SlideShare une entreprise Scribd logo
UNIVERSITE DE LOME
Ecole Supérieure des Techniques Biologiques et Alimentaires
(E.S.T.B.A.)
Domaine : Sciences et techniques, Sciences de la santé, Sciences
agronomiques
Licence professionnelle
Ecole Supérieure des Techniques Biologiques et Alimentaires (ESTBA)
UE BCH 205 – ACIDES NUCLEIQUES ET SYNTHESE PROTEIQUE
Crédits : 3
Public cible : Etudiants
Semestre : 4
Pré-requis : Biologie cellulaire, Biochimie
Responsible: Pr. TCHACONDO Tchadjobo, Professeur Titulaire,
Chronophysiologie et Toxicologie moléculaire/environnement
Tel. +228. 92 20 23 92. tchacondotchadjobo@yahoo.fr
Disponibilité : samedi, 10 h à 15h 30
Objectif général :
Cette UE vise à offrir aux apprenants des notions essentielles de la biologie et physiologie
moléculaires et sur des techniques et outils biologiques de base nécessaires pour la pratique et
recherche aux laboratoires de biologie moléculaire.
Objectifs spécifiques : Les apprenants seront capables de :
- décrire les différentes structures chimiques des biomolécules.
- reconnaître par leur nature chimique, les différents composants des biomolécules.
- maitriser les mécanismes d’action moléculaire caractérisant les différentes biosynthèse.
- maitriser les différentes techniques et tests de base de la biologie moléculaire.
CONTENU
Cette UE est composée de trois grandes parties et terminée par des exemples de pratiques de
laboratoire. La première partie traite de la structure des acides nucléiques et des mécanismes de
synthèse des protéines. La deuxième partie est une récapitulation des différents enzymes de
restriction utilisés au laboratoire pour cliver et digérer les ADN et ARN. La troisième partie
décrit les différentes techniques de base de la biologie moléculaire. Ainsi, les étudiants se
familiariseront aux notions de base de la biologie moléculaires. Ils compléteront aussi leurs
connaissances acquises en biochimie et en biologie cellulaire sur l’expression des gènes.
PLAN DU COURS
Séance N° Objectifs spécifiques Titres/Sous titres
1 Historique et intérêt Histoire de la naissance de la Biologie moléculaire,
prix Nobel et relation avec d’autres UE
2 Connaitre la structure
détaillée des RNA et
DNA
-structure des acides nucléiques
- les propriétés fondamentales
- Les différents DNA et RNA
3 Maitriser les
mécanismes de
synthèses, du DNA à
la protéine
-Réplication, synthèse du DNA
-Transcription, synthèse du RNA
-Code génétique et traduction, synthèse protéique
4 Comprendre les
systèmes de
réparations lors des
dommages
cellulaires
- Dommage et erreurs apparus au niveau du DNA
- Les différents systèmes de réparations pour la
fidélité du DNA
5 -Connaitre les
enzymes de
restriction
-Utiliser ces enzymes
Sites des enzymes de restriction
Origine et différentes classes
Utilisation des enzymes de restriction
6 -Comprendre les
phénomènes de
substituions et
mutation
-Les interpréter
-Substitutions et fidélité du DNA
-Mutation et modification géniques
-Etude de cas de maladies congénitales
7 -Connaitre les
mécanismes
d’insertion et de
délétions
- Les interpréter
-Insertion, délétion et maladies génétique
- Etude de cas de maladies congénitales
8 Savoir extraire,
purifier et quantifier
le DNA
-Extraction et purification du DNA
-Electrophorèse du DNA
9 -Comprendre
l’amplification
génique
-Savoir utiliser un
thermocycleur
-PCR et réplication
-Les différents PCR
-Les étapes de réalisation
-Les produits PCR
-Les applications pratiques
10 -Comprendre les
principes de
séquençage du DNA
-Savoir l’interpréter
-Différentes techniques de séquençage du DNA
-Principe et interprétation
11 -Comprendre les
techniques de
Southern et de
Northern
-Savoir les appliquer
-Différentes étapes de la technique de Southern
-Les applications de la technique de Southern
-Différentes étapes de la technique de Northern
-Les applications de la technique de Northern
12 Répondre aux
questions et
inquiétudes des
apprenants en
révision générale
Dépends des questions et inquiétudes des
apprenants
MODALITE D’EVALUATION
Contrôle continu des connaissances
− Devoir sur table (33.33%)
− Examen finale (66.67%)
Bibliographie
1. Françoise Quentin, Paul-françois Gallet, Michel Guilloton & Bernadette Quintard.
Biochimie en 84 fiches, Dunod, Paris, 2015, 5 rue Laromiguière, 75005 Paris,
www.dunod.com ISBN 978-2-10-073922-6
2. Simon Beaumont. Biochimie-UE1 ,1ère
année santé, Dunod, Paris, 2015, 5 rue
Laromiguière, 75005 Paris, www.dunod.com , © Dunod, Paris, 2005, ISBN 978-2-10-
073044-5
3. Weinman S., 2004. Toute la Biochimie. ISBN 2 10 006734 6. Dunod, Paris
4. David L. Nelson & Michael M. Cox, Lehninger, Principles of Biochemistry, Fourth
Edition; 1130p.
5. Jacques Kruh. Biochimie Etudes Médicales et Biologiques. Tome 1, Biologie Cellulaire
Et Moléculaire, Editions Hermann
6. Jacques Kruh. Biochimie Etudes Médicales et Biologiques. Tome 2, Métabolismes,
Edition Hermann 1989.
7. Etienne J. & Clauser E. Biochimie génétique, biologie moléculaire. Masson, 1999.
8. Stryer L. La biochimie. Flammarion, Médecine – sciences, 1992.
9. Alberts B. & al. Biologie moléculaire de la cellule. Flammarion, Médecine – sciences,
1995.
10. MAMAN I., TCHACONDO T., BANLA-KERE A. Ulcer de Buruli. Edition
Universitaire Européenne, 2019 ; 207p.
11. Biologie moléculaire et médecine. Flammarion, Médecine – sciences, 1993.
12. Boyard E. Cancer et médicaments, Masson, 1993.
INTRODUCTION A LA BIOLOGIE MOLECULAIRE
1- Définition
La Biologie Moléculaire (BM) est le champ de la biologie qui concerne les
phénomènes biologiques en termes d’interaction moléculaire ou chimique. Elle se
consacre au monde vivant par la connaissance des molécules qui lui sont propres.
Ces molécules sont des constituants élémentaires des organismes vivants (ADN,
ARN).
2- Historique
L’histoire de la Biologie Moléculaire commence en 1953 avec la découverte de
la structure en double hélice de l’ADN par Watson et Crick (Prix Nobel 1962).
Cette découverte très importante ouvre la voie à la compréhension de plusieurs
fonctions cellulaires. On sait dès lors que c’est à partir des gènes portés par l’ADN
que sont synthétisées des molécules qui permettront la vie de la cellule, des tissus
et de l’organisme. Les hormones, les enzymes, les facteurs de croissance et les
fonctions de développement constituent quelques exemples de ces molécules
essentielles de la vie.
3- Biologie Moléculaire : Science particulière
La Biologie Moléculaire diffère de la biochimie par le fait que cette dernière
concerne principalement le comportement chimique des substances biologiques
importantes et de leur analogue. Elle diffère également des autres champs
biologiques par son emphase sur les interactions chimiques particulières entre
autres celles impliquées dans la réplication de l’ADN, sa transcription en ARN et
sa traduction en protéine ; en résumé dans les réactions chimiques reliant le
génotype et le phénotype.
