lasts, but becomes acetylated during muscle differentiation, when the myogenin gene is activated [55]. Methylated H3K9 is a repressive epigenetic mark, which is recognised by hetero- chromatin protein HP1, and thus contributes to form a heterochromatic structure that represses transcription in a stable way (Figure 3A). The authors’ results demonstrate that
- 163. Author Proof Chromatin modificationand muscle differentiation 6 Expert Opin. Ther. Targets (2006) 10(6) MyoD protein interacts also with HP1 in myoblasts (unpublished observation). Other repressive HMTs negatively regulate muscle differen- tiation. Notably, Ezh2, which is a polycomb protein with a HMT activity specific for histone H3K27, is recruited specifi- cally on muscle specific genes in proliferating myoblasts [56]. Ezh2 is found in a protein complex containing HDAC1 (Figure 3A). Indeed, muscle gene promoters were found to be hypermethylated on H3K27 and thus silenced. Triggering of differentiation and muscle gene activation is coupled with the loss of this repressor complex from these loci. H3K27 becomes hypomethylated and the transcriptional activators MyoD and MEF2 are recruited, allowing the transcription of their target genes. Downregulation of Ezh2 coincided with activation of muscle gene expression and its hyperexpression inhibited muscle differentiation. These findings suggest the existence of a two-step activation mechanism, whereby removal of Ezh2-mediated H3K27 methylation, followed by the recruitment of positive transcriptional regulators at dis- crete genomic loci, are required to promote muscle gene expression and cell differentiation. The Ezh2 complex might not regulate the expression of every muscle-specific gene. Indeed, myogenin expression is not influenced by Ezh2 [56]. 5. Chromatin remodelling enzymes in differentiating myotubes During the early process of skeletal muscle differentiation, myogenic factors regulate the transition from the proliferative to a differentiating stage. Myoblasts must irreversibly exit the cell cycle prior to the activation of muscle-specific gene. Studies have revealed that MyoD contributes to both of these events (reviewed in [57]). These two functions of MyoD are controlled by distinct mechanisms: indeed, MyoD basic region mutants are unable to activate differentiation, but can still induce cell-cycle arrest [58]. The key step to growth arrest involves the downregulation of cell cycle activators such as cyc- lins (except cyclin D3) and cyclin-dependent kinases (CDKs), and upregulation of cell-cycle inhibitors such as retinoblastoma protein Rb, p21, p27 and p57. Cyclin D3, together with Rb and the CDK inhibitor protein p21, are critical cell-cycle regu- lators for MyoD-mediated growth arrest [59,60]. These genes share the properties of being non-muscle-specific genes already expressed in proliferating myoblasts, but have their expression level raised by MyoD at the onset of differentiation [60]. In dif- ferentiating myoblasts, MyoD associates to CREB (c-AMP responsive element binding protein) and activates the Rb pro- moter in cooperation with the HATs p300 and PCAF [61]. Hypophosphorylated Rb promotes cell cycle arrest and the expression of late-stage muscle-specific genes, and also prevents apoptosis during myoblast differentiation [62,63]. On the other hand, a functional link between MyoD, HDAC1 and Rb pro- tein, has been provided by Puri et al. [64] (Figure 3B). Indeed, Rb has been shown to positively regulate muscle differentiation by competing with MyoD for binding to HDAC1. During muscle differentiation, HDAC1 is released from MyoD and associates with hypophosphorylated (active) Rb. Rb-HDAC1 complex appear to stimulate differentiation by repressing E2F target genes, which are responsible of the G1/S transition [65]. Moreover, H3K9 methylation mediated by Suv39h is neces- sary for the silencing of E2F target genes. This H3K9 methyla- tion of the E2F target genes is a prerequisite for the induction of terminal muscle differentiation [66]. Suv39h is indeed required for the silencing of proliferation genes and for the activation of the programme of muscle differentiation, and thus it plays a major role in the control of the balance between proliferation and differentiation. Skeletal muscle terminal differentiation is initiated by MyoD, which binds directly to the regulatory regions of genes expressed during skeletal muscle differentiation and initiates chromatin remodelling at specific promoters, such as myogenin, MCK and the MyoD gene itself. To this end, MyoD interacts with an adjacent protein complex containing the homeodo- main protein Pbx1, which appears to be constitutively bound at the muscle gene promoters [67]. Pbx1 binds constitutively to the promoter in a SWI/SNF-independent manner, suggesting a two-step mechanism in which MyoD initially interacts indi- rectly with the myogenin promoter and attracts chroma- tin-remodelling enzymes [68], which then facilitate direct binding by MyoD and other regulatory proteins such as HATs. The HATs/MyoD complex has two distinct HAT activities, p300/CBP and PCAF [38,69-72], which are necessary for the full transcriptional activity of MyoD on chromatin-associated templates [70,73]. First, MyoD would recruit p300/CBP to the promoter, allowing p300/CBP to acetylate histones H3 and H4. p300/CBP would then recruit PCAF (the p300/CBP-associated factor), which acetylates three lysine resi- dues within MyoD, thereby facilitating the transactivation process of muscle differentiation (Figure 3B and C) [73,74]. The authors also previously showed how class II HDACs (4, 5, 6 and 7) negatively regulate muscle differentiation through association with members of the MEF2 family [38,75]. To initi- ate muscle differentiation, CamK, a calcium-dependant kinase under the control of the insulin growth factor (IGF-1), triggers the phosphorylation of two serine residues on HDAC5, resulting in its dissociation from MEF2 Figure 3B. Then, phos- phorylated HDAC5 associates with the 14-3-3 chaperone, which activates a nuclear export sequence in HDAC5 and leads to its exportation from the nucleus. The following recruitment of p300/PCAF and other co-activators with HAT activity to MEF2 allows muscle-specific transcription and myotube formation [72,76]. In addition to the HATs, the SWI/SNF ATP-dependent chromatin remodelling complex and the histone arginine methyltransferase, co-activator-associated arginine methyltrans- ferase 1 (CARM1), have emerged as positive key regulators of skeletal myogenesis [55,77]. MyoD recruits the SWI/SNF ATP-dependent chromatin-remodelling complex through an interaction that can be regulated by the p38 MAPK Figure 3C [77,78]. At myogenic loci, the p38 kinase
- 164. Author Proof Yahi, Philipot,Guasconi, Fritsch & Ait-Si-Ali Expert Opin. Ther. Targets (2006) 10(6) 7 phosphorylates the SWI/SNF subunit BAF60 [78]. Moreover, the forced activation of the p38 pathway promotes SWI/SNF recruitment, facilitates MyoD and MEF2 binding, leads to the recruitment of RNA polymerase II and anticipates expression of late muscle markers at early stages of differentiation [79]. Inhibi- tion of SWI/SNF activity, as well as inhibition of HAT activity, prevents the ability of MyoD to initiate transcription and chromatin remodelling at specific loci [69,77,80]. Recent results suggest that functional SWI/SNF complexes are required for MyoD to activate muscle-specific gene transcription, but not to activate negative cell-cycle regulators [77]. Recent reports showed that histone arginine methylation also plays an important role in the positive regulation of mus- cle gene expression. CARM1, which methylates arginines, is a positive regulator of skeletal myogenesis via direct interactions with MEF2C Figure 3B [77]. Indeed, CARM1, which is a member of the protein arginine–N-methyltransferase family (PRMT) has been shown to interact with MEF2 on the endogenous MCK promoter in a differentiation-dependent manner. Furthermore, the inhibition of CARM1 expression inhibits differentiation and abrogates key transcription factors of the differentiation cascade (myogenin and MEF2). The recruitment of CARM1 during MEF2-dependent activation of MCK expression and its function as a MEF2 co-factor sug- gest that histone arginine methylation (such as that of histone H3), and non-histone targets, potentiates the process of terminal muscle differentiation. 6. Insights from muscle regeneration studies Studies of muscle regeneration from satellite cells have brought more information on the different partners involved in muscle differentiation. In response to injury, quiescent sat- ellite cells, located between the basal lamina and the mature differentiated muscle fibres, are activated and start proliferat- ing to form myoblasts [81]. These myoblasts divide a limited number of times before terminally differentiating and fusing to form multinucleated myotubes [82,83]. The myogenic line- age progression of satellite cells and their myoblastic progeny is regulated by various transcription factors, including the paired-box transcription factors Pax3 and Pax7 and the MRFs Myf5, MyoD and myogenin [84]. Satellite cells activa- tion from quiescence is initially characterised by upregulation of MyoD and Myf5 expression, which precedes mitotic activ- ity and is maintained in proliferating satellite cell-derived myoblasts. Myogenin is also upregulated following the same progression as in embryonic myogenesis [85]. Most of the acti- vated cells commit to differentiation; however, a minority downregulates MyoD, while keeping a robust expression of Pax7, and stops DNA synthesis, thus adopting a phenotype that resembles that of quiescent satellite cells again. This maintenance of satellite-cell populations seems to be a uni- versal mechanism [84]. Finally, it has been shown that MyoD acetylation is important during muscle regeneration in vivo and in embryonic stem cells [86]. Thus, one could speculate that a defect in HAT enzymes responsible for MyoD acetylation could have dramatic effects on muscle regeneration. 7. Pharmacological triggering of the transcription regulators of skeletal muscle differentiation The detailed understanding of the intermolecular interactions and the gene programmes the myogenic factors control is essential to the rational design of therapeutics. Indeed, aber- rant forms of myogenic factors, or their aberrant regulation, could be associated with muscle disorders such as congenital myasthenias, myotonic dystrophy (DM), rhabdomyosarcoma and defects in muscle regeneration. As such, these proteins could provide an enormous pool of target molecules where one might intervene in muscle disorders, both with regard to mechanisms that cause disease and regenerative mechanisms that can ameliorate disease processes. Because transcription factors often interact with each other as a means of both posi- tive and negative regulation of effector genes, such interven- tion comes with particular peril, as the results of pharmacological manipulation are likely to be highly pleio- tropic. Nevertheless, the manipulation of transcriptional sig- nals holds the promise of treating muscle diseases by exploiting the ability of muscle cells to regenerate after injury, and these factors provide keys to unlock the incredible developmental potential of muscle cells to repair their own damage [87]. The essential role of the MRFs in muscle development has been proven by gene disruption experiments in mice. Mice lacking MyoD, although overtly normal, also have defects in muscle regeneration [88,89]. The stimulation of regeneration is a function of MyoD that is likely to be important in neuromuscular diseases. For example, the mdx mouse model of Duchenne muscular dystrophy has more severe pathology in the absence of MyoD [88]. MyoD has also been implicated in myotonic dystrophy [90]. DM is caused by two similar, non-coding, repeat expansion mutations (DM1 and DM2). These are thought to produce pathogenic RNA molecules that accumulate in nuclear foci. DM1 is a CTG expansion in the 3′UTR (untranslated region of dystrophia myotonica protein kinase [DMPK] RNA). Introduction of a mutant DMPK 3′UTR into cultured muscle cells disrupts muscle differentiation by lowering the expression of MyoD [90,91], although the mechanism for this effect is unclear. Chromatin-remodelling factors also influence muscle differ- entiation, hypertrophy and fibre-type determination, signalling mechanisms that impinge on these transcriptional complexes, and how these multicomponent regulatory cascades may be exploited in the development of novel therapies to more effec- tively treat myopathies in humans. Indeed, as mentioned previ- ously, several HDACs have been shown to regulate MEF2- and MyoD-activated transcription. HDACs 4, 5 and 7, all of which are class II HDACs, can associate with each of the four vertebrate MEF2 proteins and affect their function [38].
- 165. Author Proof Chromatin modificationand muscle differentiation 8 Expert Opin. Ther. Targets (2006) 10(6) The ability of HATs and HDACs to physically interact with MRFs and MEFs confounds the design of pharmaco- logical agents aimed at these molecules, as perturbation of HATs and HDACs could affect loci beyond those involved in gene regulation in muscle. However, the fact that there are drugs that inhibit HDAC activity might well provide novel opportunities to stimulate myogenic gene programs. In a recent and exciting demonstration of this idea, exposure of mouse embryos in utero to non-teratogenic doses of HDAC inhibitors (trichostatin A or valproic acid) increased the number of somites in mice [92]. Chromatin remodelling was also implicated in the control of cardiac hypertrophy (reviewed in [93]), which is often asso- ciated with increased risk of mortality, and the molecular mechanisms of cardiomyocyte hypertrophy could have a sig- nificant impact on human health. Thus, it seems likely that p300/CBP positively regulate cardiac hypertrophy. This hypothesis should be easily testable with specific inhibitors of p300/CBP, such as Lys-CoA and dominant-negative mutants of the HAT, as shown by Gusterson et al. [94]. On another hand, Olson’s group results suggest key roles for class II HDACs as negative regulators of cardiac hypertro- phy [55], found that diverse hypertropic signals stimulate the activity of a cardiac HDAC kinase(s) that phosphorylates the 14-3-3 binding sites in HDAC4, -5, -7 and -9, and that signal-resistant mutants of these HDACs containing alanines in place of the target serine residues are potent repressors of hypertrophy. These results strongly suggest that class II HDACs function as signal-responsive repressors of cardiac hypertrophy and heart failure, presumably through their capacity to inhibit MEF2 target genes. 8. Conclusion More is now understood about how chromatin remodelling enzymes regulate myogenesis at the molecular level. However, much remains to be done to fully evaluate the involvement of these enzymes in muscle disease initiation and progression. It will be of great interest to determine their target genes in the context of muscular homeostasis. On the basis of this infor- mation, it should be possible to develop novel drugs and specific treatment strategies having fewer side effects than is currently the case. 9. Expert opinion All of the myogenic transcription factors represent potential targets where pharmacological intervention could have a dramatic impact on disease processes. Agents affecting calcium signalling, protein phosphorylation and protein methylation could also be exploited and are another class of target molecules for the design of therapies. Chromatin-modifying enzymes play critical roles in the control of muscle gene regulatory programs. A major chal- lenge for the future is to understand how these enzymes are coopted by signalling cascades to allow for rapid and precise changes in gene expression in response to physiological and pathological cues. Elucidation of these molecular mechanisms will undoubtedly reveal novel targets that are amenable to pharmacological manipulation in the treatment of muscle-related diseases in humans. In addition to traditional pharmacological approaches, techniques such as gene therapy and RNA interference [95] are important for manipulating this biologically important class of molecules in muscle cells. Indeed, small interfering RNAs (siRNA) could be inoculated into humans, in order to knock down the expression of a harmful gene. RNA interference gene-silencing mechanism is induced by small double-stranded RNA and is highly sequence specific. It is an extremely powerful tool for silencing gene expression in vitro, and might be used as therapy in human muscle pathologies to specifically target a pathological version of a given RNA. It could for example suitable for use to knock down the patho- genic DMPK RNA in myotonic dystrophy. Indeed, the use of lentivirus-delivered short hairpin RNAs (shRNAs) seem to downregulate the endogenous nuclear retained mutant DMPK mRNAs in cultured cells [96]. The emerging role of small non-coding RNAs in many cell processes, including muscle differentiation, will be of great therapeutical interest. Some of these microRNAs, such as miR181, are directly involved in muscle differentiation [97]. It was, for example, recently demonstrated that a mutation in the 3′UTR of myostatin RNA creates a binding site for two microRNAs expressed in muscle cells causing a translation inhibition of the myostatin gene and then contributing to muscle hypertrophy [98]. Non-coding RNAs are linked to chromatin remodelling and gene silencing, at least in some organisms such as plants and fission yeast [99]. It will be of great interest to further investigate the link between the non-coding RNAs and chromatin remodelling in mammals. Deciphering such a link might help in a better understanding of chromatin remodelling in muscle physiopathology and the design of new therapies targeting non-coding RNAs. Acknowledgements The authors’ laboratory is supported by the Association Française contre les Myopathies (AFM), the Ligue Nationale contre le Cancer (LNCC), the Association pour la Recherche sur le Cancer (ARC), the Fondation Bettencourt-Schueller, and the European grant LSHG-CT-2004-502950. H Yahi and V Guasconi were recipients of fellowships from the Ligue Nationale contre le Cancer, and OP from Ministère de la Recherche.
