1. Molecular Inversion Probes for Sensitive Detection of Mycobacterium tuberculosis Rogério C. Novais 1 , Sibele Borsuk 2 , Odir A. Dellagostin 2 , Yvonne R. Thorstenson 3 1 - Department of Science, Rio de Janeiro State University, Brazil 2 - Biotechnology Center , Federal University of Pelotas, Brazil 3 – Life Technologies, Foster City, USA 2011 Microbiologie Microbiology Poster 63

2. 2011 Microbiologie Microbiology Introduction: Nucleic acid-based detection of Mycobacterium tuberculosis infections has the potential to improve the analysis of the tuberculosis epidemiology and patient care by increasing the specificity and sensitivity of diagnosis. One potential diagnostic sequence, the DR locus, is present in all isolates of M. tuberculosis complex bacteria and contains a variable number of short direct repeats interspersed with non-repetitive spacers. It encodes no known gene product but is useful for molecular typing of M. tuberculosis because of its fortuitous absence in non-tuberculosis strains of mycobacteria. In this study, we attempted to combine the specificity of molecular inversion probe (MIP) technology with the sensitivity of modified pyrosequencing readout in order to detect a short conserved 18 bp sequence (DRa-b) included in DR locus in 25 isolates of M. tuberculosis. Additional sensitivity was obtained by introducing modifications in pyrosequencing methodology, by these means we achieved to detect 500 fg of M. tuberculosis DNA. Poster 63

3. 2011 Microbiologie Microbiology Poster 63 Materials and Methods Design of MIP DRa-b (figure 1) and probing with 25 M.tuberculosis genomic DNAs (Figure 2) DNA amplification from MIPs after MIPs linearization Pyrosequencing (figure 3) of 25 MIPs Analysis of results DNA extraction

4. 2011 Microbiologie Microbiology Poster 63 Figure 1 Figure 2 Figure 1: MIP DRa-b (designed for this work) Figure 2: general overview of MIP methodology Figure 3: general overview of pyrosequencing Figure 3

5. Results: Pyrograms generated from MIPs DRa-b TB.040406 - Well C11 Entry: 25-ACGT Sample: 236 TB.040406 - Well D3 Entry: 25-ACGT Sample: 237 Expected sequence: C CGAGAGGGGACGGAAAC ACGGCTCAACGTTCCTATTCG * In blue: MIP sequence; in black: DRa-b sequence

6. (A) and (B): Determination of minimal amount of DNA to proceed pyrosequencing of MIP DRa-b from strain 724, 50 ng (A) and 5 ng (B) respectively; (C) and (D): Pyrosequencing in presence of 2.5ug of contaminating human DNA (C) and no M. tuberculosis DNA (D) (A) (B) (C) (D)

7. Sensitivity of quantitative pyrosequencing for detection of minimal amount of M ycobacterium tuberculosis DNA. For each Mycobacterium tuberculosis a single peak was generated by using four nucleotides simultaneously. 2011 Poster 63 Microbiologie Microbiology