4- Importance de la Biologie Moléculaire
La biologie moléculaire a favorisé l’évolution rapide de diverses techniques
biologiques avec des domaines d’application assez variés.
- En médecine : exemple de la Fabrication de l’insuline, de la lutte contre le
cancer (Cancer génétique).
- En agriculture
- Environnement
- Nutrition
STRUCTURE DES ACIDES NUCLEIQUES
I – Définition
Les acides nucléiques sont des macromolécules comportant des sous – unités
appelées nucléotides.
On distingue deux grands groupes d’acides nucléiques :
- Les acides ribonucléiques (ARN) ;
- Les acides désoxyribonucléiques (ADN). qui sont surtout localisés dans le
noyau.
II – Les Nucléotides
1- Définition
Ce sont des macromolécules formées de 03 composants qui sont les bases (T, A,
G, U, C), les oses (ribose, désoxyribose) et l’aide phosphorique.
a- Les bases
Elles sont classées selon la nature de leur noyau en bases puriques et
pyrimidiques.
- Les principales bases pyrimidiques c’est à dire issues d’un noyau pyrimidine
sont l’Uracile(U), la Cytosine(C) et la Thymine(T).
- Les principales bases puriques c’est à dire dérivées d’un noyau purine sont : la
Guanine(G) et l’Adénine(A).
b- Les oses
Elles sont de deux sortes : le ribose et le désoxyribose. Ces deux sucres sont des
pentoses dont la structure de base se présente comme suit :
c- L’acide phosphorique
Il est caractérisé par trois fonctions acides. Deux de ces fonctions sont estérifiées
dans les ADN et les ARN. La troisième est libre.
2- Liaisons dans les nucléotides
a- Liaison base – ose
C’est une liaison glucosidique appelée b- osidique. L’association ose – base donne
un nucléoside.
b- Liaison acide phosphorique – ose
Il s’agir d’une liaison ester. Il y a élimination d’une molécule d’eau entre un OH
de l’H3PO4 et un H de la fonction alcool de l’ose.
Fig.
3- Nomenclature des acides nucléiques
a- Nucléotides à bases pyrimidiques
Le nom des nucléosides se termine par « idine » et celui des nucléotides se termine
par « idylique ».
b- Nucléotides à bases puriques
Le nom des nucléosides se termine par « ine » et celui des nucléotides par
« ylique ».
L’appellation est complétée, si l’ose est un désoxyribose, en faisant précéder
l’abréviation du nucléotide par la lettre « d » dans les deux cas.
Le tableau de la nomenclature des principaux nucléotides est le suivent
Nomenclature des principaux nucléotides
BASE NUCLEOSIDE NUCLEOTIDE ARN
Monophosphate
ADN
Monophosphate
Adénine Adénosine Acide
adenylique
AMP d- AMP
Guanine Guanosine Acide
guanylique
GMP d- GMP
Cytosine Cytidine Acide
cytidylique
CMP d- CMP
Thymine Thymidine Acide
thymidylique
- d- TMP
Uracile Uridine Acide
uridylique
UMP -
III- Les acides nucléiques
1- Liaison entre les acides nucléiques
Dans un acide nucléique, les nucléotides sont rassemblés entre eux par des liaisons
esters. Une molécule d’eau est donc éliminée entre OH de l’H3PO4 et H de la
fonction alcool située en position 3’ de l’ose. Quand l’ H3PO4 présente ses deux
fonctions acides bloquées dans la formation de l’ester, on parle de liaison
phosphodiester. On peut indiquer les lettres a et b pour préciser les liaisons
concernées.
- La liaison phosphodiester « a » correspond à la liaison ester entre l’acide
H3PO4 et le OH en 3’ de l’ose.
- La liaison « b » correspond à la liaison ester entre l’acide H3PO4 et le OH
en 5’ de l’ose.
-
Fig.
2- Sens de lecture d’un acide nucléique
Par convention, l’acide nucléique est lu dans le sens de l’extrémité 5’ extrémité
comportant un groupement phosphate, vers l’extrémité 3’ qui possède un OH
libre.
Exemple : 5’ –AACTTGG-3’
IV- Les Acides Désoxyribonucléiques (ADN ou DNA)
1- Constituants
Ce sont les acides nucléiques faits de 02 chaînes de nucléotides. Les ADN
présentent quelques caractéristiques particulières notamment :
- l’ose : désoxyribose ;
- les bases : sont A, T, G, C soient 2 bases puriques et 2 bases pyrimidiques.
2 - Propriétés caractéristiques de l’ADN
Trois propriétés caractérisent l’ADN :
- la complémentarité
- l’antiparallélisme
- la forme hélicoïdale
* Antiparallélisme
Les 2 brins de la molécule d’ADN sont disposés dans le sens opposé. L’un est
orienté dans le sens 5’-3’ et l’autre parallèle, s’oriente dans le sens 3’-5.
* Complémentarité
Les 2 brins composant l’ADN sont appariés par des bases. Cet appariement des
bases se fait selon une règle dite de complémentarité : A est appariée à T et C à
G. Cette complémentarité repose sur des raisons structurales et sur la formation
des liaisons hydrogènes. Ces liaisons hydrogènes sont au nombre de 2 entre A et
T, et de 3 entre C et G.
Fig.
* Forme hélicoïdale
Dans l’espace, les 2 chaînes d’une molécule de DNA, présentent une
conformation hélicoïdale. Elles s’enroulent autour d’un axe imaginaire pour
former une double hélice en rotation droite (la forme A et B) ou plus
exceptionnellement à rotation gauche (forme Z).
Fig.
- Les formes d’ADN
Il existe plusieurs formes d’ADN dont les plus connues sont A, B et Z. La forme
B est la forme biologique la plus importante décrite par WATSON et CRICK. Les
caractéristiques de B sont les suivantes :
• Environ 10 paires de bases par tour de spire
• Le diamètre est de 2,4nm,
3- Priorités physico-chimiques de l’ADN
a- Température de fusion
A une certaine température, les liaisons hydrogènes entre les 2 brins d’un ADN
se rompent et les 2 brins se séparent. On dit que l’ADN est dénaturé. C’est la
fusion de l’ADN caractérisée par une température Tf dite température de fusion.
Cette dénaturation est cependant réversible. Les 2 brins peuvent se réassocier
suivant la règle de complémentarité.
b- Absorption dans l’ultraviolet
Dans l’UV, les bases pyrimidiques permettent de doser l’ADN grâce à leur
pouvoir d’absorption. Généralement l’ADN absorbe à 260 nm. Cette propriété
permet au laboratoire de détecter facilement la présence d’ADN dans un milieu.
c- Hybridation des acides nucléiques et notion de sondes nucléiques
L’hybridation est l’une des propriétés fondamentales des acides nucléiques qui
reposent sur la règle de complémentarité. Il est possible d’apparier les brins
d’ADN avec les oligonucléotides ou les polynucléotides qui reconnaissent
spécifiquement des séquences sur les brins d’ADN de manière antiparallèle et
complémentaire. Ces oligo et polynucléotides sont appelés des sondes et l’ADN
obtenu, est dit hybride.
4 - Chromatine et Nucléosomes
Dans les cellules eucaryotes, la molécule d’ADN est fortement associée à des
protéines pour constituer la chromatine. Les nucléosomes sont constitués
d’environ 200 paires de bases associées à des protéines appelées Histones. Au
niveau des nucléosomes, l’ADN est associé à un octamère d’histones. Le
traitement doux de la chromatine par une endonucléase, libère des particules qui
sont l’ADN, les protéines d’histone et quelques protéines non histones (voir
purification).