- 166. Author Proof Yahi, Philipot,Guasconi, Fritsch & Ait-Si-Ali Expert Opin. Ther. Targets (2006) 10(6) 9 Bibliography Papers of special note have been highlighted as either of interest (•) or of considerable interest (••) to readers. 1. BUCKINGHAM M: Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev. (2001) 11(4):440-448. • Very good summary of embryonic muscle differentiation. 2. CHRIST B, ORDAHL CP: Early stages of chick somite development. Anat. Embryol. (Berl) (1995) 191(5):381-396. 3. BUFFINGER N, STOCKDALE FE: Myogenic specification in somites: induction by axial structures. Development (1994) 120(6):1443-1452. 4. MUNSTERBERG AE, KITAJEWSKI J, BUMCROT DA, MCMAHON AP, LASSAR AB: Combinatorial signaling by Sonic hedgehog and Wnt family members induces myogenic bHLH gene expression in the somite. Genes Dev. (1995) 9(23):2911-2922. 5. MUNSTERBERG AE, LASSAR AB: Combinatorial signals from the neural tube, floor plate and notochord induce myogenic bHLH gene expression in the somite. Development (1995) 121(3):651-660. 6. BORYCKI AG, BRUNK B, TAJBAKHSH S et al.: Sonic hedgehog controls epaxial muscle determination through Myf5 activation. Development (1999) 126(18):4053-4063. 7. MARCELLE C, STARK MR, BRONNER-FRASER M: Coordinate actions of BMPs, Wnts, Shh and noggin mediate patterning of the dorsal somite. Development (1997) 124(20):3955-3963. 8. TAPSCOTT SJ, DAVIS RL, THAYER MJ et al.: MyoD1: a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts. Science (1988) 242(4877):405-411. 9. RHODES SJ, KONIECZNY SF: Identification of MRF4: a new member of the muscle regulatory factor gene family. Genes Dev. (1989) 3(12B):2050-2061. 10. TAJBAKHSH S, ROCANCOURT D, COSSU G, BUCKINGHAM M: Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and Myf-5 act upstream of MyoD. Cell (1997) 89(1):127-138. 11. KASSAR-DUCHOSSOY L, GAYRAUD-MOREL B, GOMES D et al.: Mrf4 determines skeletal muscle identity in Myf5:Myod double-mutant mice. Nature (2004) 431(7007):466-471. 12. RELAIX F, ROCANCOURT D, MANSOURI A, BUCKINGHAM M: Divergent functions of murine Pax3 and Pax7 in limb muscle development. Genes Dev. (2004) 18(9):1088-1105. 13. MENNERICH D, SCHAFER K, BRAUN T: Pax-3 is necessary but not sufficient for lbx1 expression in myogenic precursor cells of the limb. Mech. Dev. (1998) 73(2):147-158. 14. YUN K, WOLD B: Skeletal muscle determination and differentiation: story of a core regulatory network and its context. Curr. Opin. Cell Biol. (1996) 8(6):877-889. 15. MOLKENTIN JD, OLSON EN: Defining the regulatory networks for muscle development. Curr. Opin. Genet. Dev. (1996) 6(4):445-453. 16. ARNOLD HH, BRAUN T: Targeted inactivation of myogenic factor genes reveals their role during mouse myogenesis: a review. Int. J. Dev. Biol. (1996) 40(1):345-353. 17. TAJBAKHSH S, ROCANCOURT D, BUCKINGHAM M: Muscle progenitor cells failing to respond to positional cues adopt non-myogenic fates in myf-5 null mice. Nature (1996) 384(6606):266-270. 18. KABLAR B, KRASTEL K, YING C et al.: Myogenic determination occurs independently in somites and limb buds. Dev. Biol. (1999) 206(2):219-231. 19. RUDNICKI MA, SCHNEGELSBERG PN, STEAD RH et al.: MyoD or Myf-5 is required for the formation of skeletal muscle. Cell (1993) 75(7):1351-1359. 20. KAUL A, KOSTER M, NEUHAUS H, BRAUN T: Myf-5 revisited: loss of early myotome formation does not lead to a rib phenotype in homozygous Myf-5 mutant mice. Cell (2000) 102(1):17-19. 21. KABLAR B, KRASTEL K, TAJBAKHSH S, RUDNICKI MA: Myf5 and MyoD activation define independent myogenic compartments during embryonic development. Dev. Biol. (2003) 258(2):307-318. 22. TAJBAKHSH S, BOBER E, BABINET C et al.: Gene targeting the myf-5 locus with nlacZ reveals expression of this myogenic factor in mature skeletal muscle fibres as well as early embryonic muscle. Dev. Dyn. (1996) 206(3):291-300. 23. RUDNICKI MA, BRAUN T, HINUMA S, JAENISCH R: Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell (1992) 71(3):383-390. 24. SUMMERBELL D, HALAI C, RIGBY PW: Expression of the myogenic regulatory factor Mrf4 precedes or is contemporaneous with that of Myf5 in the somitic bud. Mech. Dev. (2002) 117(1-2):331-335. 25. TAJBAKHSH S: The genetics of murine skeletal muscle biogenesis. Results Probl. Cell Differ. (2002) 38:61-79. 26. CHAKRABORTY T, BRENNAN TJ, LI L, EDMONDSON D, OLSON EN: Inefficient homooligomerization contributes to the dependence of myogenin on E2A products for efficient DNA binding. Mol. Cell. Biol. (1991) 11(7):3633-3641. 27. LASSAR AB, DAVIS RL, WRIGHT WE et al.: Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell (1991) 66(2):305-315. 28. MURRE C, MCCAW PS, VAESSIN H et al.: Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell (1989) 58(3):537-544. 29. ARNOLD HH, WINTER B: Muscle differentiation: more complexity to the network of myogenic regulators. Curr. Opin. Genet. Dev. (1998) 8(5):539-544. 30. LASSAR A, MUNSTERBERG A: Wiring diagrams: regulatory circuits and the control of skeletal myogenesis. Curr. Opin. Cell Biol. (1994) 6(3):432-442. 31. BRENNAN TJ, OLSON EN: Myogenin resides in the nucleus and acquires high affinity for a conserved enhancer element on heterodimerization. Genes Dev. (1990) 4(4):582-595. 32. FRENCH BA, CHOW KL, OLSON EN, SCHWARTZ RJ: Heterodimers of myogenic helix-loop-helix regulatory factors and E12 bind a complex element governing myogenic induction of the avian cardiac alpha-actin promoter. Mol. Cell. Biol. (1991) 11(5):2439-2450. 33. BIESIADA E, HAMAMORI Y, KEDES L, SARTORELLI V: Myogenic basic helix-loop-helix proteins and Sp1 interact as components of a multiprotein transcriptional complex required for activity of the human cardiac alpha-actin promoter. Mol. Cell. Biol. (1999) 19(4):2577-2584.
- 167. Author Proof Chromatin modificationand muscle differentiation 10 Expert Opin. Ther. Targets (2006) 10(6) 34. FORCALES SV, PURI PL: Signaling to the chromatin during skeletal myogenesis: novel targets for pharmacological modulation of gene expression. Semin. Cell Dev. Biol. (2005) 16(4-5):596-611. 35. WEINTRAUB H, TAPSCOTT SJ, DAVIS RL et al.: Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc. Natl. Acad. Sci. USA (1989) 86(14):5434-5438. • Describes how MyoD induces transdifferentiation of non-muscle cells into muscle cells. 36. KOCAEFE YC, ISRAELI D, OZGUC M, DANOS O, GARCIA L: Myogenic program induction in mature fat tissue (with MyoD expression). Exp. Cell Res. (2005) 308(2):300-308. 37. TAPSCOTT SJ: The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Development (2005) 132(12):2685-2695. 38. MCKINSEY TA, ZHANG CL, OLSON EN: Control of muscle development by dueling HATs and HDACs. Curr. Opin. Genet. Dev. (2001) 11(5):497-504. 39. BLACK BL, OLSON EN: Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Ann. Rev. Cell Dev. Biol. (1998) 14:167-196. 40. MOLKENTIN JD, LI L, OLSON EN: Phosphorylation of the MADS-Box transcription factor MEF2C enhances its DNA binding activity. J. Biol. Chem. (1996) 271(29):17199-17204. 41. FICKETT JW: Coordinate positioning of MEF2 and myogenin binding sites. Gene (1996) 172(1):GC19-GC32. 42. BOUR BA, O’BRIEN MA, LOCKWOOD WL et al.: Drosophila MEF2, a transcription factor that is essential for myogenesis. Genes Dev. (1995) 9(6):730-741. 43. ORNATSKY OI, ANDREUCCI JJ, MCDERMOTT JC: A dominant-negative form of transcription factor MEF2 inhibits myogenesis. J. Biol. Chem. (1997) 272(52):33271-33278. 44. EDMONDSON DG, CHENG TC, CSERJESI P, CHAKRABORTY T, OLSON EN: Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol. Cell. Biol. (1992) 12(9):3665-3677. 45. WANG DZ, VALDEZ MR, MCANALLY J, RICHARDSON J, OLSON EN: The Mef2c gene is a direct transcriptional target of myogenic bHLH and MEF2 proteins during skeletal muscle development. Development (2001) 128(22):4623-4633. 46. SKAPEK SX, RHEE J, SPICER DB, LASSAR AB: Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase. Science (1995) 267(5200):1022-1024. 47. KITZMANN M, VANDROMME M, SCHAEFFER V et al.: cdk1- and cdk2-mediated phosphorylation of MyoD Ser200 in growing C2 myoblasts: role in modulating MyoD half-life and myogenic activity. Mol. Cell. Biol. (1999) 19(4):3167-3176. 48. TINTIGNAC LA, LEIBOVITCH MP, KITZMANN M et al.: Cyclin E-cdk2 phosphorylation promotes late G1-phase degradation of MyoD in muscle cells. Exp. Cell Res. (2000) 259(1):300-307. 49. TINTIGNAC LA, SIRRI V, LEIBOVITCH MP et al.: Mutant MyoD lacking Cdc2 phosphorylation sites delays M-phase entry. Mol. Cell. Biol. (2004) 24(4):1809-1821. 50. MAL A, HARTER ML: MyoD is functionally linked to the silencing of a muscle-specific regulatory gene prior to skeletal myogenesis. Proc. Natl. Acad. Sci. USA (2003) 100(4):1735-1739. 51. MAL A, STURNIOLO M, SCHILTZ RL, GHOSH MK, HARTER ML: A role for histone deacetylase HDAC1 in modulating the transcriptional activity of MyoD: inhibition of the myogenic program. EMBO J. (2001) 20(7):1739-1753. 52. FULCO M, SCHILTZ RL, IEZZI S et al.: Sir2 regulates skeletal muscle differentiation as a potential sensor of the redox state. Mol. Cell (2003) 12(1):51-62. 53. VORONOVA A, BALTIMORE D: Mutations that disrupt DNA binding and dimer formation in the E47 helix-loop-helix protein map to distinct domains. Proc. Natl. Acad. Sci. USA (1990) 87(12):4722-4726. 54. LU J, MCKINSEY TA, ZHANG CL, OLSON EN: Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol. Cell (2000) 6(2):233-244. 55. ZHANG CL, MCKINSEY TA, OLSON EN: Association of class II histone deacetylases with heterochromatin protein 1: potential role for histone methylation in control of muscle differentiation. Mol. Cell. Biol. (2002) 22(20):7302-7312. • Description of the role of class II HDACs during muscle differentiation. 56. CARETTI G, DI PADOVA M, MICALES B, LYONS GE, SARTORELLI V: The polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes Dev. (2004) 18(21):2627-2638. • Description of the role of the HMT Ezh2 during muscle differentiation. 57. MAIONE R, AMATI P: Interdependence between muscle differentiation and cell-cycle control. Biochim. Biophys. Acta (1997) 1332(1):M19-M30. 58. SORRENTINO V, PEPPERKOK R, DAVIS RL, ANSORGE W, PHILIPSON L: Cell proliferation inhibited by MyoD1 independently of myogenic differentiation. Nature (1990) 345(6278):813-815. 59. MARTELLI F, CENCIARELLI C, SANTARELLI G et al.: MyoD induces retinoblastoma gene expression during myogenic differentiation. Oncogene (1994) 9(12):3579-3590. 60. CENCIARELLI C, DE SANTA F, PURI PL et al.: Critical role played by cyclin D3 in the MyoD-mediated arrest of cell cycle during myoblast differentiation. Mol. Cell. Biol. (1999) 19(7):5203-5217. 61. MAGENTA A, CENCIARELLI C, DE SANTA F et al.: MyoD stimulates RB promoter activity via the CREB/p300 nuclear transduction pathway. Mol. Cell. Biol. (2003) 23(8):2893-2906. 62. NOVITCH BG, MULLIGAN GJ, JACKS T, LASSAR AB: Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J. Cell Biol. (1996) 135(2):441-456. 63. NOVITCH BG, SPICER DB, KIM PS, CHEUNG WL, LASSAR AB: pRb is required for MEF2-dependent gene expression as well as cell-cycle arrest during skeletal muscle differentiation. Curr. Biol. (1999) 9(9):449-459. 64. PURI PL, IEZZI S, STIEGLER P et al.: Class I histone deacetylases sequentially interact with MyoD and pRb during skeletal myogenesis. Mol. Cell (2001) 8(4):885-897.
- 168. Author Proof Yahi, Philipot,Guasconi, Fritsch & Ait-Si-Ali Expert Opin. Ther. Targets (2006) 10(6) 11 65. HARBOUR JW, DEAN DC: Chromatin remodeling and Rb activity. Curr. Opin. Cell Biol. (2000) 12(6):685-689. 66. AIT-SI-ALI S, GUASCONI V, FRITSCH L et al.: A Suv39h-dependent mechanism for silencing S-phase genes in differentiating but not in cycling cells. EMBO J. (2004) 23(3):605-615. • Description of the role of the HMT Suv39h in muscle differentiation. 67. BERKES CA, BERGSTROM DA, PENN BH et al.: Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol. Cell (2004) 14(4):465-477. • Describes how muscle genes are marked by Pbx1. 68. DE LA SERNA IL, OHKAWA Y, BERKES CA et al.: MyoD targets chromatin remodeling complexes to the myogenin locus prior to forming a stable DNA-bound complex. Mol. Cell. Biol. (2005) 25(10):3997-4009. 69. PURI PL, SARTORELLI V, YANG XJ et al.: Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol. Cell (1997) 1(1):35-45. 70. PURI PL, AVANTAGGIATI ML, BALSANO C et al.: p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription. EMBO J. (1997) 16(2):369-383. 71. SARTORELLI V, PURI PL, HAMAMORI Y et al.: Acetylation of MyoD directed by PCAF is necessary for the execution of the muscle program. Mol. Cell (1999) 4(5):725-734. 72. SARTORELLI V, HUANG J, HAMAMORI Y, KEDES L: Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS box of MEF2C. Mol. Cell. Biol. (1997) 17(2):1010-1026. 73. DILWORTH FJ, SEAVER KJ, FISHBURN AL, HTET SL, TAPSCOTT SJ: In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-dependent transactivation. Proc. Natl. Acad. Sci. USA (2004) 101(32):11593-11598. 74. POLESSKAYA A, DUQUET A, NAGUIBNEVA I et al.: CREB-binding protein/p300 activates MyoD by acetylation. J. Biol. Chem. (2000) 275(44):34359-34364. 75. MCKINSEY TA, ZHANG CL, OLSON EN: MEF2: a calcium-dependent regulator of cell division, differentiation and death. Trends Biochem. Sci. (2002) 27(1):40-47. 76. ECKNER R, YAO TP, OLDREAD E, LIVINGSTON DM: Interaction and functional collaboration of p300/CBP and bHLH proteins in muscle and B-cell differentiation. Genes Dev. (1996) 10(19):2478-2490. 77. DE LA SERNA IL, CARLSON KA, IMBALZANO AN: Mammalian SWI/SNF complexes promote MyoD-mediated muscle differentiation. Nat. Genet. (2001) 27(2):187-190. • Role of the chromatin remodelling complex SWI/SNF in muscle gene activation. 78. SIMONE C, FORCALES SV, HILL DA et al.: p38 pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat. Genet. (2004) 36(7):738-743. 79. PENN BH, BERGSTROM DA, DILWORTH FJ, BENGAL E, TAPSCOTT SJ: A MyoD-generated feed-forward circuit temporally patterns gene expression during skeletal muscle differentiation. Genes Dev. (2004) 18(19):2348-2353. 80. POLESSKAYA A, NAGUIBNEVA I, FRITSCH L et al.: CBP/p300 and muscle differentiation: no HAT, no muscle. EMBO J. (2001) 20(23):6816-6825. 81. SCHULTZ E: Satellite cell proliferative compartments in growing skeletal muscles. Dev. Biol. (1996) 175(1):84-94. 82. MORGAN JE, PARTRIDGE TA: Muscle satellite cells. Int. J. Biochem. Cell Biol. (2003) 35(8):1151-1156. 83. SLOPER JC, PARTRIDGE TA: Skeletal muscle: regeneration and transplantation studies. Br. Med. Bull. (1980) 36(2):153-158. 84. COLLINS CA: Satellite cell self-renewal. Curr. Opin. Pharmacol. (2006) 6(3):301-306. 85. ZAMMIT PS, HESLOP L, HUDON V et al.: Kinetics of myoblast proliferation show that resident satellite cells are competent to fully regenerate skeletal muscle fibers. Exp. Cell Res. (2002) 281(1):39-49. 86. DUQUET A, POLESSKAYA A, CUVELLIER S et al.: Acetylation is important for MyoD function in adult mice. EMBO Rep. (2006) Epub ahead of print. 87. MARTIN PT: Role of transcription factors in skeletal muscle and the potential for pharmacological manipulation. Curr. Opin. Pharmacol. (2003) 3(3):300-308. 88. MEGENEY LA, KABLAR B, GARRETT K, ANDERSON JE, RUDNICKI MA: MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev. (1996) 10(10):1173-1183. 89. SABOURIN LA, GIRGIS-GABARDO A, SEALE P, ASAKURA A, RUDNICKI MA: Reduced differentiation potential of primary MyoD-/- myogenic cells derived from adult skeletal muscle. J. Cell Biol. (1999) 144(4):631-643. 90. AMACK JD, REAGAN SR, MAHADEVAN MS: Mutant DMPK 3’-UTR transcripts disrupt C2C12 myogenic differentiation by compromising MyoD. J. Cell Biol. (2002) 159(3):419-429. 91. SATO S, NAKAMURA M, CHO DH et al.: Identification of transcriptional targets for Six5: implication for the pathogenesis of myotonic dystrophy Type 1. Hum. Mol. Genet. (2002) 11(9):1045-1058. 92. IEZZI S, COSSU G, NERVI C, SARTORELLI V, PURI PL: Stage-specific modulation of skeletal myogenesis by inhibitors of nuclear deacetylases. Proc. Natl. Acad. Sci. USA (2002) 99(11):7757-7762. • Use of HDAC inhibitors to modulate muscle differentiation. 93. FREY N, MCKINSEY TA, OLSON EN: Decoding calcium signals involved in cardiac growth and function. Nat. Med. (2000) 6(11):1221-1227. 94. GUSTERSON R, BRAR B, FAULKES D et al.: The transcriptional co-activators CBP and p300 are activated via phenylephrine through the p42/p44 MAPK cascade. J. Biol. Chem. (2002) 277(4):2517-2524. 95. AMEYAR-ZAZOUA M, GUASCONI V, AIT-SI-ALI S: siRNA as a route to new cancer therapies. Expert Opin. Biol. Ther. (2005) 5(2):221-224. 96. LANGLOIS MA, BONIFACE C, WANG G et al.: Cytoplasmic and nuclear retained DMPK mRNAs are targets for RNA interference in myotonic dystrophy cells. J. Biol. Chem. (2005) 280(17):16949-16954.
- 169. Author Proof Chromatin modificationand muscle differentiation 12 Expert Opin. Ther. Targets (2006) 10(6) 97. NAGUIBNEVA I, AMEYAR-ZAZOUA M, POLESSKAYA A et al.: The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat. Cell Biol. (2006) 8(3):278-284. • Role of a non-coding RNA in muscle differentiation. 98. CLOP A, MARCQ F, TAKEDA H et al.: A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. (2006) 38(7):813-818. 99. VERDEL A, JIA S, GERBER S et al.: RNAi-mediated targeting of heterochromatin by the RITS complex. Science (2004) 303(5658):672-676. Affiliation Hakima Yahi, Ophélie Philipot, Valentina Guasconi, Lauriane Fritsch & Slimane Ait-Si-Ali† †Author for correspondence Institut André Lwoff, Laboratoire ‘Epigénétique et Cancer’, FRE 2944, CNRS, 7 rue Guy Moquet, 94800 Villejuif, France Tel: +33 1 4958 3384; Fax: +33 1 4958 3307; E-mail: aitsiali@vjf.cnrs.fr
- 170. Annexe 2 Article 2 RobinP, Fritsch L, Philipot O, Svinarchuk F, Ait-Si-Ali S. Post-translational modifications of histones H3 and H4 associated with the histone methyltransferases Suv39h1 and G9a. Genome Biology 2007, 8(12):R270.