II - Les Acides Ribonucléiques : ARN ou RNA
1- Caractéristiques
Les ARN sont des acides nucléiques dont les caractéristiques générales sont les
suivantes :
- Sucre : ribose
- bases : A, U, C, G.
- appariement : les règles d’appariement dans les bases complémentaires
peuvent s’observer aussi au niveau des ARN. En effet dans une même chaîne
d’ARN, des parties peuvent être bicaténaires avec des appariements tels que A=U
et C=G. Ceci donne au niveau de la portion appariée, des sortes de lignes alors
que les régions non appariées présentent des formes en boucle. Ainsi les ARN
peuvent prendre plusieurs formes.
2- Différents types d’ARN
Les cellules contiennent essentiellement 4 types d’ARN :
- les ARNr (ribosomique)
- les ARNt (transfert)
- les ARNm (messager)
- les ARN de petites tailles (sRNA, cytoplasmique).
a- Les ARNr
Ce sont les plus nombreux des ARN. Les ARNr jouent un rôle essentiel dans la
structure et le maintien de l’intégrité des ribosomes en association avec les
protéines ribosomales. Les ribosomes sont des organites situés dans le cytoplasme
et qui constitue l’usine de fabrication des protéines chez les procaryotes et les
eucaryotes. Chaque ribosome comporte 2 sous unités :
- Une grande sous-unité de 50 S (procaryote) ou de 60 S (eucaryote) ;
- Une petite sous-unité de 30 S (procaryote) ou de 40 S (eucaryote).
b- Les ARNt
* Rôle
Leur rôle est essentiel dans la synthèse protéique. Ce sont des vecteurs qui vont
transférer les acides aminés jusqu’à l’usine ribosome où s’effectue la synthèse des
protéines.
* Structure des ARNt
En plus de la structure générale des ARN, les ARNt possèdent des particularités
propres :
- des bases inhabituelles comme l’hypoxanthine dont le nucléotide correspondant
est IMP (Inosine monophosphate), mais aussi la thiamine ou encore des bases
méthylées.
- structure spatiale : chaînes constituées d’une centaine de nucléotides avec des
zones d’appariement et des boucles non appariées. La forme générale est celle
d’une L qui prend la forme de trèfle en structure spatiale.
- des sites importants : on note plusieurs sites dont les plus importants sont :
* l’extrémité 3’-OH portant 3 nucléotides caractéristiques. C-C-A-3’-OH et qui
fixera l’acide aminé qui sera véhiculé par l’ARNt.
* l’anticodon qui correspond à un groupe de 3 nucléotides ou triplet situé sur une
boucle d’ARN. Ce triplet joue un rôle important lors de la synthèse protéique. En
effet, c’est ce triplet qui s’apparie à un autre triplet appelé codon présent sur
l’ARNm. Cet appariement se fait par des liaisons hydrogènes et selon les règles
de complémentarité. Le codon et l’anticodon sont disposés de façon antiparallèle.
Fig.
Il existe naturellement une vingtaine d’acides aminés, mais on dénombre 61
codons différents reconnus et transportés par plusieurs ARNt spécifiques.
- l’extrémité 5’ de l’ARNt comporte un groupement phosphate
e - ARNm
C’est le support essentiel de l’information génétique entre l’ADN et les ribosomes
du cytoplasme où s’effectue la synthèse protéique. Leur durée de vie est très
courte à la différence des ARNt.
Chez la bactérie, la durée de vie d’un ARNm est de quelques minutes.
Les ARNm sont très rapidement synthétisés. Ils sont formés d’une seule chaîne
de nucléotides avec des bases communes aux ARN (A,G,C et U). Cette chaîne
comporte une succession de triplets nucléotidiques et chaque triplet constitue un
codon spécifique d’un acide aminé.
d- Petits ARN nucléaires
Présents dans le noyau, ils sont impliqués dans certaines étapes de la transcription,
c'est-à-dire de la copie de l’ADN en ARNm.
LA REPLICATION
I – Généralités
Lors de la division cellulaire, quand une cellule mère donne deux cellules filles,
il est essentiel que l’ADN présent dans ces cellules filles soit la copie identique
de l’ADN parental. On parle de réplication de l’ADN.
Ainsi, préalablement à la division cellulaire, la quantité d’ADN est multipliée par
2. Le mécanisme de réplication conditionne donc le déroulement de la division
cellulaire. Ce mécanisme comporte en générale trois étapes : Initiation,
Elongation et Terminaison.
II – Réplication chez les procaryotes
1- Caractéristiques
La réplication est dite semi-conservative c'est-à-dire que sur les deux brins d’ADN
fils on a toujours un qui provient d’un des deux brins de l’ADN parental et un brin
nouvellement synthétisé.
Fig.
A chaque réplication les deux brins d’ADN parental se séparent ; chacun de ces
deux brins sert de matrice pour la synthèse d’un brin qui lui est complémentaire.
2- Eléments nécessaires à la réplication
La réplication d’ADN nécessite :
- Une matrice d’ADN constituée par un brin parental ;
- La présence de nombreuses enzymes : hélicase, ADN polymérases …. ;
- La présence de certains ions comme Mg2+ .
Ces différents éléments interviennent dans le bon déroulement de chacune des
trois étapes de la réplication.
3- Mécanisme d’initiation de la réplication
3-1- Notion de réplicon
L’unité d’ADN où se produit la réplication est appelée réplicon. Ce réplicon a une
origine où est initiée la réplication, et une terminaison où s’arrête la réplication.
A partir d’un point d’initiation, la réplication peut progresser soit d’une manière
unidirectionnelle soit d’une manière bidirectionnelle.
3-2- Initiation de la réplication
Chez E. coli, il existe au niveau de l’ADN, une origine unique de la réplication
appelée Ori C. Ce locus Ori C est constitué d’une séquence de 245 bases. Cette
séquence contient :
- 3 séquences nucléotidiques presque identiques faites de 13 nucléotides
chacune et riches en thymine.
- 4 sites de liaison comportant un motif de 9 paires de bases pour une protéine
appelée dna A qui est une protéine d’initiation de la réplication codée par
le gène du même nom dna A.
Au début de la réplication, des copies de cette protéine s’associent avec l’ADN à
l’origine de la réplication. Ces liaisons nécessitent de l’ATP. C’est une étape
indispensable à la transformation localisée de l’ADN double brin en ADN simple
brin. Ces complexes viennent ensuite fixer l’ADN hélicase ou protéine dna B,
enzyme qui catalyse le déroulement de la double hélice d’ADN en présence
d’ATP. Ce qui définira la future fourche de réplication. Une protéine appelée dna
C est indispensable à cette étape, mais elle sera ensuite relâchée après fixation de
la protéine dna B à la fourche de réplication.
Les brins séparés de l’ADN sont ensuite stabilisés sous forme de simples brins
grâce à la fixation d’autres protéines appelées SSB (Simple Strand Binding).
Il se formera ensuite un complexe appelé Primosome ou protéine dna G entre
l’hélicase et un autre enzyme appelé Primase ; complexe qui synthèse une amorce
d’ARN de 9 bases. Après synthèse de l’amorce, une enzyme dite ADN
polymérase III s’insère au niveau de la fourche de la réplication pour commencer
la synthèse de l’ADN à partir de l’extrémité 3’-OH de l’amorce. Le complexe de
protéine qui se déplacera le long de l’ADN pour catalyser la réplication est appelé
Réplisome.