- 171. Genome Biology 2007,8:R270 Open Access!""#Robinet al./olume 2, Issue 6!, 7rticle R!#"Method Post-translational modifications of histones H3 and H4 associated with the histone methyltransferases Suv39h1 and G9a :hilippe Robin=, Lauriane Fritsch=, @phélie :hilipot=, Fedor SvinarchuEF and Slimane 7it-Si-7li= 7ddresses: =Centre National de la Recherche ScientifiLue (CNRS) FRE !PQQ, Institut 7ndré LRoff, rue GuT UoLuet, /illejuif F-PQ2"6, FranceW Xniversité :aris-Sud, /illejuif F-PQ2"6, France. FCentre National de la Recherche ScientifiLue (CNRS) FRE Y"62, GENET[@N, bis rue de l'Internationale, EvrT F-P6""!, FranceW Xniversité d'EvrT, EvrT F-P6""!, France. Correspondence: Slimane 7it-Si-7li. Email: aitsiali]vjf.cnrs.fr © 2008 Robin et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. [istone modifications associated Rith [UTs^p_Uass spectrometrT analTsis of the post-transcriptional modifications of histones [Y and [Q that Rere co-purified Rith histone meth-Tltransferases SuvYPh6 and GPa shoRs that, in [eLa cells, histone methTltransferases can be phTsicallT associated Rith acetTlated histones,Rhich normallT marE transcriptionallT active chromatin.^`p_ Abstract Specific combinations of post-translational modifications of histones alter chromatin structure, facilitating gene transcription or silencing. Here we have investigated the 'histone code' associated with the histone methyltransferases Suv39h1 and G9a by combining double immunopurification and mass spectrometry. Our results confirm the previously reported histone modifications associated with Suv39h1 and G9a. Moreover, this method allowed us to demonstrate for the first time an association of acetylated histones with the repressor proteins Suv39h1 and G9a. Background The amino-terminal tails of nucleosomal histones protrude from the aN7 and are subject to covalent modifications. These modifications include lTsine acetTlation, lTsine and arginine methTlation, serine and threonine phosphorTlation, 7a:-ribosTlation, and ubiLuitination c6d. [istone lTsine methTlation can have different effects depending on the resi- due that is modified: methTlation of histone [Y at LTsQ ([YeQ) is associated Rith gene activation, Rhereas methTla- tion of [YeP, [Ye!#, and [Qe!" generallT correlates Rith transcriptional repression c!-Qd. The roles of [YeYf and [Ye#P methTlation remain elusiveW indeed, these modifica- tions are associated Rith both transcriptional activation and repression cg,fd. LTsine residues can be mono-, di-, or trimethTlated, inducing different biological responses cY,#,2d. Thus, for example, highlT condensed heterochromatic regions shoR a high degree of trimethTlated [YeP ([YePmeY), Rhereas euchro- matic regions are preferentiallT enriched in mono- and dimethTlated [YeP c!,Yd. [istone lTsine methTlation is mediated bT histone methTltransferases ([UTs), manT of Rhich contain a conserved SET cSu(var)Y-P, Enhancer-of- zeste, Trithoraxd domain, such as SuvYPh6 (Suppressor of variegation YPh6) and GPa c6,!,Pd. SuvYPh6 belongs to a fam- ilT of peri-centromeric proteins and is responsible for [YeP trimethTlation c6"-6Yd. GPa (Eu[UTase-!) is the major methTlase responsible for mono- and dimethTlation of [YeP in euchromatic regions c6Q,6gd, but it maT also be present in heterochomatic regions c6fd. Covalent modifications of histones can regulate gene expres- sion directlT or through recruitment of non-histone effector proteins c!,6#d. These effector proteins bind modified chro- matin using a varietT of chromatin-binding domains. For example, bromodomains recognize acetTlated lTsines, Rhereas chromo, UBT, Tudor, kQ" domains and :[a fin- gers, recognize methTlated lTsines c6#,62d. Repressive Published: 20 December 2007 Biology 2007, 8:R270 (doi:10.1186/gb-2007-8-12-r270) Received: 2 October 2007 Revised: 6 December 2007 Accepted: 20 December 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/12/R270
- 172. Biology 2007, 8:R270 http://genomebiology.com/2007/8/12/R270Biology 2007, Volume 8, Issue 12, Article R270 Robin et al. R270.2 methTl-lTsine modifications are recognized bT chromodo- main-containing proteins such as [:6 and :olTcomb (:cG), Rhich bind methTlated [YeP and [Ye!#, respectivelT, and contribute to creation of heterochromatin-liEe structures c6Pd. Thus, [YeP methTlation has been linEed to both aN7 methTlation c!",!6d and l-chromosome inactivation c!!d. aifferent modifications of histone amino-terminal tails con- stitute the so-called 'histone code' c!Yd. Indeed, specific com- binations of histone modifications can alter chromatin structure to alloR transcription or to repress it, either revers- iblT or stablT c6d. Chromatin modifications confer a uniLue identitT on the nucleosomes involved. The composite pattern of modifications regulates the binding and activities of other chromatin-associated components. Indeed, modifications of histones at a specific nucleosome verT liEelT influence subse- Luent modifications, regulated bT both !"# and %&'(# mecha- nisms. Characterizing such modifications could provide insight into the roles of chromatin-binding proteins In this studT, Re Rere interested in the 'histone code' associ- ated Rith the [UTs SuvYPh6 and GPa, as these tRo [UTs generallT localize to tRo distinct regions in the nucleus. Stud- Ting modifications of the histones associated Rith these [UTs could help in understanding the "( )")* state of consti- tutive heterochromatin associated Rith SuvYPh6, and that of the silent euchromatin and facultative heterochromatin asso- ciated Rith GPa. @ur approach Ras to identifT post-translational modifica- tions on histones co-purified Rith tagged SuvYPh6 and GPa [UTs. ke performed a double immunopurification of these proteins from chromatin preparations enriched in mono- nucleosomes. ke then studied histone modifications bT a propionTlation-based modification method, folloRed bT mass spectrometrT analTsis c!Q-!#d. ke used four cell sTstems in this studT: normal liver cells, [eLa cells, [eLa cells expressing a tagged form of SuvYPh6, and [eLa cells expressing a tagged form of GPa. ke began bT comparing the global epigenetic modifications of crude nucle- osomal histones isolated from these cell lines. ke observed a decrease of the three repressive trimethTlation marEs ([YeP, [Ye!# and [Qe!") in cancerous [eLa cells compared Rith normal liver cells. [eLa cells expressing tagged SuvYPh6 have a higher [YePmeY content than the parent [eLa cells, Rhereas [eLa cells expressing tagged GPa shoR a higher level of [YePme and non-modified [YeP. ke also identified a neR epigenetic modification, the monomethTlation of LTs#P on histone [Q. @ur results help define the histone code asso- ciated Rith SuvYPh6 and GPa. [istone [Y associated Rith SuvYPh6 is heavilT trimethTlated at LTsP, Rhereas [Ye!# and [Qe!" are mainlT dimethTlated. In addition, SuvYPh6 is associated Rith methTlation at [Ye62, [Ye#P and [Qe#P. [istone [Y associated Rith GPa is mainlT mono- or dimeth- Tlated at LTsP, as expected. InterestinglT, Re find SuvYPh6 and GPa to be associated Rith substantial acetTlation of [Qe6f, [Ye62 and [Ye!Y. TaEen together, our results confirm some histone modifica- tions previouslT found to be associated Rith SuvYPh6 and GPa, and shoR, for the first time, an unexpected association betReen these repressor proteins and histone acetTlation, Rhich normallT activates transcription. Results Determination of global histone modifications ke first compared the basal modifications present on the crude nucleosomal histones in the different cell lines used: the cancerous [eLa cell line, and the [eLa cell lines stablT expressing the [YeP-specific trimethTlase SuvYPh6 ([eLa- SuvYPh6) or dimethTlase GPa ([eLa-GPa). [eLa-SuvYPh6 and [eLa-GPa cell lines give a different bacE- ground pattern of [YeP, [Ye!" and [Ye!# methTlation states. Indeed, our results shoR an approximatelT Q"m increase in [YePmeY in [eLa-SuvYPh6 cells compared to [eLa cells (Figure 6b), Rhereas levels of this modification are similar in [eLa and [eLa-GPa cells (Figure 6b). In [eLa- SuvYPh6 cells, [Qe!"meY and [Ye!#meY are present at similar levels to those found in [eLa cells (Figure 6b). khen Re compare [eLa-SuvYPh6 to [eLa cells, the increase in [Ye!#me! is similar to the decrease in [Ye!#me, bT approx- imatelT 6"-6gm (Figure 6b), Rhereas [Ye!#meY increases slightlT in [eLa-GPa cells (Figure 6b). SurprisinglT, in [eLa cells expressing the [YeP dimethTlase GPa, the [YePme and non-modified [YeP ([YePnm) forms increase significantlT, Rhereas [YePme! decreases bT !6m relative to [eLa cells (Figure 6b). GenerallT, methTlation at [Ye!# and [Qe!" occurs to the same extent in [eLa and in [eLa-GPa cells (Fig- ure 6b). UethTlation on [YeYf occurs at comparable levels in [eLa cells and in [eLa-SuvYPh6 cells, Rhereas [eLa-GPa cells shoR a slight increase (6gm) in non-modified [YeYf (Figure 6b). In [eLa-GPa cells, [YeYfme! decreases bT roughlT 62m compared Rith [eLa cells (Figure 6b). For the amino-terminal histone [Q peptide Q- GegGGe2GLGe6!GG7e6fR-6# ('peptide Q-6#'), the predomi- nant form detected in the three cell lines Ras a non-modified one corresponding to an ion of 6,gg" m`z (Figure 6c). The most abundant single modification of this peptide is acetTlated [Qe6f ([Qe6fac), detected as an ion of 6,gYf m` z, Rhich appears at a level of 6Qm in [eLa cells, 6gm in [eLa- SuvYPh6, and fm in [eLa-GPa cells (Figure 6c). [Qe6fac is found mostlT alone, but can be found in combination Rith [Qe2ac or Rith [Qe6!ac (data not shoRn). 7 triacetTlated form of this peptide Ras also found, representing less than 6m of the total (data not shoRn). The second most abundant modification of peptide Q-6# is [Qe6!ac, Rhich is found either as a single modification or in combination Rith [Qe2ac or [Qe6fac (Figure 6c, panacetTl). Considering the
- 173. http://genomebiology.com/2007/8/12/R270 2007, Volume8, Issue 12, Article R270 Robin R270.3 2007, 8:R270 Comparison of histone H3 and H4 modifications in different cell typesFigure 1 Comparison of histone H3 and H4 modifications in different cell types. (a) Purification of crude nucleosomal histones. Nucleosomal histones were separated on a 4-12% gradient NuPAGE gel and run in MES buffer (Invitrogen), fixed, and stained with Seeblue (Invitrogen). Lane 1, SeeBlue pre-stained molecular weight markers (Invitrogen); lane 2, nucleosomal histones from normal mouse liver; lane 3, nucleosomal histones from HeLa cells, purified on a POROS HQ column. (b) Methylation states of H3K9, H3K27, H3K36, and H4K20. nm, non-modified; me, monomethyl; me2, dimethyl; me3, trimethyl. Shown are the means of four independent experiments. (c) Basal amino-terminal modifications of histone 4 in the indicated cell types. 'H4 4-17nm': unmodified H4 peptide containing amino acids 4-17. Shown are the means of four independent experiments (± standard deviation). Pan-ac: panacetylated. (a) 1 2 Macro- H2A1.1 H1, H5 HP1 H3, H2B H2A Percentrelativeabundance (c) HeLaLiver H4 3 MW (KDa) 39 28 19 14 Histone H4 Percentrelativeabundance nm me me2 me3 H3K36 H4K20 Percentrelativeabundance H3K9 Percentrelativeabundance H3K27 (b) 10 20 30 40 50 60 70 10 20 30 40 50 60 70 80 90 nm me me2 me3 Percentrelativeabundance 10 20 30 40 50 60 70 80 nm me me2 me3 10 20 30 40 50 60 70 80 90 nm me me2 me3 HeLa-G9a H4K16ac H4K12acH4 4-17 pan-ac H4 4-17nm 10 20 30 40 50 60 70 80 90 100 Liver HeLa Hela-Suv39h1 HeLa-G9aLiver HeLa Hela-Suv39h1
- 174. 2007, 8:R270 http://genomebiology.com/2007/8/12/R270 2007,Volume 8, Issue 12, Article R270 Robin R270.4 total monoacetTlated plus panacetTlated peptide, [Qe6!ac occurs in gm of the peptide Q-6# in [eLa cells, 6"m in [ela- SuvYPh6, and less than 6m in [eLa-GPa cells. ke cannot explain the much loRer level observed in [eLa-GPa cells. FinallT, Re found a neR modification on histone [Q: [Qe#P monomethTlation (see 7dditional data file !). Indeed, approximatelT !"m of [Qe#P is methTlated in [eLa, [eLa- SuvYPh6, [eLa-GPa, and normal liver cells. ke confirmed this methTlation bT analTzing trTpsin-digested histone [Q Rithout anT additional treatment. Xsing this method, this ion gives a poor signal, and it is detected at a level of !m of the partiallT digested e#P-RP! peptide. This ten-fold decrease is mostlT due to the poor signal, but this ion gives a robust and complete T-series and a poor b-series in the collision frag- mentation result. This modification has never been described in mammals but Ras suggested in +,-#'&./ c!2d. ke also detected an acetTlated form of this amino acid at a level of fm in the bacEground cell lines. To further validate our method, Re compared the global his- tone modifications in normal liver cells and in the cancerous [eLa cells. This approach has been validated in previous studies of histone modifications in cancer cells c!Pd. @ur results shoR a dramatic difference in the usage of the histone [Y variant [Y.Y, Rhich, surprisinglT, is present in f"m of the nucleosomes of normal mouse liver and in onlT !-Ym of nucleosomes in [eLa cell lines (data not shoRn). The amounts of the histone [!7 variant macro-[!7 seem com- parable in normal liver cells and [eLa cells (Figure 6a). ke then extensivelT studied the three lTsine methTlation modifications associated Rith heterochromatin - [YePme, [Qe!"me and [Ye!#me - as Rell as the [YeYfme modifica- tion. ke observed a decrease of 6"-!"m for the repressive tri- methTlation of [YeP, [Ye!# and [Qe!" in [eLa cells compared to normal liver cells (Figure 6b). 7 similar result has alreadT been reported for [Qe!" c!Pd. ConverselT, the di- and trimethTlated lTsine [YeYf, Rhich are mainlT associated Rith transcriptional activation, shoR an increase in [eLa cells (Figure 6b), Rhereas the non-modified [YeYf decreases significantlT in [eLa cells compared to normal liver cells (Figure 6b). For the amino-terminal histone [Q peptide Q-6#, Re also detected three different ions. The non-modified form is the predominant species in both normal liver and in [eLa cells (Figure 6c). 7 single acetTlation at [Qe6f ([Qe6fac) accounts for !Ym of the peptide Q-6# in liver and 6Qm in [eLa cells (Figure 6c). This [Qe6fac modification can be found in combination Rith [Qe2ac or Rith [Qe6!ac in another #m of the peptide Q-6# species in mouse liver cells (data not shoRn). Considering the total monoacetTlated plus panacetTlated peptides, [Qe6!ac occurs 6"m of the time in normal liver but onlT gm in [eLa cells (Figure 6c and data not shoRn). In summarT, the protocol Re used to studT modifications of crude histone preparations, especiallT those of histones [Y and [Q, gave satisfactorT and informative results. Conse- LuentlT, Re used this protocol to studT the histone code asso- ciated Rith the [UTs SuvYPh6 and GPa. Determination of the epigenetic modifications on histones H3 and H4 associated with HMTs Suv39h1 and G9a in HeLa cells The main goal of our studT Ras to identifT the histone modi- fications associated Rith the [YeP-specific [UTs SuvYPh6 and GPa, especiallT on histones [Y and [Q. To this end, Re performed double-affinitT purification of [7-Flag-SuvYPh6 and [7-Flag-GPa complexes from chromatin enriched in mononucleosomes (Figure !a and 7dditional data file 6). The SuvYPh6-associated complex is visualized in Figure !b, lane !. ke observe good stoichiometrT of the SuvYPh6-associated proteins stronglT bound to chromatin, such as members of the [:6 protein familT, histones [6-[g, and macro-[!7 (Figure !b). The double immunopurification has been per- formed on chromatin extracts from the [eLa control cell line transduced bT the emptT vector to measure the bacEground signal. The results do not give anT Luantifiable signal, espe- ciallT at the histone molecular Reight (data not shoRn). [YePmeY and [Qe!"me! associate Rith SuvYPh6 at levels of 26m and f2m, respectivelT (Figure !c). These percentages are approximatelT Q"m loRer in [eLa-SuvYPh6 cells (compare Figures 6b and !b, or see 7dditional data file Y). :osition [Ye!# is dimethTlated ([Ye!#me!) 2"m of the time in SuvYPh6 complexes versus fgm in [eLa-SuvYPh6 cells (com- pare Figures 6b and !b, or see 7dditional data file Y). FinallT, SuvYPh6 is mainlT associated Rith non-modified and dimeth- Tlated forms of [YeYf (Figure !c). In the protein complex associated Rith the [UT GPa, [YePme and [YePme! both occur Q"m of the time (Figure 6b), compared Rith !6m and g!m in [eLa-GPa cells, respec- tivelT (Figure !c). Thus, there is a significant enrichment of [YePnm and [YePme in the GPa complex. ke did not suc- ceed in detecting [YePmeY on GPa-associated histone [Y, Rhereas this modification is detected approximatelT 6Ym of the time in [eLa-GPa cells (Figures 6b and !b and see 7ddi- tional data file Y). GPa protein is associated Rith the mono- methTlated form of [Qe!", Rith 66m enrichment compared to the [eLa-GPa cell line. Indeed, GPa is found to be associ- ated Rith [Qe!"me and [Qe!"me! Y#m of the time (Figure !c). For [Ye!# and [YeYf, the GPa complex gives the same distribution as its bacEground cell line. Indeed, GPa is associ- ated Rith [Ye!#me !"m of the time and Rith [Ye!#me! fQm of the time. 7t position [YeYf, GPa is found Rith the unmodified, mono-, or dimethTlated forms (Figure !c). In conclusion, a comparison of histone modifications associ- ated Rith SuvYPh6 or GPa shoRs that SuvYPh6 is associated Rith [YePmeY, Rhereas GPa is associated Rith [YePme and
- 175. http://genomebiology.com/2007/8/12/R270 2007, Volume8, Issue 12, Article R270 Robin R270.5 2007, 8:R270 [YePme!. This result is expected: SuvYPh6 is a EnoRn tri- methTlase, and GPa a EnoRn dimethTlase, of position [YeP. SurprisinglT, SuvYPh6 is not associated Rith [Qe!"meY. ke have also studied [Y modifications at the folloRing posi- tions: [Ye62, Rhich can be either acetTlated or monomethTl- ated, though Re have also occasionallT detected a dimethTlated form (7dditional data file Q)W [Ye!Y, Rhich can onlT be acetTlatedW and [Ye#P, Rhich can be monomethTl- ated. SurprisinglT, Re found [Ye62ac associated Rith both SuvYPh6 and GPa complexes Pm of the time (7dditional data file g). ke also detected the monomethTlated form of [Ye62 in SuvYPh6 complexes 2m of the time, constituting an 2m enrichment, as this modification is barelT detectable in [eLa- SuvYPh6 cells. The monomethTlated form of [Ye62 has been described previouslT c!#d. 7cetTlation of [Ye!Y is present gm of the time in SuvYPh6 and 2m in GPa complexes (7dditional data file g). UethTlation of [Ye#P has also been studied and Ras detected in association Rith SuvYPh6 about 6gm of the time, but is not detected Rith GPa. Concerning histone [Q, Re did not find the panacetTlated form of the [Q peptide Q-6# in either SuvYPh6 or GPa com- plexes. [oRever, Re found [Qe6fac associated Rith SuvYPh6 complexes 6#m of the time and Rith GPa complexes !!m of the time (Figure !d). 7n acetTl group and a trimethTl group have comparable masses, so to confirm the [Qe6fac modifi- cation, Re performed a U7LaI-T@F analTsis on the same sample that Re used for ion trapping, Rith internal scaling using histone peptides of non-ambiguous mass (7dditional data file f). ke found the m`z ratio for the ion to be 6,gYf.f6f". This is in agreement Rith the theoretical mass of an acetTl group and four propionTl groups on peptide Q-6#. Thus, the signal detected on [Qe6f corresponds most proba- blT to an acetTl group. Discussion UanT reports to date have analTzed histone modifications bT different approaches. 7lthough these studies have improved our understanding of the role of histone modifications in biological pathRaTs, to our EnoRledge feR studies have Figure 2 (b) MW(KDa) Suv39h1 complex 1 2 Macro- H2A1.1 H1, H5 HP1 H3, H2B H2A tagged Suv39h1 64 51 39 28 19 14 H4 Histone H4 (d) H4K16ac H4 4-17 pan-ac H4 4-17nm Percentrelativeabundance Suv39h1 complex G9a complex Percentrelativeabundance PercentrelativeabundancePercentrelativeabundance Percentrelativeabundance H3K36 H4K20 H3K9 H3K27 nm me me2 me3 10 20 30 40 50 60 70 80 90 100 10 20 30 40 50 60 70 80 90 100 10 20 30 40 50 60 70 80 90 100 10 20 30 40 50 60 70 80 90 100 nm me me2 me3 nm me me2 me3 nm me me2 me3 Suv39h1 complex G9a complex HMT HMT T Chromatin extracts preparation (MNase) HMTT HMT Crude histones preparation:HMT-histones complex purifcation: Purification on Flag resin Purification on HA resin SDS-PAGE resolution, mass spec analysis of histone modifcations POROS anion exchange column Elution with a salt gradient (a) 20 40 60 80 100 HMTTHMT HMTT HMTTHMT Elution against Flag peptide Elution against HA peptide Chromatin (c) Post-translational modifications of histones H3 and H4 associated with thechromatin-binding proteins Suv39h1 and G9aFigure 2 Post-translational modifications of histones H3 and H4 associated with the chromatin-binding proteins Suv39h1 and G9a. (a) Schematic representation of the purification protocols used to purify the HMT- histone complexes and crude histones. (b) Doubly immunopurified Suv39h1 complexes from chromatin extracts of 20 g of HeLa-Suv39h1 cells were resolved on a 4-12% gradient NuPAGE gel, run in MES buffer (Invitrogen), fixed, and stained with Colloidal blue. Lane 1, SeeBlue pre- stained molecular weight markers (Invitrogen); lane 2, Suv39h1 complex from chromatin fractions. (c) Amino-terminal lysine methylation of histones H3 and H4 associated with Suv39h1 or G9a proteins. (d) Post- translational modifications of histone H4 associated with Suv39h1 or G9a. Shown are the means of three independent experiments (± standard deviation).