4- Discontinuité de la réplication et élongation
4-1- Discontinuité
Le déroulement de la réplication n’est pas identique entre les deux brins d’ADN.
En effet sur l’un des deux brins en synthèse, la réplication s’effectue de manière
continue : c’est le brin avancé. Alors que sur l’autre brin, elle est discontinue et
on parle de brin retardé.
4-2- Elongation
Sur le brin avancé, la progression de la réplication se fait dans le sens 5’-3’ en
utilisant comme modèle, le brin d’ADN parental orienté dans le sens 5’-3’.
Sur le brin retardé, de petits fragments d’ADN sont synthétisés : ce sont des
fragments d’Okazaki. Chaque fragment est synthétisé dans le sens 5’-3’. Le brin
modèle correspondant (de l’ADN) est orienté de manière antiparallèle 3’-5’.
*ADNp III et étape d’élongation
L’intervention de l’ADNp III est essentielle dans l’incorporation des nucléotides.
L’ADNp III synthétise un brin complémentaire à partir de l’extrémité 3’-OH de
l’amorce d’ARN, en utilisant les brins d’ADN comme matrice. Cet enzyme
comportant 10 polypeptides, synthétise le brin avancé et les fragments discontinus
sur le brin retardé et toujours dans le même sens 5’-3’.
En résumé, la copie d’un brin parental nécessite donc l’intervention d’une amorce
d’ARN, une synthétase qui synthétise l’amorce d’ARN puis l’ADNp III qui
allonge cette amorce d’ARN pour fabriquer le brin complémentaire d’ADN.
5- Hydrolyse et remplacement des amorces d’ARN
Ce mécanisme est caractérisé par l’intervention d’une ADN polymérase appelée
ADNp I. Les amorces d’ARN sont ensuite détruites et hydrolysées par
l’intervention d’un enzyme appelé RNase H.
Les lacunes engendrées par l’RNase H sont comblées par l’ADNp I. Finalement
les fragments d’ADN deviennent contigus et soudés les uns aux autres grâce à un
enzyme appelé DNA ligase.
Notons que l’ADNp I est aussi capable d’hydrolyser les amorces d’ARN.
6- Remarques générales sur la fonction des ADN polymérases
Les ADNp présentent plusieurs fonctions enzymatiques :
- Fonction polynucléasique permettant de constituer la chaîne
polynucléotidique, l’enzyme ajoute les nucléotides à l’extrémité 3’-OH
d’un acide nucléique.
- Fonction exonucléasique 3’-5’ : elle permet de vérifier les derniers
nucléotides mis en place. En cas d’un défaut d’appariement, elle enlève ce
dernier nucléotide et insère le nucléotide correct ; ce mécanisme capital est
appelé fonction d’édition des ADNp. Il permet la correction d’erreurs au
cours de la réplication.
7- Terminaison de la réplication
Il existe plusieurs sites de terminaison dans le génome bactérien. Une protéine
spécifique appelée Tus, se lie au site de terminaison. Cette liaison arrête la
protéine hélicase en même temps que la réplication.
III – Réplication de l’ADN chez les Eucaryotes
1- Caractéristiques générales
La réplication est en général comparable à celle des ADN procaryotes. Elle est
bidirectionnelle, discontinue, complémentaire, antiparallèle et se fait dans le sens
5’-3’. Elle utilise également les amorces d’ARN.
2- Caractéristiques particulières
• La réplication chez le Eucaryotes se fait en de nombreux points d’initiation.
Elle fait intervenir un nombre d’ADNp plus important et de nombreuses
protéines comme facteurs de réplication.
• Il existe au moins 05 ADNp chez les Eucaryotes qui sont ADN alpha, β,
gama, Δ, et epsilon.
• L’ADN simple brin au cours de la réplication est stabilisé par des protéines
SSB particulières.
• Les télomères : ce sont des extrémités des chromosomes d’eucaryotes
formées des séquences répétitives.
- A l’extrémité 3’ des chromosomes, on trouve des copies répétées de
séquences de type TTGGGG ou TTAGGG.
- A l’extrémité 5’, on a les séquences complémentaires riches en cytosine.
Ainsi, la réplication de l’ADN à l’extrémité des chromosomes eucaryotes fait
donc intervenir un enzyme spécifique : la Télomérase. Cet enzyme ajoute des
séquences spécifiques en 3’-OH des brins d’ADN. Il assure également la
protection de ces extrémités chromosomiques.
Figure résumé.
LA TRANSCRIPTION
I – Généralités
La transcription constitue l’ensemble des mécanismes par lesquels l’ARNm est
synthétisé. L’ARNm est une copie d’une portion d’ADN.
Seules certaines parties de l’ADN sont transcrites. Ces séquences d’ADN sont
appelées des gènes.
Seul l’un des deux brins de l’ADN est copié en ARNm.
La transcription constitue l’étape préliminaire essentielle pour la biosynthèse des
protéines.
II – Caractères généraux
1- Règles de base
La synthèse d’un ARNm à partir d’une ADN s’effectue toujours :
- dans le sens 5’-3 de l’ARNm en synthèse
- de manière antiparallèle par rapport à la portion d’ADN copiée.
- de façon complémentaire c'est-à-dire G - C et A - U.
2- Eléments nécessaires
La synthèse d’ARNm nécessite :
- La présence de nucléotides propres aux ARN c'est-à-dire contenant des
bases A, C, G, U ;
- La présence d’un sucre : le ribose ;
- La présence d’ARNp et des sels de Mg2+
;
- La présence d’une matrice d’ADN servant de modèle : on parle d’ARN
polymérase – ADN dépendant.
III – Différentes étapes de la transcription
La transcription ne concernant qu’une portion de l’ADN, il faut déterminer son
début et sa fin, puis préciser les mécanismes par lesquels l’ARNp reconnaît la
portion d’ADN à transcrire. On parle d’unité transcriptionnelle. La synthèse de
l’ARNm comprend trois phases : l’initiation, l’élongation et la terminaison.
1- Initiation
a- Généralités
Par convention, on donne le chiffre +1 au 1er
nucléotide à partir duquel commence
la transcription, puis le chiffre –1, au nucléotide qui le précède. Le signal pour
initier une transcription correcte est appelé Promoteur. Ce promoteur est situé en
avant et au début de la zone où commence la transcription.
b- Promoteur des gènes procaryotes
Ils sont généralement situés en 5’ du site +1 d’initiation. Ces promoteurs ne sont
pas donc transcrits. Dans la plupart des cas, les séquences nucléotidiques des
promoteurs sont courtes et assez similaires. Deux de ces séquences sont
remarquables :
- Une première située entre -30 et -35 paires de bases en avant de l’origine
de la transcription. On l’appelle séquence -35, constituée de six paires de
bases.
- Une deuxième séquence dite séquence -10 située à environ dix nucléotides
par rapport à l’origine de la transcription +1.
Fig.
5’ TTGACA TATAAT II +1
3’
3’ AACTGT ATATTA 5’
- 35 - 10
c- ARNp des procaryotes
L’ensemble des ARN est synthétisé par l’ARNp chez les procaryotes. Cet enzyme
reconnaît les sites promoteurs, puis se positionne sur ces sites. Il recouvre une
région située entre les positions -60 et +20. Dès lors placée sur cette région,
l’ARNp protège l’ADN de l’action d’autres enzymes.
Chez les eucaryotes l’initiation est plus complexe.