- 176. 2007, 8:R270 http://genomebiology.com/2007/8/12/R270 2007,Volume 8, Issue 12, Article R270 Robin R270.6 sought to provide a sTstematic analTsis of the histone modifi- cations associated Rith a given chromatin-binding protein cY"d. In this studT, Re attempted to investigate modifications of the histones [Y and [Q associated Rith the [YeP-specific [UTs SuvYPh6 and GPa. Basal modifications of histones H3 and H4 in normal versus cancer cells To validate our method, Re first studied the basal histone modifications in the different cell lines used in this studT. [eLa cells stablT expressing tagged [YeP tri-methTlase SuvYPh6 shoR an increase in [YePmeY compared to [eLa cells, Rhereas [YePme and [YePme! decrease significantlT. This result is in agreement Rith a previous RorE using #.)01,-`- cells in Rhich the level of [YePmeY Ras found to decrease, [YePme! Ras unaffected and [YePme increased c!Qd. Furthermore, a studT in 2&*#*3,"4' shoRed that a 5.)01,6 hTperactive mutant displaTed an increase in [YeP di- and trimethTlation cY6d. In [eLa cells expressing tagged GPa, Rhich is preferentiallT a dimethTlase of [YeP, [YePme and [YePnm increase significantlT compared to [eLa cells, Rhereas [YePme! decreases. This last result Ras totallT unexpected, but as GPa cooperates Rith the other Eu[UTase, GL: (Eu[UTase 6), it maT be necessarT to co-express the tRo proteins to see an increase in [YePme!. TaEen together, these results suggest that SuvYPh6, Rhen over-expressed, can convert a mono- or a dimethTlated [YeP to a trimethTlated state, Rhereas GPa can monomethTlate [YeP. [Qe!"meY and [Ye!#meY do not seem to change in [eLa- SuvYPh6 compared to [eLa cells. 7nd, generallT, [Ye!# and [Qe!" methTl modifications are present to the same extent in [eLa and in [eLa-GPa cells. ke found that three of the repressive methTlation modifica- tions ([YePme, [Ye!#me, and [Qe!"me) Rere underrepre- sented in [eLa cells and derivative lines compared to normal liver cells, Rhereas the activating modification [YeYfme Ras overrepresented compared to normal liver cells. The decrease in repressive methTlation is reminiscent of general aN7 methTlation in tumor cells cY!d. Tumor suppressor gene pro- moters are found to be heavilT methTlated in tumors cYY,YQd, and indeed there is cross-talE betReen [YeP methTlation and aN7 methTlation in manT species c!6,Yg,Yfd. In the case of tumor suppressor genes, it has been shoRn that theT are also silenced bT methTlation on [YeP, [Ye!# and [Qe!" cYY,Y#d, Rith or Rithout concomitant aN7 methTlation of the promoter. ConverselT, one might thinE that oncogenes in tumor cells could be methTlated on [YeYf and hTpo-methTl- ated on [YeP and [Ye!#. It Rill be interesting to test Rhether the methTlation pattern of aN7 and the methTlation of [YeP and [Ye!# overlap 'geographicallT' in tumor cells. FinallT, Re report here a neR modification of histone [Q, the monomethTlation of [Qe#P, Rhich is found at a level of !"m in normal liver cells, as Rell as in [ela cells. Post-translational modifications of Suv39h1- and G9a- associated histones H3 and H4 ke have studied post-translational modifications of chroma- tin-bound histones associated Rith the [UTs SuvYPh6 and GPa, Rhich overlap onlT partiallT in their nuclear distribu- tion. Indeed, SuvYPh6 is mainlT located in the pericentric and constitutive heterochromatin, Rhereas GPa Ras first described as a euchromatic protein, and later Ras shoRn to have a broader distribution in the nucleus c6fd. The distribu- tion of both proteins is associated Rith specific methTlation states of LTsP on histone [Y. khen associated Rith SuvYPh6 in constitutive heterochromatin, [YeP is mainlT trimethTl- ated but also dimethTlatedW Rhen associated Rith GPa in euchromatin and facultative heterochromatin, it is either non-modified, mono-, or dimethTlated. ke found SuvYPh6 to be associated mainlT Rith dimethTlation at [Qe!", but GPa Ras associated eLuallT freLuentlT Rith mono- or dimethTla- tion at this position. Both SuvYPh6 and GPa are associated mainlT Rith the dimethTlated form of [Ye!#. Thus, SuvYPh6 is mainlT associated Rith [YePmeY, [Ye!#me!, and [Qe!"me!. These three modifications are EnoRn to act in concert to create a heterochromatin structure. 7t least in embrTonic stem cells, SuvYPh6 has been suggested to maintain [YeP trimethTlation, [Ye!# monomethTlation and [Qe!" trimethTlation at pericentromeric heterochroma- tin c!Q,Y2d. The apparent discrepancT betReen those results and ours could be explained bT differences betReen embrT- onic stem cells and [eLa cells. @ur RorEing model suggests that there is a direct or indirect interaction betReen SuvYPh6 and the [UTs responsible for [Qe!" and [Ye!# methTla- tion, namelT SuvQ-!"h and the :olTcomb protein Ezh!, respectivelT. Indeed, a phTsical association betReen SuvYPh6 and :cG proteins has been reported cYPd. It has been suggested that [YeP trimethTlation constitutes the first event leading toRard [Qe!" trimethTlation cY2d. [:6 proteins, Rhich recognize [YePmeY created bT SuvYPh6, recruit SuvQ-!"h, the enzTme that normallT establishes [Qe!"meY. @ur results suggest that SuvYPh6 is preferen- tiallT associated Rith [Qe!"me!, but not [Qe!"meY. This association might correspond to an intermediate state of [Qe!" methTlation. 7nother possibilitT is that heterochro- matin modification is not homogenousW for example, some SuvYPh6-bound nucleosomes maT be dimethTlated on [Qe!", Rhile adjacent nucleosomes are trimethTlated on [Qe!". ke have found a significant enrichment of [Ye62ac and [Ye!Yac in SuvYPh6-chromatin complexes. [Ye!Y is located Rithin the epitope of histone [Y that is recognized bT the chromodomain of :olTcomb proteins c6Pd. Therefore, [Ye!Y acetTlation could regulate this recognition bT prevent- ing the formation of the :olTcomb complex. Indeed, distinct localizations betReen [YePmeY, Rhich is associated Rith
- 177. http://genomebiology.com/2007/8/12/R270 2007, Volume8, Issue 12, Article R270 Robin R270.7 2007, 8:R270 SuvYPh6, and [Ye!#meY, Rhich is recognized bT :olTcomb complex, have been deduced from ChI:-chip analTsis cQ"d. In addition, Re have observed an acetTlated form of LTs6f of histone [Q associated Rith both SuvYPh6 and GPa. It is Luite surprising to have [Qe6fac associated Rith the transcription repressors SuvYPh6 and GPa, since this modification is mainlT associated Rith transcriptional activation. Even so, it is unclear Rhether [Qe6fac alRaTs causes activation, since it is associated Rith constitutive heterochromatin in manT spe- cies cQ6,Q!d, and another acetTlation marE, [Qe6!ac, is involved in the establishment of heterochromatin in 2&*7 #*3,"4' cQYd. Furthermore, it is EnoRn that GPa can be a coac- tivator cQQd. It maT be that acetTlation at [Qe6f is involved in recruiting SuvYPh6 and GPa, but also other proteins, to the histone tails. For example, the chromatin remodeling complex kIN7C has been described to bind [Ye6Qac via kSTF to induce repres- sion of a target gene cQgd, and [Qe6f could plaT a similar role in the nucleosomal context. In addition, binding of the NoRC complex to [Qe6fac is reLuired for the subseLuent deacetTla- tion of [Qeg, [Qe2, and [Qe6! during the NoRC-dependent establishment of heterochromatin cQfd. FinallT, [Qe6f acetTlation varies in a cell cTcle-dependent manner and is associated Rith replication cQ#-QPd. SuvYPh6 and GPa are also linEed to aN7 replication cg"d. 7s [Qe6f is the first lTsine to be acetTlated after replication cQPd, SuvYPh6 and GPa could associate Rith this form in a replication-dependent manner. ke have found a neR histone [Q modification: monomethTl- ation of [Qe#P. [Qe#Pme is detected in SuvYPh6 and GPa complexes. This modification has never been described in mammals but Ras suggested in +,-#'&./ c!2d. Uutation of [Qe#P in 5'!!,'&*/-!8# !8&8)"#"'8 affects both telomeric and raN7 silencing cg6d. In fact, [Qe#P is part of the Lrs (Loss of ribosomal silencing) nucleosomal domain cg!d, sug- gesting that [Qe#P methTlation is associated Rith gene silencing. Indeed, [Qe#P is located close to [Ye#P in the nucleosome structure and contacts the aN7 surface cg6,gYd, suggesting that its charge is important for silencing raN7 genes cg6,gYd. FinallT, Re found [Ye#Pme associated Rith SuvYPh6, but not Rith GPa. This modification preferentiallT labels constitutive heterochromatin and perhaps more specif- icallT telomeres. Conclusion In conclusion, Re can combine double immunopurification and mass spectrometrT to uncover novel associations of his- tone modifications Rith specific chromatin-binding proteins. This method alloRed us to demonstrate for the first time an association of acetTlated histones Rith the repressor proteins SuvYPh6 and GPa. It Rould be interesting to studT the signif- icance of such an association. Materials and methods Purification of Suv39h1 and G9a complexes [eLa cell lines stablT expressing SuvYPh6 and GPa Rere established Rith human transgenes coding for full-length proteins SuvYPh6 (amino acids 6-Q6!) and GPa (amino acids 6-6,!66) tagged Rith double-[7 (haemagglutinin) and dou- ble-FL7G epitopes at the amino terminus. 7 [eLa control cell line transduced Rith the emptT vector has been established and used to control the complex purification protocols. These cell lines shoRed about the same proliferation rate as the par- ent [eLa cell line. To purifT nucleosomes, Re used !" g of drT cell pellet per experiment, Rhich corresponds roughlT to 6" billion cells. Cells Rere resuspended in a hTpotonic buffer, lTsed and dis- rupted using !" stroEes of a tight-fitting aounce homoge- nizer, and centrifuged to pellet the nuclei cgQd. SuvYPh6 and GPa complexes Rere purified as described in cggd. BrieflT, nuclei Rere resuspended and digested Rith micrococcal nuclease (Sigma, Saint-nuentin Fallavier, France) until theT consisted primarilT of mononucleosomes (7dditional data file 6). The complexes associated Rith nucleosomes Rere then purified bT immunoprecipitation using anti-FL7G antibodT immobilized on agarose beads (Sigma). 7fter elution Rith the FL7G peptide (sTnthesized bT 7nsTnth, Roosendal, The Netherlands), the bound complexes containing nucleosomes Rere further affinitT-purified on anti-[7 antibodT-conju- gated agarose (Sigma) and eluted Rith the [7 peptide (sTn- thesized bT 7nsTnth, Roosendal, The Netherlands). The eluted protein complexes Rere then resolved on precast Nu:7GE Q-6!m bis-Tris acrTlamide gradient gel in UES buffer (Invitrogen, CergT :ontoise, France) and stained Rith Colloidal blue (Invitrogen, CergT :ontoise, France). 7t this step, bands corresponding to histones Rere cut from the gel and subjected to a propionTlation-based modification method (see beloR). The other bands Rere also cut from the gel, trTpsin-digested using ".Q mg of seLuencing-grade trTpsin (:romega, Charbonnières, France), and identified bT mass spectrometrT. Crude histone purification Nuclei from mouse liver Rere prepared as described in cgfd. Nuclei from liver cells and nuclei obtained from different [eLa cell lines Rere Rashed, digested Rith micrococcal nuclease (Sigma) at g" units per !" g of initial tissue or cell pellet, and sonicated for Q minutes. Crude nucleosomes Rere further purified on a :@R@S [n!" anion exchange column pacEed in a Q.f mm p 6"" mm :@R@S column (7pplied Bio- sTstems, Courtaboeuf, France), loaded at ".Qg U NaCl, and eluted Rith a salt gradient extending to 6.g U NaCl in g" mU Tris (p[ f.g). Nucleosomal histone preparation for mass spectrometry analysis Nucleosomal histones associated Rith SuvYPh6 or GPa, and crude histones purified from [eLa cells or from normal
- 178. 2007, 8:R270 http://genomebiology.com/2007/8/12/R270 2007,Volume 8, Issue 12, Article R270 Robin R270.8 mouse liver, Rere run on a precast Nu:7GE Q-6!m bis-Tris acrTlamide gradient gel Rith UES buffer (Invitrogen, CergT :ontoise, France) and stained Rith Colloidal blue (Invitro- gen). Gel bands corresponding to each histone Rere cut and destained overnight in g"m acetonitrile, g" mU N[Q[C@Y. [istones Rere then subjected to a propionTlation-based mod- ification method c!Q-!#d. :ropionic anhTdride maEes cova- lent bonds Rith non-modified or monomethTlated lTsines and Rith the amino termini of proteins. Gel slices Rere treated for 6 h at Y#qC Rith 6"" !l of Y"m propionic anhTdride in methanol and Q" !l of g" mU N[Q[C@Y c!Q-!fd, folloRed bT tRo ten-minute Rashes in 6"" mU N[Q[C@Y, one Rash in g"m acetonitrile, 6"" mU N[Q[C@Y, and one Rash in ace- tonitrile. The slices Rere then dried and digested at Y#qC over- night using ".Q !g of seLuencing-grade trTpsin (:romega). The digests Rere acidified in ".gm trifluoroacetic acid, lTophi- lized, resuspended in Q" !l of g" mU N[Q[C@Y, and propionTlated again in 6"" !l of Y"m propionic anhTdride in methanol for 6 h at Y#qC, lTophilized and resuspended in !" !l of ".6m of formic acid. The second propionTlation modified the neRlT created amino-terminal ends after trTpsin diges- tion. These conditions gave complete lTsine and amino-termi- nal propionTlation, but also chemical methTlations that can be detected using deuterated methanol (methanol-dQ) for the propionic anhTdride dilution (not shoRn). Determination of histone modifications by mass spectrometry The peptide mixtures obtained as described above Rere run on a Nano C62 :epUap 6"" pre-column (g mm, 6"" r, Y"" !m I.a. p 6 mm), coupled Rith a column of #g !m I.a. p 6g cm Rith the same resin (LC :acEings, aionex, /oisins le Breton- neux, France). The Nano-floR-[igh :ressure LiLuid Chroma- tographT LC (LC :acEings) is directlT coupled to an electrospraT ionization sTstem on an ion-trap mass spectrom- eter (ESI`US-USW ThermoFinnigan LCn aeca l:). The five most intense ions of the mass spectrometrT scan Rere sub- jected to fragmentation (US-US) Rithout anT data-depend- ent scan. The interpretation of the mass spectrometrT data Ras performed Rith the BiokorEs softRare version Y.! (Thermo Scientific, Courtaboeuf, France), Rith the folloRing specifications: a banE of peptides from the histones cut at arginine residues Ras indexed Rith permanent add mass for the amino terminus and lTsine of gf."!g aa, and three poten- tial modifications - e minus 6Q."6g for acetTlation or trimeth- Tlation, es6Q."6g aa for a monomethTlation and e minus !#.PPg aa for a dimethTlation. This set-up alloRed us to auto- mate analTsis of the mass spectrometrT raR data. Each raR dataset Ras analTzed to checE for combinations of modifica- tions that might have been missed bT the automated method. ke also tooE advantage of the fact that each modification shoRs a specific retention time on reverse phase [:LC. Ions di- and trimethTlated on lTsine elute before acetTlated ones, propionTlated ones elute later, and propionTlated plus mono- methTlated elute last. Just one ion did not folloR this rule, namelT, the highlT hTdrophobic peptide that bears the [Qe#P amino acid, for Rhich the propionTlated and methTlated form elutes before the propionTlated one. Retention times Rere used to confirm that the data analTsis reconstituted the frag- mentation correctlT. [istone modifications Rere Luantified bT the number of ions detected bT US`US analTsis: for each post-translational modification, results are presented as the number of ions detected that bear the modification, expressed as a percentage of the total number of peptides (modified or not) recognized in the US`US analTsis. 