2- Elongation
a- Mécanisme
La progression de la transcription se fait par formation de la liaison entre les
nucléotides. Les nucléotides à ajouter sont sous formes de nucléosides
triphosphates riches en énergie. Chaque nucléoside forme une liaison ester par
extrémité 5’ avec l’extrémité 3’ de l’ARN en cours d’élongation. Le 1er
nucléotide
comporte toujours une base purique. Ce 1er
nucléotide va conserver son
groupement triphosphate. La progression de la transcription se fait dans le sens
5’-3’ de l’ARN en synthèse.
Fig. rechercher dans la bibliographie.
Au fur et à mesure qu’elle se réalise, les 2 brins d’ADN se séparent et un seul brin
est copié. L’ARN formé, initialement apparié au brin d’ADN, se détache par la
suite. La liaison hydrogènes des brins d’ADN se forme après passage de l’ARNp.
Puis les 2 brins de l’ADN matrice reprennent leur forme hélicoïdale.
Fig. rechercher dans la bibliographie.
b- Identification de brins
Considérons la séquence d’ADN suivante comme matrice :
+1
5’ AGCTTAACGCGTA 3’
3’ TCGAATTGCGCAT 5’
Le chiffre +1 ci-dessus sur la base A, désigne le site d’initiation, c’est la 1ère
base
transcrite.
Au cours de la transcription et dans le cas d’une ARNp progressant dans le sens
gauche - droit sur la séquence ci-dessus, l’ARNp synthétisera un ARNm dans le
sens 5’-3’ ; ce qui signifie que la séquence d’ARNm commerce par A soit
5’ –AACGCGUA- 3’
Par définition,
- le brin d’ADN qui a le même sens que l’ARN est appelé brin sens.
- Le brin d’ADN opposé est nommé brin non-sens ou brin antisens.
Le brin sens est aussi dit non transcrit c'est-à-dire qu’il ne sert pas de brin matrice
de lecture de l’ARNp. Par contre le brin d’ADN orienté 3’-5’ est appelé brin
transcrit.
Par référence à la synthèse protéique, on parlera de brin non transcrit (sens) ou
brin codant et de brin transcrit ou non codant.
Considérons une autre séquence d’ADN suivante :
5’-GCAATCG-3’
3’-CGTTAGC- 5’
Si l’ARNp progresse dans le sens gauche - droit, le brin sens est constitué par le
brin 5’-3’. Par contre si l’ARNp progresse dans le sens droit - gauche, le brin sens
est 3’- 5’.
3- Terminaison
L’arrêt de la transcription s’effectue par l’intervention des signaux de fin de
transcription.
Les signaux formés par les séquences de polyadénylation de type 5’AATAAAA3’
sur le brin sens annoncent la terminaison de la transcription chez les eucaryotes.
L’ARNp reconnaît ce signal sur l’ADN mais poursuit la transcription. Dans ces
conditions les produits primaires de la transcription. Dans ces conditions les
produits primaires de la transcription sont appelés transcrits primaires
Chez les procaryotes la terminaison est caractérisée par un site dit Terminateur. Il
apparaît à l’extrémité de l’ARNm, des boucles qui déstabilisent la liaison ARNp
et matrice d’ADN.
Fig. rechercher dans la bibliographie.
4- Produits de la transcription
Ces produits peuvent être principalement :
- ARNm qui sera traduit en protéine et peut être polycistronique c'est-à-dire
pour plusieurs chaînes polypeptidiques (Procaryotes) avec un ARNm issu
de plusieurs gènes) ou monocistronique (Eucaryotes).
- ARNt, ARNr, sARN.
IV- Modifications Post-transcriptionnelles chez les procaryotes
Après la synthèse de l’ARN, ARNm sort de l’ADN et du noyau pour le
cytoplasme. Les cassures réalisées au niveau de l’ADN matrice sont comblées et
réparées par les ADNp I ou II et les ligases.
Fig. rechercher dans la bibliographie.
Après la synthèse protéique, les ARNm sont rapidement dégradés. La
dégradation des ARNm bactériens est réalisée par la combinaison des fonctions
d’endo et d’exonucléases. Les clivages par les endonucléases s’effectuent dans le
sens 5’-3’ et en arrière des ribosomes qui assurent la traduction protéique. Les
fragments seront ensuite dégradés par les exonucléases qui travaillent dans le sens
3’-5’.
Fig. rechercher dans la bibliographie.
V- Modifications post-transcriptionnelles chez les eucaryotes
Chez les eucaryotes on a 03 groupes d’ARNp :
- ARNp I : qui transcrit les ARNr
- AAARNp II : qui transcrit les précurseurs des ARNm appelés transcrits
primaires.
- ARNp III : qui transcrit les ARNt
Ces 03 ARNp sont des protéines constituées de sous-unités et ont besoin de
facteurs multiples pour se positionner au point de départ (+1) au niveau des gènes.
1- Structure des gènes eucaryotes
Chez les eucaryotes les gènes possèdent une structure discontinue comportant
des sous-unités appelées Exons et Introns.
* Les exons sont des séquences d’ARN qui seront traduites en protéine.
* Les introns sont des séquences non traduites intercalées par les exons.
2- Unité de transcription et transcrit primaire
a- Définition
On appelle unité de transcription, un ensemble comportant une origine ou point
de départ de la transcription +1 et un point de fin de transcription ou site de
terminaison. Elle va donc de la 1ère
base transcrite à la dernière base transcrite.
L’ARNm correspondant s’appelle Prè-ARNm ou transcrit primaire (eucaryote).
Ce pré-ARNm comprend outre les exons et les introns, des régions extrêmes non-
traduites appelées UTR (Untranslated region) : 5 UTR et 3’ UTR.
Le schéma général se présente comme suit :
b- Structure détaillée et sites de Pré-ARNm
Au niveau du transcrit primaire, les séquences de bases d’un intron commencent
par GU et se terminent par les bases AG. L’exon d’amont se termine par CAG
ou AAG et l’exon d’aval par G ou A.
Le transcrit primaire comporte 02 sites appelés site d’épissage : le site 3’-OH et
le site 5’P. Ces sites sont respectivement receveurs et donneurs d’électron lors de
la maturation de l’ARNm.
D’autres sites dits régulateurs assurent la régulation de cette maturation. En amont
du site 3’-OH d’épissage entre 20 et 30 nucléotides, se trouve un autre site appelé
site de branchement A, qui joue un rôle important dans les mécanismes d’excision
– épissage.
Fig. rechercher dans la bibliographie.
3- Les modifications du transcrit primaire
a- Addition de la coiffe
La coiffe est une macromolécule indispensable ajoutée à l’ARNm pour la
protection contre l’attaque des enzymes de dégradation.
b- Addition des poly A à l’extrémité
La présence de poly A à l’extrémité 3’-OH aurait également une fonction
protectrice des ARNm.
c- Excision – épissage
L’excision-épissage est un mécanisme qui permet la maturation du transcrit
primaire en ARNm. Il se déroule dans le noyau des cellules eucaryotes.
* Mécanisme
L’excision-épissage fait intervenir deux réactions de tranestérification.
Considérons le schéma suivant :
5’ 3’ A 5’ 3’
5’ 3’
Exon 1 2’-OH Exon 2
Intron
Deux grandes étapes caractérisent les mécanismes d’excision – épissage.
- Etape 1 : Clivage en 5’ de l’intron et formation d’un boucle appelé Lasso.
A’
- Etape 2 : Clivage en 3’ de l’intron, il y a simultanément soudure des deux
exons avec formation d’une liaison phosphodiester entre 3’- OH de l’exon
1 et 5’ –P de l’exon 2 ; puis libération de Lasso qui sera ensuite dégradé.