7ll masses are expressed in centroid m`z values. Abbreviations ac, acetTlatedW [7, haemagglutininW [eLa-GPa, [eLa cells stablT expressing human [7-FL7G-tagged GPa proteinW [eLa-SuvYPh6, [eLa cells stablT expressing human [7- FL7G-tagged SuvYPh6 proteinW [UT, histone methTtrans- feraseW me, monomethTlatedW me!, dimethTlatedW meY, tri- methTlatedW nm, non-modifiedW SuvYPh6, suppressor of variegation YPh6. Authors' contributions R: and 7S initiated and designed this studT. R: performed crude histone and complex purifications and did all the in- house mass spectrometrT analTsis on an ion-trap mass spec- trometer. FL performed SuvYPh6 and GPa complex purifica- tion. :@ performed cell culture and helped in complex purification. 7S established the cell lines expressing tagged proteins and set up the complex purification protocols, Rrote the paper, got the supporting grants and directed the research project. SF performed the U7LaI-T@F analTsis to confirm the [Qe6fac modification and helped in the analTsis of US data. 7ll the authors have participated in discussing the results and reading the manuscript. 7ll the authors have read and approved the final manuscript. Additional data files The folloRing additional data are available Rith the online version of this paper. 7dditional data file 6 shoRs the size of the aN7 extracted from the nucleosomal preparation used to purifT the SuvYPh6 complex. 7dditional data file ! shoRs the fragmentation of the ion [Qe#Pme. 7dditional data file Y shoRs selected amino-terminal lTsine methTlations of the his- tones [Y and [Q associated Rith SuvYPh6 and GPa proteins compared to their bacEground cell lines. 7dditional data file Q is about the fragmentation of the 6,"!# m`z ion Rith a pro- pionTl group at the amino terminus, tRo methTl groups on lTsine [Ye62, and a propionTl group on [Ye!Y. 7dditional data g shoRs selected histone [Y modifications in different cell bacEgrounds and in SuvYPh6 and GPa complexes. 7ddi- tional data f shoRs the [Qe6fac fragmentation on a U7LaI- T@F. 7dditional data file 6The size of the aN7 extracted from the nucleosomal preparationused to purifT the SuvYPh6 complexThe size of the aN7 extracted from the nucleosomal preparationused to purifT the SuvYPh6 complex.ClicE here for file7dditional data file !Fragmentation of the ion [Qe#PmeFragmentation of the ion [Qe#Pme.ClicE here for file7dditional data file YSelected amino-terminal lTsine methTlations of the histones [Yand [Q associated Rith SuvYPh6 and GPa proteins compared totheir bacEground cell linesSelected amino-terminal lTsine methTlations of the histones [Yand [Q associated Rith SuvYPh6 and GPa proteins compared totheir bacEground cell lines.ClicE here for file7dditional data file QFragmentation of the 6,"!# m`z ion Rith a propionTl group at theamino terminus, tRo methTl groups on lTsine [Ye62, and a propi-onTl group on [Ye!YFragmentation of the 6,"!# m`z ion Rith a propionTl group at theamino terminus, tRo methTl groups on lTsine [Ye62, and a propi-onTl group on [Ye!Y.ClicE here for file7dditional data file gSelected histone [Y modifications in different cell bacEgroundsand in SuvYPh6 and GPa complexesSelected histone [Y modifications in different cell bacEgroundsand in SuvYPh6 and GPa complexes.ClicE here for file7dditional data file f[Qe6fac fragmentation on a U7LaI-T@F[Qe6fac fragmentation on a U7LaI-T@F.ClicE here for file
- 179. http://genomebiology.com/2007/8/12/R270 2007, Volume8, Issue 12, Article R270 Robin R270.9 2007, 8:R270 Acknowledgements We thank Drs Thomas Jenuwein, Yoichi Shinkai, Irina Stancheva, Didier Trouche, Annick Harel-Bellan, Ali Hamiche and Marie Körner for providing crucial reagents. We thank Dr Anna Polesskaya, Mouloud Souidi, Dr Khalid Ouararhni and Maxime Marouteau for sharing material and technical help. We thank Drs Linda L Pritchard, Anna Polesskaya, Valentina Guasconi and Maya Ameyar-Zazoua for critical reading of the manuscript and scientific discussions. This work was supported by the Association Française contre les Myopathies (AFM); the Fondation Bettencourt-Schueller; the Ligue Nationale contre le Cancer (LNCC); the Association pour la Recherche sur le Cancer (ARC); the Ministère de la Recherche (ACI-Jeunes chercheurs, décision N° 04 3 75), the CNRS; and the Université Paris-Sud Orsay. OP was recipient of fellowship from the Ministère de la Recherche. References 1. Kouzarides T: Chromatin modifications and their function. Cell 2007, 128:693-705. 2. Martin C, Zhang Y: The diverse functions of histone lysine methylation. Nat Rev Mol Cell Biol 6: The epigenetic magic of histone lysine methylation. FEBS J 273: Histone lysine methylation: a signature for chromatin function. Trends Genet 19: The Set2 his- tone methyltransferase functions through the phosphor- ylated carboxyl-terminal domain of RNA polymerase II. J Biol Chem 278: et al. Set2 is a nucleosomal histone H3-selective methyltransferase that mediates tran- scriptional repression. Mol Cell Biol 22: Trilogies of histone lysine methylation as epigenetic landmarks of the eukaryotic genome. Cold Spring Harb Symp Quant Biol 69: Active genes are tri-methylated at K4 of histone H3. Nature 419: Unsafe SETs: histone lysine methyltransferases and cancer. Trends Biochem Sci 27: Mitotic phospho- rylation of SUV39H1, a novel component of active centro- meres, coincides with transient accumulation at mammalian centromeres. J Cell Sci 113: et al. Functional mamma- lian homologues of the Drosophila PEV-modifier Su(var)3-9 encode centromere-associated proteins which complex with the heterochromatin component M31. EMBO J 18: Structure-function analysis of SUV39H1 reveals a dominant role in heterochromatin organization, chromosome segre- gation, and mitotic progression. Mol Cell Biol 20: et al. Isolation and characterization of Suv39h2, a second histone H3 methyl- transferase gene that displays testis-specific expression. Mol Cell Biol 20: Set domain-con- taining protein, G9a, is a novel lysine-preferring mammalian histone methyltransferase with hyperactivity and specific selectivity to lysines 9 and 27 of histone H3. J Biol Chem 276: et al. G9a histone methyltrans- ferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis. Genes Dev 16: Functional analysis of the N- and C-terminus of mammalian G9a histone H3 methyltransferase. Nucleic Acids Res 33: Kim J, Daniel J, Espejo A, Lake A, Krishna M, Xia L, Zhang Y, Bedford MT: Tudor, MBT and chromo domains gauge the degree of lysine methylation. EMBO Rep 2006, 7:397-403. 18. Shi X, Kachirskaia I, Walter KL, Kuo JH, Lake A, Davrazou F, Chan SM, Martin DG, Fingerman IM, Briggs SD, et al.: Proteome-wide analysis in Saccharomyces cerevisiae identifies several PHD fingers as novel direct and selective binding modules of his- tone H3 methylated at either lysine 4 or lysine 36. J Biol Chem 2007, 282:2450-2455. 19. Fischle W, Wang Y, Jacobs SA, Kim Y, Allis CD, Khorasanizadeh S: Molecular basis for the discrimination of repressive methyl- lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev 2003, 17:1870-1881. 20. Tamaru H, Selker EU: A histone H3 methyltransferase controls DNA methylation in Neurospora crassa. Nature 2001, 414:277-283. 21. Fuks F, Hurd PJ, Wolf D, Nan X, Bird AP, Kouzarides T: The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. J Biol Chem 2003, 278:4035-4040. 22. Heard E, Rougeulle C, Arnaud D, Avner P, Allis CD, Spector DL: Methylation of histone H3 at Lys-9 is an early mark on the X chromosome during X inactivation. Cell 2001, 107:727-738. 23. Strahl BD, Allis CD: The language of covalent histone modifications. Nature 2000, 403:41-45. 24. Peters AH, Kubicek S, Mechtler K, O'Sullivan RJ, Derijck AA, Perez- Burgos L, Kohlmaier A, Opravil S, Tachibana M, Shinkai Y, et al.: Par- titioning and plasticity of repressive histone methylation states in mammalian chromatin. Mol Cell 2003, 12:1577-1589. 25. Johnson L, Mollah S, Garcia BA, Muratore TL, Shabanowitz J, Hunt DF, Jacobsen SE: Mass spectrometry analysis of Arabidopsis his- tone H3 reveals distinct combinations of post-translational modifications. Nucleic Acids Res 2004, 32:6511-6518. 26. Bonaldi T, Imhof A, Regula JT: A combination of different mass spectroscopic techniques for the analysis of dynamic changes of histone modifications. Proteomics 2004, 4:1382-1396. 27. Garcia BA, Hake SB, Diaz RL, Kauer M, Morris SA, Recht J, Shabanow- itz J, Mishra N, Strahl BD, Allis CD, et al.: Organismal differences in post-translational modifications in histones H3 and H4. J Biol Chem 2007, 282:7641-7655. 28. Waterborg JH, Fried SR, Matthews HR: Acetylation and methyla- tion sites in histone H4 from Physarum polycephalum. Eur J Biochem 1983, 136:245-252. 29. Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, Bonaldi T, Haydon C, Ropero S, Petrie K, et al.: Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet 2005, 37:391-400. 30. Zhou H, Madden BJ, Muddiman DC, Zhang Z: Chromatin assem- bly factor 1 interacts with histone H3 methylated at lysine 79 in the processes of epigenetic silencing and DNA repair. Bio- chemistry 2006, 45:2852-2861. 31. Ebert A, Schotta G, Lein S, Kubicek S, Krauss V, Jenuwein T, Reuter G: Su(var) genes regulate the balance between euchromatin and heterochromatin in Drosophila. Genes Dev 2004, 18:2973-2983. 32. Robertson KD: DNA methylation and human disease. Nat Rev Genet 2005, 6:597-610. 33. Nguyen CT, Weisenberger DJ, Velicescu M, Gonzales FA, Lin JC, Liang G, Jones PA: Histone H3-lysine 9 methylation is associ- ated with aberrant gene silencing in cancer cells and is rap- idly reversed by 5-aza-2'-deoxycytidine. Cancer Res 2002, 62:6456-6461. 34. Kondo Y, Shen L, Issa JP: Critical role of histone methylation in tumor suppressor gene silencing in colorectal cancer. Mol Cell Biol 2003, 23:206-215. 35. Lehnertz B, Ueda Y, Derijck AA, Braunschweig U, Perez-Burgos L, Kubicek S, Chen T, Li E, Jenuwein T, Peters AH: Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr Biol 2003, 13:1192-1200. 36. Tariq M, Saze H, Probst AV, Lichota J, Habu Y, Paszkowski J: Erasure of CpG methylation in Arabidopsis alters patterns of histone H3 methylation in heterochromatin. Proc Natl Acad Sci USA 2003, 100:8823-8827. 37. McGarvey KM, Fahrner JA, Greene E, Martens J, Jenuwein T, Baylin SB: Silenced tumor suppressor genes reactivated by DNA demethylation do not return to a fully euchromatic chroma- tin state. Cancer Res 2006, 66:3541-3549.
- 180. Genome Biology 2007,8:R270 http://genomebiology.com/2007/8/12/R270 Genome Biology 2007, Volume 8, Issue 12, Article R270 Robin et al. R270.10 38. Schotta G, Lachner M, Sarma K, Ebert A, Sengupta R, Reuter G, Rein- berg D, Jenuwein T: A silencing pathway to induce H3-K9 and H4-K20 trimethylation at constitutive heterochromatin. Genes Dev 2004, 18:1251-1262. 39. Sewalt RG, Lachner M, Vargas M, Hamer KM, den Blaauwen JL, Hen- drix T, Melcher M, Schweizer D, Jenuwein T, Otte AP: Selective interactions between vertebrate polycomb homologs and the SUV39H1 histone lysine methyltransferase suggest that histone H3-K9 methylation contributes to chromosomal tar- geting of Polycomb group proteins. Mol Cell Biol 2002, 22:5539-5553. 40. O'Geen H, Squazzo SL, Iyengar S, Blahnik K, Rinn JL, Chang HY, Green R, Farnham PJ: Genome-wide analysis of KAP1 binding suggests autoregulation of KRAB-ZNFs. PLoS Genet 2007, 3:e89. 41. Belyaev ND, Keohane AM, Turner BM: Histone H4 acetylation and replication timing in Chinese hamster chromosomes. Exp Cell Res 1996, 225:277-285. 42. Belyaev ND, Houben A, Baranczewski P, Schubert I: The acetyla- tion patterns of histones H3 and H4 along Vicia faba chromo- somes are different. Chromosome Res 1998, 6:59-63. 43. Swaminathan J, Baxter EM, Corces VG: The role of histone H2Av variant replacement and histone H4 acetylation in the estab- lishment of Drosophila heterochromatin. Genes Dev 2005, 19:65-76. 44. Lee DY, Northrop JP, Kuo MH, Stallcup MR: Histone H3 lysine 9 methyltransferase G9a is a transcriptional coactivator for nuclear receptors. J Biol Chem 2006, 281:8476-8485. 45. Fujiki R, Kim MS, Sasaki Y, Yoshimura K, Kitagawa H, Kato S: Ligand- induced transrepression by VDR through association of WSTF with acetylated histones. EMBO J 2005, 24:3881-3894. 46. Zhou Y, Grummt I: The PHD finger/bromodomain of NoRC interacts with acetylated histone H4K16 and is sufficient for rDNA silencing. Curr Biol 2005, 15:1434-1438. 47. Turner BM: Histone acetylation and control of gene expression. J Cell Sci 1991, 99:13-20. 48. Belyaev ND, Houben A, Baranczewski P, Schubert I: Histone H4 acetylation in plant heterochromatin is altered during the cell cycle. Chromosoma 1997, 106:193-197. 49. Waterborg JH: Identification of five sites of acetylation in alfalfa histone H4. Biochemistry 1992, 31:6211-6219. 50. Esteve PO, Chin HG, Smallwood A, Feehery GR, Gangisetty O, Karpf AR, Carey MF, Pradhan S: Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation during replication. Genes Dev 2006, 20:3089-3103. 51. Hyland EM, Cosgrove MS, Molina H, Wang D, Pandey A, Cottee RJ, Boeke JD: Insights into the role of histone H3 and histone H4 core modifiable residues in Saccharomyces cerevisiae. Mol Cell Biol 2005, 25:10060-10070. 52. Fry CJ, Norris A, Cosgrove M, Boeke JD, Peterson CL: The LRS and SIN domains: two structurally equivalent but functionally distinct nucleosomal surfaces required for transcriptional silencing. Mol Cell Biol 2006, 26:9045-9059. 53. Mersfelder EL, Parthun MR: The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure. Nucleic Acids Res 2006, 34:2653-2662. 54. Dignam JD, Lebovitz RM, Roeder RG: Accurate transcription ini- tiation by RNA polymerase II in a soluble extract from iso- lated mammalian nuclei. Nucleic Acids Res 1983, 11:1475-1489. 55. Ouararhni K, Hadj-Slimane R, Ait-Si-Ali S, Robin P, Mietton F, Harel- Bellan A, Dimitrov S, Hamiche A: The histone variant mH2A1.1 interferes with transcription by down-regulating PARP-1 enzymatic activity. Genes Dev 2006, 20:3324-3336. 56. Blobel G, Potter VR: Nuclei from rat liver: isolation method that combines purity with high yield. Science 1966, 154:1662-1665.
- 181. Annexe 3 Article 3 YahiH, Fritsch L, Philipot O, Guasconi V, Souidi M, Robin P, Polesskaya A, Losson R, Harel-Bellan A, Ait-Si-Ali S. Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. J Biol Chem. 2008 Aug 29;283(35):23692-700.