L’exclusion des introns détermine la maturation des pré-ARNm en ARNm.
• Intervention des SnARN
Les SnARN s’associent aux facteurs ribonucléoprotéiques (RNP) pour donner le
complexe SnRNP. Ce complexe va se fixer au niveau de l’intron à éliminer. Il se
forme ainsi un autre complexe appelé Splicéosome nécessaire pour un
déroulement correct du mécanisme de l’excision – épissage.
VI – Contrôle de la transcription et régulation post – transcriptionnelle
1- Contrôle de la transcription
La transcription étant un mécanisme assez complexe, des erreurs peuvent
apparaître. Ainsi un système de contrôle est mis en marche depuis l’étape
d’initiation jusqu’à l’étape de la terminaison. Ce système est constitué en général
des protéines appelées Facteurs de Transcription (TF) qui s’associent à chaque
étape, aux différentes structures de transcription. Exemples : TF II –A ; TF II –D.
E 1 E 2
2- Régulation post – transcriptionnelle
Elle est assurée par un système de régulateur composé de protéines dites
régulatrices. Ces protéines sont caractérisées par :
- leur situation à proximité du promoteur
- leur interaction avec les protéines fixées sur le promoteur
- leur variation d’un gène à l’autre.
Ces protéines ne peuvent se rencontrer très en amont ou en aval d’un site
d’initiation. On distingue deux grands groupes, le groupe des cis –régulateurs et
le groupe des trans – régulateurs. L’association des deux groupes de facteurs de
régulation joue un rôle quantitatif important dans la synthèse des ARNm.
a- Régulation quantitative
• Epissage alternatif
Une cellule peut épisser le pré – ARNm de diverses façons pour donner plusieurs
protéines différentes à parti d’un seul gène. Ce processus est appelé épissage
alternatif ou différentiel, et l’exon éliminé est dit optionnel.
• Edition
La correction d’un ARN concerne tout traitement par addition, suppression ou
substitution d’un ou plusieurs nucléotides aboutissant à la formation d’un ARNm
dont la séquence diffère de celle du brin d’ADN lu au cours de la transcription.
On distingue :
- Edition par insertion d’une base et décalage du cadre de lecture.
- Edition avec changement d’un codon ou triplet (substitution) .
b- Régulation qualitative
Elle fait intervenir les facteurs régulateurs de :
- la stabilité de l’ARNm : cette stabilité peut être très variable et conditionne
la durée de vie de l’ARNm.
- Stockage de l’ARNm.
TRADUCTION ET CODE GENETIQUE
I – Le Code Génétique
A – Définition
Le code génétique correspond à l’enchaînement ordonné de trois bases (triplet)
permettant de déterminer le code d’un acide aminé. Ce codage c'est-à-dire
"séquence nucléotidique" correspond à séquence protéique, est assuré par un
système de traduction présent dans le cytoplasme. Il faut noter qu’il existe dans la
nature 20 acides aminés et 04 bases susceptibles de former des codons. La
combinaison des bases donne 43
= 64 triplets. Ainsi un acide aminé peut être
déterminé par plus d’un triplet.
B- Caractéristiques principales
1- Code génétique défini par trois lettres
Sur 64 codons disponibles 03 ne peuvent pas être traduits en acides aminés et sont
appelés codons non – sens ou codons stop. Il s’agit de : UAA, UAG et UGA.
2- Code universel
Le code génétique est le même dans tous les organismes vivants à quelques
exceptions près.
3- Code génétique dégénéré
Un même acide aminé peut être codé par plusieurs codons. Dans beaucoup de cas,
les triplets nucléotidiques codant pour un même acide aminé ne diffèrent que par
la troisième base.
4- Code génétique non chevauchant
La partie exprimée en protéine d’un ADN est transcrite en ARNm, puis traduite
triplet pat triplet selon un ordre bien précis. Les triplets nucléotidiques sont lus
d’un point de départ jusqu’à un point de terminaison et ceci sans chevauchement.
a- Notion de cadre de lecture (RF)
Considérons l’exemple suivant :
1 2 3 4 5 6 7 8 9
ACG ACG ACG ACG ACG ACG ACG ACG ACG
* Première façon de lecture : ACG ACG ………………. ACG (9)
* Deuxième façon de lecture : CGA CGA ……………… CGA (8)
* Troisième façon de lecture : GAC GAC ……………… GAC (8)
Il y a donc trois cas de lecture possibles pour cet exemple.
b- Cadre ouvert de lecture (ORF)
C’est un cadre de lecture fait exclusivement de triplets représentant les acides
aminés.
c- Séquences traduites en protéines
C’est un cadre portant un codon d’initiation généralement AUG (méthionine) et
un codon de terminaison.
d- Cadre de lecture bloqué
C’est un cadre qui ne peut être lu et traduit en protéine car riche en codons stop.
C- Les adaptateurs de synthèse protéique
Il s’agit des aminoacyl- tRNA qui jouent un rôle important dans la traduction.
1- Synthèse des aminoacyl – ARNt
Cette synthèse se fait en deux étapes en présence de l’ATP et de l’aminoacyl –
synthétase.
E1 : acides aminés + ATP aminoacyl – AMP + 2Pi
E2 : aminoacyl – AMP + ARNt aminoacyl – ARNt + AMP
2- Fonction d’édition des aminoacyl – synthétase
activation
Aminoacyl – synthétase
Cet enzyme reconnaît d’une part les bons acides aminés et d’autre part les tRNA
correspondant. Il intervient donc dans les deux réactions précédentes et peut jouer
le rôle de correcteur dans le cas de 02 acides aminés à structure proche.
II – Traduction
A- Localisation et éléments nécessaires
La traduction s’effectue dans le cytoplasme au niveau des ribosomes et en
présence d’autres éléments nécessaires pour la synthèse de la chaîne
polypeptidique. Ces éléments sont les acides aminés, l’ARNm, l’ARNt, les
aminoacyl – tRNA – synthétase, les peptidyl – synthétases.
*ARNm : Il est porteur du message de l’ADN et indique par un codage
nucléotidique, l’ordre des acides aminés dans la future chaîne polypeptidique.
* ARNt : ce sont des adaptateurs entre les ARNm et les acides aminés. Ils
transportent les acides aminés par leur extrémité 3’-OH et possèdent l’anticodon
permettant de reconnaître les codons correspondants sur l’ARNm.
B- Différentes étapes de la traduction
Il y a trois étapes : Initiation, Elongation et Terminaison.
Notons que la synthèse protéique se déroule de l’extrémité N- terminale à
l’extrémité C- terminale du polypeptide en synthèse.
Les ribosomes lisent l’ARNm dans le sens 5’-3’. La synthèse se déroule avec des
polysomes. Chaque ribosome réalise sa propre synthèse protéique en décodant
l’ARNm. Chaque ARNm peut être décodé par plusieurs ribosomes à la fois.
1- Initiation
L’ARNm porte le codon initiateur en 5’-P, généralement le codon AUG codant
pour la méthionine. Toutes les chaînes polypeptidiques commencent alors par la
méthionine. Ainsi chez les procaryotes comme chez les eucaryotes, l’initiation
nécessite la reconnaissance du codon AUG et la présence de ribosome.
Au début de l’initiation de la traduction, les deux sous – unités du ribosome se
dissocient, puis la petite sous – unité forme au niveau du codon initiateur, un
complexe avec l’ARNm et l’ARNt portant la formyl –méthionine (procaryote) ou
la méthionine (eucaryote).
Fig. rechercher dans la bibliographie.
La grande sous – unité viendra par la suite s’ajouter à cet ensemble. Les ribosomes
possèdent deux sites de fixation des ARNt :
- Un site A où se fixe l’ARNt porteur des acides aminés.
- Un site P pour l’ARNt porteur de la chaîne peptidique en cours
d’élongation.
Fig. rechercher dans la bibliographie.
2- Elongation
Elle comprend trois étapes permettant d’accrocher les acides aminés les uns aux
autres par des liaisons peptidiques grâce aux peptidyl – synthétases.
• Etape1 : Accrochage d’un aminoacyl – tRNA
Un deuxième aminoacyl – tRNA vient se fixer sur le site A, le codon situé après
le codon initiateur détermine l’anticodon qui va se fixer, c'est-à-dire l’aminoacyl
– tRNA.
ARNm 5’ 3’
• Etape 2 : Formation des liaisons peptidiques
Elle commence par la rupture de la liaison entre la méthionine et le premier ARNt.
Ce dernier est éjecté du ribosome, puis il y a formation d’une liaison peptidique
grâce à une peptidyl – transférase, entre le groupement carboxylique de l’acide
aminé N°1 (méthionine) et le groupement amine de l’acide aminé N°2.
ARNm 5’ 3’
A la fin de cette phase, on a la formation d’un dipeptide est logé dans le site A, le
site P est alors libre.
5’ 3’
• Etape3 : Translocation
Le ribosome se déplace d’un cran sur l’ARNm dans le sens 5’-3’ d’une distance
de 03 paires de base. Ceci correspond à un déplacement de trois nucléotides. Un
nouveau codon (codon 3) est placé en face du site A des acides aminés ; et le
mécanisme recommence.
La répétition de ce mécanisme, allonge la chaîne peptidique et conduit à l’étape
de terminaison.
5’ 3’
3- Terminaison
La traduction est terminée quand le ribosome se déplaçant, se trouve en présence
d’un des trois codons stop sur l’ARNm. Ces trois codons ne codant pour aucun
acide aminé, il n’y a donc pas d’ARNt correspondant. Il se produit une rupture
entre le dernier ARNt et le dernier acide aminé de la chaîne polypeptidique. Puis
une molécule d’eau viendra former avec l’extrémité C terminal, le COOH de la
nouvelle protéine.
5’ 3’
C – Intervention des facteurs de régulation
La synthèse peptidique fait intervenir des facteurs protéiques essentiels pour le
déroulement correct des étapes.
Au niveau de l’initiation on a les facteurs d’initiation appelés IF (Initiation
Factors) pour les procaryotes ou eIF pour les eucaryotes.
Au niveau de l’élongation on a les EF (Elongation Factors) pour les procaryotes
et les eEF pour les eucaryotes.
Au niveau de la terminaison on a les RF pour les procaryotes et les eRF pour les
eucaryotes.
Notons l’existence des ARNt dits suppresseurs capables en cas d’erreurs, de
supprimer les effets de certaines mutations. Ces tRNA sont aussi capables de
supprimer des codons stop apparus prématurément et susceptibles d’arrêter la
traduction et permettent ainsi d’éviter la synthèse de protéines raccourcies.
OUTILS ENZYMATIQUES DE LA BIOLOGIE MOLECULAIRE
LES ENZYMES DE RESTRICTION
1-GENERALITE
La révolution technologique du début des années 70 a été fortement marquée par
la notion et l’utilisation des enzymes de restriction. Cette utilisation a ouvert la
voie à une exploitation technologique du matériel génétique (clonage,
séquençage…). On assiste dès lors à une évolution importante du concept de gène
et de la notion de polymorphisme. C’est en fait le début de l’ère des
biotechnologies avec l’usage sous forme purifiée de courtes séquences
nucléotidiques directement analysables, rendu possible grâce à la caractérisation
d’endonucléases sites-spécifiques nommées enzymes de restriction ou
endonucléases de restrictions ou ciseaux moléculaires.
Ces enzymes de restriction sont en fait, des outils utilisés au laboratoire pour
cliver les ADN. La coupure se fait en un site particulier reconnu spécifiquement
par un enzyme et appelé site de restriction. Très nombreuses, ses enzymes sont
capables de cliver les liaisons phosphodiesters entre deux nucléotides à l’intérieur
d’un acide nucléique.
Examples: Eco RI, Sma I.
.2- Séquences d’ADN Reconnues par les Enzymes de Restriction
Les séquences reconnues par les Enzymes de restriction sont souvent des
séquences dites palindromique. Ce sont des séquences où la succession des
nucléoniques lus dans le sens 5’ – 3’ pour le premier brin est identique à la
séquence lue dans le sens droite-gauche pour le second brin.
Exemple :
5’CCGG3’
3’GGCC5’
.
3- Fréquence théorique des sites de restriction
Les séquences palindromiques son généralement constitué de 4 à 6 paires de bases
et sont rencontrées dans l’ADN avec une fréquence donnée. En général, la
fréquence de coupure d’un ADN par un enzyme de restriction, peut être estimée
statistiquement en considérant le nombre de nucléotide de la séquence spécifique
reconnue par cet enzyme et/ou la fraction GC du DNA.
Ainsi, en ne considérant que le site de restriction :
F = 1/4n
; avec n, le nombre de nucléotide de la séquence spécifique
Exemple : la séquence GATC reconnue par l’enzyme de restriction Mbo I est
présente avec une fréquence statistique de 1/44
soit 1/256.
En prenant en considération le nombre de nucléotides de la séquence spécifique
reconnue par cet enzyme et la fraction GC du DNA, on estime que la probabilité
P de rencontrer un site est :
P= p² (1-p)²/2n
P: fraction GC
1-p : Fraction AT
n: le nombre de nucléonique de séquence spécifique
L’inverse de cette probabilité représente la distance moyenne entre 2 sites pour
cette enzyme dans cet ADN
Exo : On considère un DNA contenant 40% de GC et 2 ER Sau3AI (GATC) et
BamHI (GGATCC).
1- Calculer la probabilité de rencontre chaque site sur ce DNA
2- Déterminer la distance moyenne entre 2 sites de chacune des ER.
La distance moyenne entre les sites prédit comment est centrée la distribution des
tailles réelles des fragments. En réalité l’analyse est purement probabilistique car
la distribution des bases n’est pas toujours régulière ; de plus pour des raisons de
mutation et réparation, certaines séquences ne sont pas présentes aussi
fréquemment qu’il est prédit par les analyses statistiques.
4.- Origine des Enzymes de Restriction
Les enzymes des restrictions sont extraites de microorganismes en particulier des
bactéries, et le plus souvent des bactéries parasitées par des virus à ADN. Une
souche peut porter jusqu’à une dizaine de ER. Ces enzymes servent à cliver les
ADN étrangers comme ceux des virus en reconnaissant de courtes séquences de
nucléotides qu’elle hydrolyse en présence de Mg2+
.
5 – Nomenclature des Enzymes de Restriction
Le nom d’un enzyme de restriction comporte des lettres et est lié à la bactérie
sources.
- La première lettre est écrite en majuscule et correspond au genre de la bactérie
source.
- La seconde et la troisième lettre écrites en minuscules, correspondent à l’espèce
de la bactérie source.
- Une probable quatrième lettre écrite en majuscules, est en rapport avec la souche
bactérienne.
- Un chiffre romain vient indiquer l’ordre de caractérisation de l’enzyme de
restriction.
Exemples : voir tableau
.