- 182. Differential Cooperation betweenHeterochromatin Protein HP1 Isoforms and MyoD in Myoblasts*□S Received for publication,April 4, 2008, and in revised form, June 25, 2008 Published, JBC Papers in Press,July 2, 2008, DOI 10.1074/jbc.M802647200 Hakima Yahi‡1,2 , Lauriane Fritsch‡1 , Ophelie Philipot‡3 , Valentina Guasconi‡ , Mouloud Souidi‡ , Philippe Robin‡ , Anna Polesskaya‡ , Regine Losson§ , Annick Harel-Bellan‡ , and Slimane Ait-Si-Ali‡4 From the ‡ Institut Andre´ Lwoff, CNRS, FRE 2944, 7 rue Guy Moquet, 94800 Villejuif, Universite´ Paris-Sud, Villejuif F-94801, France and the § Institut de Ge´ne´tique et de Biologie Mole´culaire et Cellulaire, CNRS UMR 7104 and INSERM U 596, Universite´ Louis Pasteur, Colle`ge de France, F-67404 Illkirch, France Mechanisms of transcriptional repression are important during cell differentiation. Mammalian heterochromatin protein 1 iso- forms HP1␣, HP1, and HP1␥ play important roles in the regula- tion of chromatin structure and function. We explored the possi- bility of different roles for the three HP1 isoforms in an integrated system,skeletalmuscleterminaldifferentiation.Inthissystem,ter- minal differentiation is initiated by the transcription factor MyoD, whose target genes remain mainly silent until myoblasts are induced to differentiate. Here we show that HP1␣ and HP1 iso- forms, but not HP1␥, interact with MyoD in myoblasts. This inter- action is direct, as shown using recombinant proteins in vitro. A gene reporter assay revealed that HP1␣ and HP1, but not HP1␥, inhibit MyoD transcriptional activity, suggesting a model in which MyoD could serve as a bridge between nucleosomes and chroma- tin-binding proteins such as HDACs and HP1. Chromatin immu- noprecipitationassaysshowapreferentialrecruitmentofHP1pro- teins on MyoD target genes in proliferating myoblasts. Finally, modulationofHP1proteinlevelimpairsMyoDtargetgeneexpres- sion and muscle terminal differentiation. Together, our data show a nonconventional interaction between HP1 and a tissue-specific transcription factor, MyoD. In addition, they strongly suggest that HP1 isoforms play important roles during muscle terminal differ- entiation in an isoform-dependent manner. Mammalian heterochromatin protein 1 (HP1)5 isoforms are closely related non-histone proteins that are involved in transcriptional regulation and chromatin organization. In mammals, HP1 exists in three isoforms: ␣, , and ␥ (Ref. 1 and references therein). Each is composed of a conserved chro- modomain that is important for heterochromatin binding and a chromoshadow domain (CSD), whose structure is similar to that of the chromodomain that is involved in dimerization and interaction with proteins containing the consensus sequence PXVXL (2). The chromodomain and the CSD are separated by a less conserved region called the hinge region. HP1 isoforms exhibit different subnuclear localizations in interphasic nuclei: HP1␣ is mainly centromeric; HP1 is also centromeric but to a lesser extent; and HP1␥ is located in both euchromatic and heterochromatic compartments (3). HP1 proteins are known to bind methylated histone H3 lysine 9 (H3K9) and heterodimer- ize, contributing to the formation and maintenance of hetero- chromatic structures (4, 5). HP1 isoforms interact with a wide variety of proteins, mainly chromatin-associated proteins (Refs. 1 and 6 and references therein). HP1 proteins have been implicated in many differentiation pathways (7–10), although their individual roles are not always well understood. During terminal differentiation of cells, chro- matin undergoes dramatic morphological changes (reviewed in Refs. 11–13), for example during muscle differentiation (14). These changes involve reorganization of constitutive hetero- chromatin (15) and selective silencing and activation of specific groups of genes (Refs. 7, 16, and 17; reviewed in Ref. 13 and references therein) and implicate both differential interactions of various proteins with chromatin and changes in the chroma- tin structure itself. Skeletal muscle terminal differentiation begins with an irre- versible withdrawal from the cell cycle, followed by muscle- specific marker expression with fusion of myoblasts into multinucleated myotubes (18). Cell cycle withdrawal corre- sponds to a definitive silencing of proliferation associated genes, such as E2F targets (Ref. 16; reviewed in Ref. 19 and references therein). Terminal muscle differentiation is orches- trated by the myogenic basic helix loop helix transcription fac- tors, such as MyoD, which is the master myogenic determina- tion factor. In proliferating myoblasts, MyoD is expressed but is unable to activate its target genes even when it binds to their promoters (20, 21). Therefore, the requirement for MyoD to be continuously expressed in undifferentiated myoblasts is enig- matic. MyoD might have a repressive role at its target genes prior to initiating chromatin remodeling in differentiating cells (20, 22, 23). In proliferating myoblasts, MyoD is associated with * This work was supported by the Association Franc¸aise contre les Myopa- thies, the Fondation Bettencourt-Schueller, the Ligue Nationale contre le Cancer, the Association pour la Recherche sur le Cancer, Ministe`re de la Recherche ACI-Jeunes Chercheurs De´cision 04375, the CNRS, Grant LSHG- CT-2004-502950 from the European Union 6th Framework program (to A. H.-B.), and the Universite´ Paris-Sud Orsay. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. □S The on-line version of this article (available at http://www.jbc.org) contains four supplemental figures. We dedicate this work to the memory of He´le`ne Richard-Foy. 1 These authors contributed equally to this work. 2 Recipient of a fellowship from the Ligue Nationale contre le Cancer. 3 Recipient of a fellowship from the Ministe`re de la Recherche. 4 To whom correspondence should be addressed. Tel.: 33-1-4958-3384; Fax: 33-1-4958-3307; E-mail: aitsiali@vjf.cnrs.fr. 5 The abbreviations used are: HP1, heterochromatin protein 1; CSD, chro- moshadow domain; H3K9, histone H3 lysine 9; HDAC, histone deacetylase; MCK, muscle creatine kinase; HA, hemagglutinin; GST, glutathione S-trans- ferasel; ChIP, chromatin immunoprecipitation; IP, immunoprecipitation. THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 35, pp. 23692–23700, August 29, 2008 © 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. 23692 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom http://www.jbc.org/cgi/content/full/M802647200/DC1 Supplemental Material can be found at:
- 183. histone deacetylases (HDACs)and might actively suppress expression of its targets by inducing a locally repressive chro- matin structure (20, 24, 25). It is known that histone deacetyla- tion contributes to H3K9 methylation on these same promoters (22). It has been shown that some MyoD target promoters, including p21 and myogenin, are methylated at H3K9 specifi- cally in proliferating myoblasts (20, 22), a modification known to be bound by HP1 proteins. Here we show that HP1 proteins associate directly with MyoD in an isoform-dependent manner and inhibit its tran- scriptional activity. Indeed, MyoD interacts preferentially with the isoforms HP1␣ and HP1, but not HP1␥. In addition, HP1 proteins are recruited to MyoD target promoters preferentially in proliferating myoblasts. Finally, overexpression of HP1 iso- forms interferes with muscle terminal differentiation in an isoform-dependent manner. Taken together, these data strongly suggest that, in addition to its role as an activator of differentiation-specific genes, MyoD can also act as a transcrip- tional repressor in proliferating myoblasts in cooperation with specific isoforms of HP1 protein. EXPERIMENTAL PROCEDURES Cell Culture and Transfection—C2C12, HEK 293, and HeLa cells were maintained using standard conditions. C2C12 cells were differentiated as described in Ref. 16. The biotin-streptavidin interaction studies were performed as described in Ref. 26. Stable Cell Lines Establishment—A HeLa cell line stably expressing MyoD was established with a transgene encoding for full-length MyoD, and C2C12 cell lines expressing HP1 iso- forms were established with transgenes encoding for full-length HP1␣, HP1, and HP1␥ as described in Ref. 27. The transgenes were tagged with double hemagglutinin (HA) and double FLAG epitopes at the N terminus as described in Ref. 27. HeLa and C2C12 control cell lines transduced with the empty vector were also established. Protein Complex Purification—MyoD complex characteriza- tion was performed as described in Ref. 27. Protein Extraction, Coimmunoprecipitations, and Western Blotting—The biotin-streptavidin interaction studies were per- formed as described in Ref. 26. Expression vectors for biotiny- latable proteins are kind gifts from Dr. V. Ogryzko (26). For the study of the endogenous protein interactions, nuclear extracts were used for immunoprecipitation overnight, after which the immunoprecipitates were incubated with Ultralink immobilized protein A/G (Pierce) for 2 h at room temperature and washed with the dilution buffer 4–10 times. Plasmids, GST Fusions, and GST Pulldown—Expression vec- tors derived from pGEX for GST fusions of wild type HP1␣, , ␥, and HP1␣ deletion mutants GST-HP1␣(1–119), GST- HP1␣(1–66), and GST-HP1␣(67–119) were described in Ref. 28. All of the plasmid constructs were expressed in Escherichia coli strain BL21 and purified using glutathione-Sepharose beads according to the manufacturer (Sigma). Purified proteins were quantified by Coomassie staining after SDS-PAGE sepa- ration and by the Bradford protein assay. BL21 cells were also used for bacterial expression of untagged MyoD as described in Ref. 29. Beads coated with equal amounts of GST fusion proteins (1 g) were incubated with 100 ng of recombinant MyoD in NTEN buffer (100 mM NaCl, 20 Mm Tris-HCl, pH 8, 0.5 mM EDTA, 0.1% Nonidet P-40) completed with protease inhibitors (Roche Applied Science) for 4 h at 30 °C. The beads were then washed four times with washing buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% Nonidet P-40, 1 mM phenylmethylsul- fonyl fluoride) and resuspended, and the proteins were resolved by SDS-PAGE gel for Western blot analysis. For this GST pulldown assays using MyoD deletion mutants, HEK 293 cells were transfected with 10 g of expression plas- mids of tagged MyoD (wild type MyoD) or its deletion mutants (Cter, Nter, ⌬Cter, and ⌬Nter), using Lipofectamine (Qiagen). 48 h post-transfection, the cells were lysed in lysis buffer (300 mM NaCl, 50 mM Tris-HCl, pH 7.5, 0,4% Nonidet P-40, 10 mM MgCl2) to extract MyoD or its deletion mutants. GST pulldown assays were then performed as described above. Gene Reporter Assays—HEK 293 cells at 60% confluence were cotransfected by calcium phosphate coprecipitation. 24 h post- transfection, the cells were lysed in a reporter lysis buffer (Pro- mega, Charbonnie`res, France). Luciferase activity (Promega lucif- erase assay system) was determined and normalized to the level of -galactosidase (Promega -galactosidase enzyme assay system) and to the total protein amount. The plasmids used in the assay were pEMSV-MyoD, pEMSV, pcDNA3-HP1␣, pcDNA3-HP1, pcDNA3-HP1␥, pcDNA3, pMCK-Luciferase reporter gene, and pCMV--galactosidase. Antibodies—The C-20 anti-MyoD, M-225 anti-myogenin, normal rabbit IgG, and normal mouse IgG antibodies were pur- chased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti- HP1 antibodies (2HP2G9, 1MOD1A9AS, and 2MOD1GC) were obtained from Euromedex (Souffelweyersheim, France). Rabbit polyclonal anti-Suv39h1 (suppressor of variegation 39h1) antibody (catalog number 07-550) was obtained from Upstate Biotechnology, Inc.. Rabbit polyclonal anti-MCK anti- body was developed by Dr. H. Ito (30). The horseradish perox- idase-streptavidin conjugate (Sigma; catalog number S 2438), anti-FLAG and anti-␣-tubulin antibodies were purchased from Sigma. Rat anti-HA antibody was purchased from Roche Applied Science. Chromatin Immunoprecipitation (ChIP)—ChIP protocol and primers have been described in Ref. 26. RESULTS HP1 Proteins Interact with MyoD—To exhaustively charac- terize MyoD protein partners, we first purified MyoD complex from a HeLa cell line ectopically expressing a double tagged form of MyoD. To this end, we performed double affinity puri- fication of the HA-FLAG-MyoD complex (Fig. 1A) from chro- matin enriched in mononucleosomes (as described in Ref. 27). Mass spectrometry analysis of MyoD complex confirmed some “historical” partners of MyoD such as Id, E12/E47, and MEIS1, and other partners that have never been described to interact with MyoD, among them HP1 proteins, as confirmed by West- ern blotting (Fig. 1B). Thus, MyoD can coexist with HP1 pro- teins in the same complex, at least in an artificial cell system. To further characterize these interactions, we used HEK 293 human cells to express biotinylatable forms of either MyoD or HP1 and Terminal Differentiation AUGUST 29, 2008•VOLUME 283•NUMBER 35 JOURNAL OF BIOLOGICAL CHEMISTRY 23693 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 184. HP1 proteins ␣,, or ␥ (as described in Ref. 26). The system is based on the coexpression of the target protein fused to a short biotin acceptor domain together with the biotinylating enzyme BirA from E. coli. The strength of the biotin-streptavidin inter- action allows a robust characterization of protein-protein interactions, even in stringent conditions. Using biotinylated HP1 proteins, detected with streptavidin-horseradish peroxi- dase (Fig. 1C, bottom panel), we could precipitate MyoD with HP1␣ and HP1 but not with HP1␥ (Fig. 1C, lanes 1–3). The signal is specific for HP1␣ and ; we did not detect MyoD in the HP1␥ precipitate, nor in the control cells, which do not express any biotinylatable protein (Fig. 1C, lanes 1 and 4, respectively), nor in the cells that express biotinylated HP1 proteins but not MyoD (Fig. 1C, lanes 5–7). The level of ectopic MyoD was nor- malized by Western blotting, and that of biotinylated HP1 pro- teins was normalized by streptavidin-horseradish peroxidase (Fig. 1C, bottom panel). The reverse experiment using biotiny- lated MyoD and FLAG-tagged HP1 proteins (Fig. 1D, top panel) led to the same conclusion: a preferential interaction of MyoD with HP1␣ and HP1, but not with HP1␥. The precipitation of biotinylated MyoD by streptavidin beads coprecipitated HP1␣ and HP1 but never HP1␥ (Fig. 1D, lanes 4–6). The coprecipi- tation of HP1␣ and HP1 with biotinylated MyoD was specific, because there was no signal in cells not transfected with the bio- tinylated MyoD expressing vector (Fig. 1D, lanes 1–3). The absence of an interaction between MyoD and HP1␥ is not due to a low expression of this isoform, because this is shown in the bottom panel of Fig. 1D (normalization of the inputs). Taken together, these results confirm, in cells, the specific interaction of MyoD with HP1␣ and HP1, but not HP1␥. MyoD Interacts with HP1␣ and HP1, but Not with HP1␥, in Proliferating Myoblasts—To confirm the interaction between MyoD and HP1 proteins in a more physiological context, we used C2C12 myoblasts. In this system, MyoD is expressed at a low level in proliferating myoblasts, and its expression increases upon initiation of terminal differentiation. Immunoprecipita- tion (IP) experiments were performed using isoform-specific anti-HP1 or anti-MyoD antibodies or an anti-Suv39h1 anti- body as a positive control, because this H3K9 methylase is known to interact with HP1. Indeed, Suv39h1 coprecipitated the three isoforms of HP1 as expected (Fig. 2A). Endogenous MyoD specifically coprecipitated endogenous HP1␣ and HP1, but not HP1␥ (Fig. 2A), and the IgG control did not show any HP1 signal (Fig. 2A). The results of the reciprocal IP confirmed these conclusions: IP of HP1␣ or HP1, but not HP1␥, copre- cipitated MyoD (Fig. 2B), and the control IP did not give any detectable signal (Fig. 2B). The absence of the interaction between MyoD and HP1␥ is not due to a low expression of the latter, because this isoform is highly detected by Western blot- ting. Taken together, these results show that MyoD interacts preferentially with the ␣ and  isoforms of HP1, but not with the ␥ isoform, in myoblasts. MyoD + ++ - - - IP:bHP1 IB: α-MyoD ΙΒ: MyoD Str-HPO A HP1α HP1β HP1α HP1β HP1γ MyoD + ++- - - HP1α HP1β HP1γ HP1α HP1β HP1γ + + * * bMyoD IP:bMyoD IB: Flag ΙΒ: Flag - 1 2 3 4 5 6 7 1 2 3 4 5 6 7 - HP1γ C Flag HP1α MyoD Mock HP1β HP1γ MW(KDa) MyoDCom. 14 21 31 36 55 66 97 116 B D MyoD FIGURE 1. Ectopically expressed MyoD interacts with endogenous HP1 proteins. A, silver staining the double affinity-purified MyoD complex iso- lated from chromatin fractions in a HeLa cell line stably expressing FLAG-HA tagged MyoD. MW, protein molecular weight marker. The molecular masses of the markers are indicated. B, Western blot analysis of double purified FLAG- HA-MyoD (MyoD) or eluate from HeLa control cells (Mock). C, top panel, West- ern blotting with anti-MyoD on streptavidin-bead precipitates from HEK 293 cell extracts transfected with a MyoD expression vector (lanes 1–4) or with an empty vector (lanes 5–7), along with expression vectors for the biotinylated forms of HP1␣ (bHP1␣) (lanes 3 and 7), HP1 (lanes 2 and 6), HP1␥ (lanes 1 and 5), or the empty vector (lane 4). Middle and bottom panels, quantity control of MyoD detected with an anti-MyoD antibody (middle panel) and biotinylated HP1 detected using streptavidin-horseradish peroxidase conjugate (bottom panel) in the inputs. D, top panel, Western blotting of anti-FLAG-HP1 of streptavidin bead precipitates from HEK 293 cell extracts transfected with the expression vector for FLAG-HP1␣ (lanes 1 and 4), FLAG-HP1 (lanes 2 and 5), HP1␥ (lanes 3 and 6), or with the empty vector (lane 7), along with expression vectors for the biotinylated form of MyoD (lanes 4–7) or the empty vector (lanes 1–3). Middle and bottom panels, quantity control of biotinylated MyoD (bMyoD)detectedusingstreptavidin-horseradishperoxidaseconjugate(mid- dle panel) and that of FLAG-HP1 protein in the inputs as detected with an anti-FLAG antibody (bottom panel). *, endogenous biotinylated proteins. IB, immunoblot. HP1 and Terminal Differentiation 23694 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 185. MyoD Interacts Directlywith HP1␣ and HP1 in Vitro—We studied the possible direct interaction between MyoD and HP1 proteins. GST-HP1 fusion proteins produced in bacteria were immobilized on agarose-glutathione beads, and an untagged recombinant form of MyoD (purification protocol described in Ref. 29) was detected by Western blotting using an anti-MyoD antibody. GST pulldown experiments showed that MyoD inter- acts with HP1␣ and HP1 but not with HP1␥ (Fig. 3A, lanes 1–3). The interaction of MyoD with HP1␣ and HP1 was spe- cific; we did not detect any MyoD signal in the presence of GST protein alone (Fig. 3A, lane 4). The quantity of each GST-HP1 protein was checked by Western blotting using an anti-GST antibody (Fig. 3A, lower panel). The interaction of HP1 proteins with MyoD was specific and was not seen with myogenin, another myogenic basic helix loop helix factor (Fig. 3B). These results show that, very interestingly, MyoD, but not myogenin, interacts specifically and directly with the isoforms ␣ and  of HP1. The Chromoshadow Domain of HP1␣ and the C-terminal Domain of MyoD Are Required for Their Interaction—In an attempt to delimit the domain of HP1 responsible for interac- tion with MyoD, we used deletion mutants of HP1␣ fused to GST. A GST pulldown experiment was performed using bacte- rially produced MyoD as described above. GST pulldown revealed an interaction of MyoD with the wild type HP1␣ as expected (Fig. 3C, lane 1) and with a HP1␣ 119–189 mutant, which retains the CSD (Fig. 3C, lane 2). MyoD failed to interact with truncated HP1␣ versions lacking the CSD, i.e. mutants 1–119, 67–119, and 1–67 (Fig. 3C, lanes 3–5). The amounts of the different GST-HP1␣ mutants were checked by Western blotting (Fig. 3C, bottom panel). These experiments clearly show that the CSD of HP1␣ is required for interaction with MyoD. The same experiments were performed using tagged deletion mutants of MyoD ectopically expressed in HEK 293 cells. The results show that the C-terminal domain of MyoD is required for the interaction with HP1 (Fig. 3, D and E). HP1 Represses MyoD Transcriptional Activity—To inves- tigate the effects of HP1 proteins on MyoD transcriptional activity, we used a Luciferase reporter gene under the con- trol of the muscle creatine kinase (MCK) promoter, which is a direct target promoter of MyoD. Cotransfection experi- ments were performed in different nonmuscle cells lines that do not express MyoD endogenously. We observed that the cotransfection of either HP1␣- or HP1-expressing plasmid together with MyoD expression vector resulted in the inhi- bition of MCK promoter activity in a dose-dependent man- ner (Fig. 4, A and B, black bars). Interestingly, cotransfection of a HP1␥ expression vector had no effect on the activity of MyoD (Fig. 4C, black bars). The expression of transfected MyoD was not influenced by cotransfection with HP1 expression vectors as determined by Western blotting (data not shown). The inhibitory effect of HP1␣ and HP1 is spe- cific and is MyoD-dependent. Indeed, it was not seen with -galactosidase expression under a cytomegalovirus pro- moter (used as a normalization control for transfection effi- ciency) nor with a pMCK-luciferase vector in the absence of MyoD (Fig. 4, gray bars). Thus, HP1␣ and HP1, but not HP1␥, directly inhibit MyoD activity. HP1 Protein Isoforms Are Preferentially Recruited to MyoD Target Genes in Proliferating Myoblasts—To test the recruit- ment of HP1 isoforms into MyoD target promoters, we per- formed ChIP experiments using specific antibodies to each HP1 isoform. Our results show a preferential enrichment in all the three HP1 isoforms on both p21 and MCK promoters, which are MyoD targets activated early and late in differen- tiating cells, respectively, in proliferating myoblasts com- pared with differentiating myotubes (Fig. 5). Thus, even HP1␥, which does not interact directly with MyoD, is recruited on MyoD target promoters, suggesting that HP1␥ may regulate myogenesis independently of any interaction with MyoD (see below). These results suggest that all the three HP1 isoforms regulate MyoD target genes in prolifer- ating myoblasts using different mechanisms. Note that HP1 proteins are not found on coding regions of MyoD target genes (data not shown). HP1 Levels Are Crucial for Muscle Terminal Differentiation— To test more generally the role of HP1 proteins in muscle terminal differentiation, we employed gain-of-function strategy. To ectopically express HP1 protein isoforms, we used a retrovirus expressing HA and FLAG-tagged isoforms of HP1 or an empty vector as a negative control to transduce C2C12 cells (see “Experimental Procedures”). Immunofluo- rescence studies using anti-HA antibody showed that the exogenous HP1 isoforms had normal subnuclear localization IgG MyoD Suv39h1 MyoD IB: Suv39h1 HP1α IP antibody HP1γ HP1β A B IB: MyoD lnput IgG IgG IP antibody IgG HP1γ HP1β HP1α IB:HP1γ IB:HP1β IB:HP1α 1 32 4 5 6 7 GM FIGURE 2. HP1␣ and HP1, but not HP1␥, coprecipitate with MyoD in myoblasts. Nuclear extracts from growing myoblasts were used for immu- noprecipitation with antibodies raised against MyoD, Suv39h1, or control beads (A) or against HP1␣, HP1, HP1␥, or normal mouse IgG as a negative control (B). The resulting precipitates were then subjected to Western blot- ting (immunoblot, IB) analysis for the presence of Suv39h1, MyoD, HP1␣, HP1, and HP1␥ as indicated in A and B. Total input lysate was loaded in B to showthatHP1␥ispresentintheinputs,evenifitisnotpresentintheIP. Lower panel of B, the faint signal obtained with anti-HP1 Western blotting in the control IgG IP corresponds to IgG light chain (noise). HP1 and Terminal Differentiation AUGUST 29, 2008•VOLUME 283•NUMBER 35 JOURNAL OF BIOLOGICAL CHEMISTRY 23695 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 186. (Fig. 6A). Overexpressionof any of the HP1 isoforms, ␣, , or ␥, resulted generally in the inhibition of differentiation com- pared with the control cell line. HP1-overexpressing cells did not express the differentiation markers myogenin and MCK (Fig. 6B) and did not fuse into myotubes (data not shown). The faint expression of MCK and myogenin in HP1␣-ex- pressing cells cultured in differentiation medium was due to the fact that this cell line was not pure for the expression of tagged HP1␣, ϳ90%; during cul- ture, some cells lost tagged HP1␣ expression. We presume that these cells differentiated normally and expressed myogenin and MCK. Overexpression of HP1 proteins could have broad effects (31). Thus, differentiation inhibition we have seen in cells overexpressing HP1 proteins could be a result of these broad effects. To check the specific- ity of the effects seen when we over- express HP1 isoforms (Fig. 6, A and B), we performed ChIP experiments using anti-FLAG resin to test whether the tagged HP1 isoforms are recruited to MyoD target genes. Our results show that the exoge- nous HP1 isoforms are indeed phys- ically recruited into MyoD target genes (Fig. 6C), but unlike the endogenous HP1 (Fig. 5), these exogenous isoforms remain on MyoD target promoters even in myoblasts cultured in differentia- tion conditions (Fig. 6C). This result suggests that the differentiation defect seen in HP1-overexpressing myoblasts could be due, at least in part, to a lack of de-repression of MyoD target genes. Taken together, these results suggest that overex- pression of HP1 proteins impairs MyoD target genes expression and thus muscle terminal differentia- tion, regardless of the HP1 isoform. DISCUSSION Repression of MyoD target genes in proliferating myoblasts involves H3K9 methylation (20, 22), which is normally recognized by HP1 pro- teins (4, 5). This suggests the forma- tion of local facultative heterochro- matin on MyoD target promoters, insuring their stable repression until the cells undergo terminal dif- ferentiation. We tested the hypoth- esis that HP1 proteins are involved in the repression of MyoD target genes and explored their role in muscle terminal differentiation in general. Physical and Functional MyoD/HP1 Interaction—Immuno- precipitation assays showed that MyoD interacts with HP1␣ and HP1, but not with HP1␥ in myoblasts. In vitro assays dem- onstrated that MyoD interacts directly with HP1␣ and HP1 via their chromoshadow domains and the MyoD transactivat- ing domain. A reporter gene assay indicated that this interac- A IB:MyoD IB:GST GST-HP1α GST-HP1β GST-HP1γ GST 1 32 4 WT 119-189 1-119 67-119 1-67 C IB:MyoD IB:GST CD CSD 1 67 119 189 HP1α 1 32 4 5 GST-HP1α: MyoDWT MyoDWT Cteraa173-318 Nteraa1-114 ∆Cteraa1-241 ∆Nteraa83-318 GST-HP1βGST Emptyvector α-Flag α-GST GST-HP1β GST α-HA D 1 31899 167 CterNter bHLH TAD Dimerization DNA binding TAD MyoD GST GST-HP1α GST-HP1β GST-HP1γ GST GST-HP1α GST-HP1γ input input GST-HP1α GST-HP1γ GST-HP1β GST-HP1α GST-HP1γ + --- --+ + + +++ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 MyoDMyogenin MyoDMyogenin B MyoDWT Cteraa173-318 Nteraa1-114 ∆Cteraa1-241 ∆Nteraa83-318 Emptyvector E * * * * * 35,1 47,4 24,9 24,9 35,1 47,4 35,1 47,4 60,4 24,9 MW KDa MW KDa MW KDa y MW KDa 35,1 * * * * * 47,4 35,1 24,9 47,4 60,4 24,9 35,1 47,4 24,9 47,4 60,4 FIGURE 3. HP1␣ and HP1, but not HP1␥, interact directly with MyoD in vitro via their chro- moshadow domain and MyoD transactivating domain. A, HP1␣ and HP1 interact directly with MyoD in a GST pulldown assay. Equivalent amounts of bacterially produced untagged MyoD were incubated with GST beads (lane 4) or GST-HP1 beads (lanes 1–3). MyoD was detected by Western blotting using an anti-MyoD antibody (upper panel), and GST fusions using an anti-GST antibody (lower panel). IB, immuno- blot. B, unlike MyoD, myogenin does not interact with HP1 proteins. Myogenin and MyoD were in vitro translated in the presence of radioactive [35 S] methionine (inputs on lanes 1 and 14, respectively). MyoD or myogenin were incubated with equivalent amounts of either GST or GST-HP1 proteins, as indicated. GST pulldown was then conducted as described under “Experimental Procedures,” except that at the end of the experiment, the radiolabeled proteins were detected by autoradiography. Lanes 1–8, GST pulldown experiment with [35 S]myogenin; lanes 9–14, with [35 S]MyoD. C, the chromoshadow domain of HP1␣ is required for interaction with MyoD. Equivalent amounts of bacterially produced MyoD were incubated with GST-HP1␣ deletion mutants on beads (lanes 2–5) or GST-HP1␣ wild type (lane 1). MyoD was detected by Western blotting using an anti-MyoD antibody (upper panel) and GST fusions using an anti-GST anti- body (lower panel). D, HP1 interacts with MyoD wild type and with MyoD deletion mutants containing the C-terminal domain. Top panel, schematic diagram of MyoD functional domains . TAD, transactivation domain. Lower panels, wild type MyoD was detected using anti-FLAG antibody, and its deletion mutants were detected using anti-HA antibody (upper panels). GST and GST-HP1 were detected using anti-GST antibody (lower panel). E, Western blotting using anti-FLAG and anti-HA to verify the expression level of MyoD and its deletion mutants in HeLa cells used in D* , specific bands. HP1 and Terminal Differentiation 23696 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 187. tion contributes toMyoD-mediated transcriptional repression. Our results provide evidence for a physical interaction between MyoD and HP1␣/ and suggest a direct role for these two HP1 isoforms in regulating the repressive function of MyoD. A sim- ilar result has been described for HP1␣ and muscle enhancer factor 2C, which belongs to the muscle enhancer factor 2 family of myogenic transcription factors (22). HP1␣ has also been shown to interact and cooperate with two critical hematopoi- etic transcription factors, PU.1/GATA-1 (32) and the differen- tiation factor C/EBP␣ (33). In the case of MyoD, it has been shown to bind target promoters in proliferating myoblasts, where it acts as a repressor (20). This repression involves HDACs, among other factors (25). MyoD binds HDAC1 via its helix-loop-helix domain (25) and HP1 via its C-terminal domain, which contains a pseudo-PXVXL motif (PALLL) at position 266, found in many HP1-interacting proteins (34). Such a motif is not found in myogenin, which does not interact with any of the HP1 isoforms. Thus, MyoD could form a ternary complex with HDAC1 and HP1. MyoD could thus serve as a bridge between nucleosomes and chromatin-binding proteins. The first enzymes to be recruited by MyoD could be HDACs that deacetylate H3K9 to allow its subsequent methylation by a histone methyltransferase (20, 22). Methylated H3K9 could then be recognized and stabilized by HP1 proteins. Thus, there would be a complex composed of MyoD-HDAC-histone meth- yltransferase-HP1, which ensures the stable silencing of MyoD target genes by preventing H3K9 acetylation before the initia- tion of differentiation, as previously suggested in: (22). In con- clusion, the equilibrium between H3K9 acetylation and meth- A B C Relativeluciferase/βgalactivityRelativeluciferase/βgalactivity 10 20 30 40 50 60 70 80 90 HP1α 10 20 30 40 50 60 70 80 90 HP1β HP1γ Relativeluciferase/βgalactivity 10 20 30 40 50 60 pEMSV-MyoD pEMSV FIGURE 4. HP1␣ and HP1, but not HP1␥, repress MyoD-mediated tran- scription. Cotransfection into HEK 293 cells of an MCK promoter-driven lucif- erase reporter plasmid with a fixed amount of MyoD expression vector (800 ng),andincreasingamountsofpcDNA3vectorexpressingHP1␣(A),HP1(B), or HP1␥ (C). The quantities of different pcDNA3-HP1 expression vectors used were: 0, 100, 200, 300, and 500 ng. The total amount of pcDNA3 was normal- ized when necessary to 500 ng. Expression of MyoD and different HP1s was analyzed by Western blotting (data not shown). The inhibitory effect of HP1␣ and HP1 was specific and MyoD-dependent (compare black bars to gray bars). Indeed, it was not seen with -galactosidase expression under a cyto- megalovirus promoter (used as a normalization control for the transfection), nor with the MCK-luciferase vector in the absence of MyoD (gray bars). Black bars correspond to transfections with pEMSV-MyoD vector, and gray bars correspond to the empty vector control pEMSV. MCK promoter Proliferation Differentiation HP1α HP1β HP1γChIP Ab Relativeassociation 0,2 0,4 0,6 0,8 1 p21 promoter Relativeassociation HP1α HP1β HP1γChIP Ab 0,2 0,4 0,6 0,8 1 Proliferation Differentiation FIGURE 5. Preferential recruitment of HP1 on MyoD target promoters in proliferating myoblasts. Chromatin fractions from either proliferating C2C12 myoblasts (black bars) or cultured 48 h in differentiating medium (gray bars) were immunoprecipitated using anti-HP1 antibodies (HP1) and ana- lyzed by quantitative PCR. We quantified copy numbers of the p21 and MCK promoters regions harboring the MyoD-binding site. gapdh and 36B4 genes were used as negative controls to normalize our ChIP results. The results are the means of two independent experiments and six PCR measurements. HP1 and Terminal Differentiation AUGUST 29, 2008•VOLUME 283•NUMBER 35 JOURNAL OF BIOLOGICAL CHEMISTRY 23697 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 188. ylation at MyoDtarget promoters may represent a switch that determines the timing of differentiation. Specificity of the Interaction of MyoD with HP1␣ and HP1— We report differential associations of HP1␣/ with MyoD, whereas HP1␥ does not associate with MyoD, at least in our hands. The only system in which HP1␥ was found in association with MyoD was in HeLa cells. Because this interaction was not found in myoblasts, it could be due to the large amount of HeLa cells we used to purify MyoD complex. We concluded that MyoD does not directly interact with HP1␥. HP1 proteins share extensive structural identity and several char- acteristics (35–40). Despite these structural and biochemical similari- ties, HP1 proteins differ in some properties. For example, they differ in their subnuclear distribution (28, 41, 42). In addition, HP1␥ is the only isoform that has been linked to tran- scription activation (43). Finally, among the HP1 binding proteins, several have been reported to inter- act with all HP1 isoforms, such as SP100; in contrast, TAFII130 binds to HP1␣ and HP1␥, but not to HP1 (41), and BRG1 binds only to HP1␣ (28). Thus, the absence of interac- tion between MyoD and HP1␥ could be due to structural and sub- nuclear localization differences compared with the two other HP1 isoforms. Together, these results strongly support the notion that HP1 proteins form distinct com- plexes in cells (28, 44) and suggests both shared and distinctive roles for these proteins in muscle development. HP1 Level Is Crucial for Skeletal MyoD Target Genes Expression and Muscle Terminal Differentiation—It was shown that HP1 isoform expression levels do not change dur- ing muscle differentiation (45), and our results show that HP1 isoform levels do not significantly change in regenerating muscle, with only a slight increase in HP1␣ and HP1␥ levels (not shown). As observed with overexpression of Suv39h1 (Refs. 42 and 46) and unpublished results), overexpression of any of the three HP1 isoforms resulted in the loss of differentiation capacity. Our re- sults show that exogenous HP1 isoforms remain on MyoD target promoters even in differentiation conditions. Thus, overexpression of HP1 or Suv39h1 could preclude de-repression of MyoD tar- get genes, thus inhibiting terminal differentiation. However, down-regulation of HP1 isoforms with small inter- fering RNAs resulted in a generally poor differentiation effi- ciency (supplemental data). This result was unexpected, because we have shown that HP1␣ and HP1 are involved in the regulation of MyoD activity. This apparent contradiction could be explained several ways. First of all, down-regulation of only one HP1 isoform might not be sufficient to activate MyoD target genes. One can also hypothesize that H3K9 remains A HP1α HP1β HP1γ α-Tubulin end. ex. end. ex. end. ex. Proliferation Differentiation ib: Myogenin39 28 MW 28 28 28 51 C2C12: * HP1α HP1β HP1γ ctrl MCK51 DAPI HA HP1α HP1β HP1γ ctrl HP1α HP1β HP1γ ctrl B ItgA7 5 10 15 20 25 30 35 40 HP1α HP1β HP1γ HP1α HP1β HP1γ Relativeenrichment p21 ChIP Flag: 10 20 30 40 50 60 70 80 ctrl ctrl MCK Relativeenrichment HP1α HP1β HP1γChIP Flag: ctrl Relativeenrichment Proliferation Differentiation C 2 4 6 8 10 ChIP Flag: FIGURE 6. Modulating the levels of HP1 isoforms affects muscle terminal differentiation. A and B, C2C12 cells stably expressing HA-FLAG tagged HP1 isoforms as indicated or control cells (ctrl) were cultured under proliferation conditions or in differentiation medium. Proliferating cells were tested by immunofluorescence using anti-HA antibody (Roche Applied Science) and 4Ј,6Ј-diamino-2-phenylindole (DAPI) to stain DNA (A) or analyzed by Western blotting with isoform-specific anti-HP1, anti-myogenin, anti-MCK, and anti-␣-tubulin as a loading control (B). Note that the kinetic studies were carried out in the same 10-cm-diameter cell culture dish for each sample. C, FLAG-HA tagged HP1 isoforms are recruited to MyoD target promoters regardless of differentiation. ChIP experiments using anti-FLAG resin were performed from myoblasts stably expressing the tagged HP1 isoforms (or from the control cell line, ctrl) either proliferating (black bars) or cultured in differen- tiation conditions (gray bars). We quantified copy numbers of the MCK, ItgA7, and p21 promoter regions harboring the MyoD target sequence. The 36B4 gene was used as a negative control. The results are the means of three independent experiments. HP1 and Terminal Differentiation 23698 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 189. methylated in theabsence of one HP1 isoform and could be sufficient per se to silence transcription as described by others (47). In addition, other repressor proteins, like the histone H3 lysine 27 methylase EZH2 (48) and HDAC1 (25), are recruited to silent MyoD target genes in myoblasts, and this could be sufficient to inhibit gene expression per se in the absence of HP1. Secondly, down-regulation of one HP1 isoform may be sufficient to interfere with (or inhibit) general chromatin reor- ganization, which occurs in differentiating myoblasts (11, 12, 14), thereby inhibiting terminal differentiation. More likely, HP1 proteins are required to silence proliferation-associated genes in differentiating cells, a step that is obligatory to initiate terminal differentiation (see supplemental data). Indeed, we previously found comparable results with Suv39h1, a H3K9 his- tone methyltransferase, which is involved in muscle terminal differentiation by silencing proliferation genes, i.e. E2F target genes (16). It has also been shown that HP1 proteins associate with proliferation genes only in differentiated cells, where these genes are irreversibly silenced (Ref. 7) and unpublished results) and upon triggering irreversible cell cycle exit in senescent cells (17). Thus, when we down-regulate HP1 protein expression in myoblasts and try to induce differentiation, E2F target genes are not correctly silenced in the absence of HP1, cells do not undergo irreversible cell cycle exit, and differentiation cannot start (supplemental data). We have observed a similar pheno- type when we down-regulate the Suv39h1 expression in myo- blasts (Ref. 16 and unpublished results). Concerning HP1␥, ChIP experiments showed its preferential enrichment on MyoD target genes in proliferating myoblasts. Although we observed that HP1␥ does not interact directly with MyoD, its overexpression interferes with muscle terminal differentiation. Thus, HP1␥ might regulate myogenesis inde- pendently of any direct interaction with MyoD. Because it is known that HP1 proteins heterodimerize, HP1␥ could be recruited by HP1␣/. In addition, HP1␥ might be necessary for the general nuclear reorganization occurring in differentiating myoblasts. Indeed, mutation in the Su(var)205 gene, which encodes HP1, in Drosophila melanogaster causes lethality at larval stages (49), suggesting a general role of HP1 as a non- histone chromatin protein. However, to our knowledge, no HP1 knock-out mice have been described to date. In conclusion, our results provide additional evidence that members of the HP1 protein family are functionally distinct and point to a novel role for MyoD in the organization of het- erochromatin-like local structures on its targets in proliferating myoblasts. These data strongly suggest that, in addition to the role of MyoD as an activator of differentiation-specific genes, it can also act as an active transcriptional repressor in proliferat- ing myoblasts, in cooperation with specific isoforms of HP1 proteins. Acknowledgments—We warmly thank Dr. S. A. Leibovitch for provid- ing MyoD expressing vectors, Dr. H. Ito for the kind gift of anti-MCK antibody, Drs. D. Trouche and A. Hamiche for providing crucial reagents, and Drs. V. Ogryzko and A. Viens for sharing plasmids and technical help. We thank Dr. L. L. Pritchard and A. Marchand for critical reading of the manuscript. REFERENCES 1. Hediger, F., and Gasser, S. M. (2006) Curr. Opin. Genet. Dev. 16, 143–150 2. Cavalli, G., and Paro, R. (1998) Curr. Opin. Cell Biol. 10, 354–360 3. Dialynas, G. K., Terjung, S., Brown, J. P., Aucott, R. L., Baron-Luhr, B., Singh, P. B., and Georgatos, S. D. (2007) J. Cell Sci. 120, 3415–3424 4. Lachner, M., O’Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001) Nature 410, 116–120 5. Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O., Allshire, R. C., and Kouzarides, T. (2001) Nature 410, 120–124 6. Lomberk, G., Wallrath, L., and Urrutia, R. (2006) Genome Biol. 7, 228–235 7. Panteleeva, I., Boutillier, S., See, V., Spiller, D. G., Rouaux, C., Almouzni, G., Bailly, D., Maison, C., Lai, H. C., Loeffler, J. P., and Boutillier, A. L. (2007) EMBO J. 26, 3616–3628 8. Meshorer, E., Yellajoshula, D., George, E., Scambler, P. J., Brown, D. T., and Misteli, T. (2006) Dev. Cell 10, 105–116 9. Cammas, F., Herzog, M., Lerouge, T., Chambon, P., and Losson, R. (2004) Genes Dev. 18, 2147–2160 10. Cammas, F., Oulad-Abdelghani, M., Vonesch, J. L., Huss-Garcia, Y., Chambon, P., and Losson, R. (2002) J. Cell Sci. 115, 3439–3448 11. Francastel, C., Schubeler, D., Martin, D. I., and Groudine, M. (2000) Nat. Rev. Mol. Cell Biol. 1, 137–143 12. Meshorer, E., and Misteli, T. (2006) Nat. Rev. Mol. Cell Biol. 7, 540–546 13. Guasconi, V., Souidi, M., and Ait-Si-Ali, S. (2005) Cancer Biol. Ther. 4, 134–138 14. Moen, P. T., Jr., Johnson, C. V., Byron, M., Shopland, L. S., de la Serna, I. L., Imbalzano, A. N., and Lawrence, J. B. (2004) Mol. Biol. Cell 15, 197–206 15. Brero, A., Easwaran, H. P., Nowak, D., Grunewald, I., Cremer, T., Leon- hardt, H., and Cardoso, M. C. (2005) J. Cell Biol. 169, 733–743 16. Ait-Si-Ali, S., Guasconi, V., Fritsch, L., Yahi, H., Sekhri, R., Naguibneva, I., Robin, P., Cabon, F., Polesskaya, A., and Harel-Bellan, A. (2004) EMBO J. 23, 605–615 17. Narita, M., Nunez, S., Heard, E., Narita, M., Lin, A. W., Hearn, S. A., Spector, D. L., Hannon, G. J., and Lowe, S. W. (2003) Cell 113, 703–716 18. Buckingham, M. (1996) Biochem. Soc. Trans. 24, 506–509 19. Walsh, K., and Perlman, H. (1997) Curr. Opin. Genet. Dev. 7, 597–602 20. Mal, A., and Harter, M. L. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 1735–1739 21. Ohkawa, Y., Marfella, C. G., and Imbalzano, A. N. (2006) EMBO J. 25, 490–501 22. Zhang, C. L., McKinsey, T. A., and Olson, E. N. (2002) Mol. Cell Biol. 22, 7302–7312 23. de la Serna, I. L., Carlson, K. A., and Imbalzano, A. N. (2001) Nat. Genet. 27, 187–190 24. Fulco, M., Schiltz, R. L., Iezzi, S., King, M. T., Zhao, P., Kashiwaya, Y., Hoffman, E., Veech, R. L., and Sartorelli, V. (2003) Mol. Cell 12, 51–62 25. Mal, A., Sturniolo, M., Schiltz, R. L., Ghosh, M. K., and Harter, M. L. (2001) EMBO J. 20, 1739–1753 26. Viens, A., Mechold, U., Lehrmann, H., Harel-Bellan, A., and Ogryzko, V. (2004) Anal. Biochem. 325, 68–76 27. Robin, P., Fritsch, L., Philipot, O., Svinarchuk, F., and Ait-Si-Ali, S. (2007) Genome Biol. 8, R270 28. Nielsen, A. L., Sanchez, C., Ichinose, H., Cervino, M., Lerouge, T., Cham- bon, P., and Losson, R. (2002) EMBO J. 21, 5797–5806 29. Polesskaya, A., Duquet, A., Naguibneva, I., Weise, C., Vervisch, A., Bengal, E., Hucho, F., Robin, P., and Harel-Bellan, A. (2000) J. Biol. Chem. 275, 34359–34364 30. Ito, H., Kamei, K., Iwamoto, I., Inaguma, Y., and Kato, K. (2001) Exp. Cell Res. 266, 213–221 31. Sharma, G. G., Hwang, K. K., Pandita, R. K., Gupta, A., Dhar, S., Parenteau, J., Agarwal, M., Worman, H. J., Wellinger, R. J., and Pandita, T. K. (2003) Mol. Cell Biol. 23, 8363–8376 32. Stopka, T., Amanatullah, D. F., Papetti, M., and Skoultchi, A. I. (2005) EMBO J. 24, 3712–3723 33. Demarco, I. A., Periasamy, A., Booker, C. F., and Day, R. N. (2006) Nat. Methods 3, 519–524 34. Lechner, M. S., Schultz, D. C., Negorev, D., Maul, G. G., and Rauscher, F. J., III (2005) Biochem. Biophys. Res. Commun. 331, 929–937 HP1 and Terminal Differentiation AUGUST 29, 2008•VOLUME 283•NUMBER 35 JOURNAL OF BIOLOGICAL CHEMISTRY 23699 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 190. 35. Minc, E.,Allory, Y., Courvalin, J. C., and Buendia, B. (2001) Methods Cell Sci. 23, 171–174 36. Minc, E., Allory, Y., Worman, H. J., Courvalin, J. C., and Buendia, B. (1999) Chromosoma 108, 220–234 37. Minc, E., Courvalin, J. C., and Buendia, B. (2000) Cytogenet. Cell Genet. 90, 279–284 38. Nielsen, A. L., Ortiz, J. A., You, J., Oulad-Abdelghani, M., Khechumian, R., Gansmuller, A., Chambon, P., and Losson, R. (1999) EMBO J. 18, 6385–6395 39. Nielsen, A. L., Oulad-Abdelghani, M., Ortiz, J. A., Remboutsika, E., Cham- bon, P., and Losson, R. (2001) Mol. Cell 7, 729–739 40. Nielsen, S. J., Schneider, R., Bauer, U. M., Bannister, A. J., Morrison, A., O’Carroll, D., Firestein, R., Cleary, M., Jenuwein, T., Herrera, R. E., and Kouzarides, T. (2001) Nature 412, 561–565 41. Vassallo, M. F., and Tanese, N. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 5919–5924 42. Czvitkovich, S., Sauer, S., Peters, A. H., Deiner, E., Wolf, A., Laible, G., Opravil, S., Beug, H., and Jenuwein, T. (2001) Mech. Dev. 107, 141–153 43. Vakoc, C. R., Mandat, S. A., Olenchock, B. A., and Blobel, G. A. (2005) Mol. Cell 19, 381–391 44. Aagaard, L., Laible, G., Selenko, P., Schmid, M., Dorn, R., Schotta, G., Kuhfittig, S., Wolf, A., Lebersorger, A., Singh, P. B., Reuter, G., and Jenu- wein, T. (1999) EMBO J. 18, 1923–1938 45. Agarwal, N., Hardt, T., Brero, A., Nowak, D., Rothbauer, U., Becker, A., Leonhardt, H., and Cardoso, M. C. (2007) Nucleic Acids Res. 35, 5402–5408 46. Mal, A. K. (2006) EMBO J. 25, 3323–3334 47. Stewart, M. D., Li, J., and Wong, J. (2005) Mol. Cell Biol. 25, 2525–2538 48. Caretti, G., Di Padova, M., Micales, B., Lyons, G. E., and Sartorelli, V. (2004) Genes Dev. 18, 2627–2638 49. Eissenberg, J. C., James, T. C., Foster-Hartnett, D. M., Hartnett, T., Ngan, V., and Elgin, S. C. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9923–9927 HP1 and Terminal Differentiation 23700 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283•NUMBER 35•AUGUST 29, 2008 atCNRSonMarch26,2009www.jbc.orgDownloadedfrom
- 191.
- 192. Ophélie PHILIPOT Ingénieur-Docteur– ophelie.philipot@gmail.com- Page 1 de 2 Ophélie PHILIPOT 7 rue René THIBERT, 94800 Villejuif Tél : (+33) 6 7007 8747 ophelie.philipot@gmail.com 26 ans (05/03/83), nationalité Française INGENIEUR EN BIOTECHNOLOGIES - DOCTEUR EN BIOLOGIE (EN FINALISATION) EXPÉRIENCES PROFESSIONNELLES CHERCHEUR ÉTUDIANT UNITE DE RECHERCHE EN EPIGENETIQUE & DESTIN CELLULAIRE 2005 – 2009 Université de Paris-Diderot, France Réalisations/Productions • Rédaction d’articles scientifiques et soumission pour publication de mon projet de recherche de doctorat • Participation à la publication de quatre autres articles scientifiques • Mise en place de trois collaborations : au Japon, en Australie et en France • Présentation de mes travaux lors de congrès, notamment à un congrès international à New-York • Encadrement et formation d’étudiants (niveaux Licence 3, Master 1 et Ingénieur) • Enseignement (vacations 20h, niveau Bac+3) INGENIEUR ÉTUDIANT PIERRE FABRE- ONCOLOGIE 2005 (6 mois) Industrie pharmaceutique, Toulouse, France Réalisations/Productions • Mise en place de la technologie FACS au laboratoire. • Optimisation d’un protocole de routine pour l’analyse du cycle cellulaire par FACS • Incrémentation de la banque de lignée cellulaire du laboratoire avec la caractérisation de nouveaux modèles tumoraux (mélanomes) FORMATION 2009 Doctorat en biologie moléculaire et cellulaire (prévu pour octobre 2009) (Université de Paris Diderot, France) Lauréate d’une bourse de recherche en oncologie (ARC) 2005 Ingénieur en Biotechnologies (ESIL, Marseille, France) 2002 BTS biotechnologies (Institut La Raque, Castelnaudary, France) (major de promotion, mention TB) LANGUES ET COMPÉTENCES INFORMATIQUES INFORMATIQUE • Travail en environnement Mac et PC (microsoft office). LANGUES • Anglais (courant), Espagnol (très bon niveau écrit, lu et parlé) ARTICLES ET COMMUNICATIONS PLOS ONE Philipot O. and Ait-Si-Ali S Article en révision Core Binding Factor CBF negatively regulates muscle terminal differentiation
- 193. Ophélie PHILIPOT Ingénieur-Docteur– ophelie.philipot@gmail.com- Page 2 de 2 EXPERT OPIN. THER. TARG. Philipot O*, Yahi, H*, Guasconi, V, Fritsch, L, Ait-Si-Ali, S. Chromatin modification and muscle differentiation. 2006, 10(6) : 923-34. (*contribution égale) GENOME BIOLOGY Robin P, Fritsch L, Philipot O, Svinarchuk F, Ait-Si-Ali S. Post-translational modifications of histones H3 and H4 associated with the histone methyltransferases Suv39h1 and G9a. 2007. 8(12) :R270 J BIOL CHEM Yahi H, Fritsch L, Philipot O, Guasconi V, Souidi M, Robin P, Polesskaya A, Losson R, Harel-Bellan A, Ait-Si-Ali S. Differential cooperation between heterochromatin protein HP1 isoforms and MyoD in myoblasts. 2008. 29;283(35):23692-700 CRIT REV ONCOL HEMATOL Raynaud CM, Sabatier L, Philipot O, Olaussen KA, Soria JC. Telomere length, telomeric proteins and genomic instability during the multistep carcinogenic process. 2008. 66(2):99-117 COLLABORATIONS • avec les Drs El-Osta et Baker (Melbourne, Australie). Cartographie épigénétique des gènes cibles de MyoD • avec le Dr Ozasa (Kumamoto, Japan). Etalissement des modèles cellulaires exprimant ectopiquement MyoD CONFERENCES •Young Researchers Meeting (Institut Curie,Institut Jacques Monod, Paris-Diderot), mai 2009. Présentation orale. •Making Muscle in the embryo and the adult (University of Columbia, New-York City, NY, USA), juin 2009. Présentation poster.
- 194. Résumé/Abstract Coopération entre lefacteur myogénique MyoD et le facteur CBF pour la régulation de l’équilibre prolifération-différenciation dans le muscle Le facteur de transcription CBF est composé de deux sous-unités, Runx1 et CBFβ. Core Binding Factor ou CBF était à l’origine étudié pour son rôle dans l’hématopoïèse, mais des études récentes l’on impliqué dans d’autres types cellulaires. Dans notre étude, nous montrons pour la première fois que Runx1 et CBFβ jouent un rôle clé dans la différenciation terminale du muscle squelettique. La différenciation musculaire terminale est sous le contrôle d’un facteur myogénique majeur, MyoD. Ce facteur est capable d’orchestrer la sortie du cycle cellulaire des myoblastes et d’activer l’expression des gènes spécifiques du muscle. Cette étude suggère que Runx1 et CBFβ inhibent la sortie cellulaire et interagissent avec MyoD pour réprimer l’expression des gènes cibles de MyoD. Ensemble, ces données suggèrent que le facteur CBF régule négativement l’équilibre prolifération- différenciation musculaire. Mots clés : différenciation, prolifération, muscle, MyoD, Runx1, CBFβ, destin cellulaire Cooperation between the muscle transcription factor MyoD and Core Binding Factor in the proliferation-differentiation balance in skeletal muscle Core Binding Factor or CBF transcription factor is composed of two subunits, Runx1/AML1 and CBFβ. CBF was originally described as a regulator of hematopoiesis, but recent studies demonstrated its participation in many other differentiation pathways. In this study, we show that Runx1 and CBFβ play a key role in skeletal muscle terminal differentiation. Muscle terminal differentiation is orchestrated by MyoD, a major transcription factor in skeletal muscle. MyoD is capable of triggering the irreversible cell cycle exit of myoblasts and induces the expression of muscle markers. Here, we show that Runx1 and CBFβ have a growth promoting role and that Runx1 and CBFβ interact with MyoD and repress the activation of MyoD target genes. Together, our data suggest that CBF negatively regulates muscle terminal differentiation. Key words : differentiation, proliferation, muscle, MyoD, Runx1, CBFβ, cell fate