6- Types de coupures réalisées par les enzymes de restriction
Les enzymes de restriction coupent l’ADN autant de fois qu’il y a de sites de
restriction leur correspondant. L’ADN est donc découpé en fragments de taille
variable. D’où l’importance de ce type d’outil enzymatique dans les techniques
biologiques.
Les enzymes de restriction peuvent donner deux types de coupure selon la forme
des bouts obtenus :
- Coupure à bout franc : coupure en milieu de la séquence palindromique.
- Coupure à bout collant ou à extrémité adhésive qui se fait de part et d’autre
d’un centre de symétrie imaginaire.
On peut considérer ici les exemples de HaeIII, et de EcroRI
Exemple 1 : Coupure de l'ADN double brin par HaeIII, générant des extrémités
franches.
Hea III est une enzyme de restriction produite par Haemophilus aegypticus. Le
site de liaison à l’ADN est formé de quatre paires de nucléotides 3’CC/GG 5’
Lorsque l’hydrolyse des liaisons phosphodiesters se fait au centre de symétrie du
palindrome, toutes les paires de nucléotides restent appariées : les fragments qui
en résultent sont dits « à bouts frances.
Exemple 2 : Coupure de l'ADN double brin par EcoRI, générant des extrémités
cohésives.
EcoR I est une enzyme de restriction produite par Escherichia coli, souche R.
Le site de liaison à l’ADN est formé de six paires de nucléotides 5’G/AATTC 3’
Lorsque l’hydrolyse des liaisons phosphodiesters se fait loin du centre de symétrie
du palindrome, certaines paires de nucléotides restent non appariées. Les
fragments qui en résultent sont dits « à bouts collants ou à extrémités cohésives».
7 – Classes des Enzymes de Restriction
Les enzymes de restriction sont groupés en trois classes (I, II, III) selon la position
du site de coupure par rapport au site de reconnaissance.
7.1 – Enzymes de type I
Ils coupent non pas au niveau de la séquence de reconnaissance, mais 1000 à 5000
pb plus loin.
7.2 Enzymes de type II
Ils sont caractérisés par un site de reconnaissance identique ou proche du site de
coupure. Ce groupe est le plus utilisé au laboratoire à cause des propriétés
suivantes :
- L’attaque endonucléolytique a lieu dans la séquence reconnue ou à une distance
proche du site (moins de 25 pb)
- Les fonctions d’endonucléase et de méthylation sont dissociables car portées par
des protéines distinctes ; on peut purifier et utiliser les deux enzymes
indépendamment.
- Les extrémités générées peuvent être cohésives ou franches; la coupure laisse
une extrémité 3’OH et une extrémité 5’P ; extrémités qui sont des substrats de
ligases. Cette dernière propriété est intéressante pour la manipulation des gènes.
Exple : EcoRI, HaeIII,…..
7.3- Enzymes de type III
Leur site de reconnaissance est séparé du site de coupure par une vingtaine de
nucléotides au moins.
.8- Inactivation des Enzymes de restriction et Méthylation
L’ADN bactérien présente des sites de restriction repérables par les enzymes de
restriction que possède la bactérie. Pour éviter une autodestruction, la bactérie fait
intervenir ses enzymes de restriction que possède la bactérie. Pour éviter une
autodestruction, la bactérie fait intervenir ses enzymes de modification de l’ADN
qui sont souvent des méthylases. Ces enzymes reconnaissent le même site que
l’ER et lient de façon covalente un groupement méthyle aux résidus adénine et
guanine de la séquence cible. Cette méthylation peut se réaliser sur une ou
plusieurs bases appartenant à un site de restriction. Ce qui entraine l’inactivation
du site.
La méthylation ne modifie pas les propriétés d’appariement des bases, mais fait
saillit dans l’un des sillons de l’hélice, empêchant ainsi l’ER de s’associer à
l’ADN; le chromosome devient alors résistant. On parle de systèmes de
Restriction/modification(RM).
Exemple de EcoR I
Fig.: Systèmes de restriction et de méthylation.
Considérons par exemple l’enzyme de restriction Hind III reconnaissant la
séquence spécifique palindromique suivante :
5’AAGCTT 3’
3’TTCGAA 5’
La méthylation de l’adénine ou de cytosines aboutit à une absence de
reconnaissance de ce site (A/AGCTT) spécifique par Hind III et donc à une
absence de coupure enzymatique.
L’ADN, d’une bactérie ainsi méthylé, n’est pas hydrolysé alors que l’ADN
parasite qui n’est pas méthylé sera hydrolysé.
Exo : décrire les résultats de l’action de Hind III avant et après la méthylation.
.9 – Utilisations des Enzymes de Restriction
Les utilisations des enzymes de restriction sont très nombreuses en biologie
moléculaire, en génie génétique, en biotechnologie etc. ………. On peut citer
quelques exemples
- Electrophorèse
Les enzymes de restriction permettent la fragmentation de l’ADN pour séparation.
Fig.: Gel d'agarose des produits de digestion d'un fragment de 5kb par deux
enzymes de restriction.
La figure au-dessous montre la digestion d'un fragment d'ADN de 5 kb par deux
enzymes de restriction (BamHI et EcoRI).
- Utilisation des ER de restriction pour établir la mappe de restriction
Fig. 7: Les différentes possibilités de localisation des sites de restriction des deux
enzymes (EcoRI, et BamHI).
-Insertion et transfert de gènes
Préparation des fragments d’ADN d’un gène destiné à être inséré dans vecteur
pour un transfert
-Recherche de mutation dans un génome
-Recherche des méthylations de bases dans l’ADN
Elle concerne des cellules eucaryotes. En effet, ces méthylations provoquent
parfois le verrouillage de l’expression des gènes dans un tissu. Les méthylations
concernent généralement les cytosines impliquées dans les doublets
nucléotidiques CG.
En pratique, la recherche de ces doublets et de la présence ou non d’une
méthylation sur les cytosines est réalisée à l’aide de deux enzymes de restriction,
une insensible et l’autre sensible à cette méthylation. Exemple de Msp I insensible
et de Hpa II sensible.
Des notions sont à retenir pour maitriser l’utilisation des enzymes de restriction
notamment la notion d’enzymes compatibles et la notion d’isoschizomère .
.9.1-Notion d’enzymes compatibles
C’est une notion importante dans l’utilisation des enzymes de restriction. Deux
enzymes sont dites compatibles si elles génèrent, après digestion, des fractions
aux extrémités cohésives complémentaires. Ces fragments peuvent être
facilement ligaturés.
Exemple 1 : BamH I et BgtII (fig)
*Exemple 2 : Bam HI (G/GATCC) et Mbo I (/GATC
Considérons les fragments suivant reconnus et digérés respectivement par Bam
HI et Mbo I.
Action de Bam HI
5’ GGATCC 3’ 5’ G 3’ + 5’ GATC 3’
3’ CCTAGG 3’ 3’ CCTAG 5’ 3’ G 5’
Action de Mbo I
5’ AGATCAGC 3’ 5’ A 3’ + 5’ GATCAGC 3’
3’ TCTAGTCG 5’ 3’ TCTAG 5’ 3’ TCG 5’
Exo : Quels sont les fragments à bouts cohésifs ?
.9.2 – Les Isoschiromère
Ce sont des enzymes de restriction qui reconnaissent la même séquence
nucléotidique, mais les fragments obtenus après leur action, ont des extrémités
différentes.
*Quelques exemples
- les enzymes de restriction Kpn I (GGTAC/C ) et Acc 65 I (G/GTACC) agissent
sur la séquence GGTACC.
Exo : Décrire les résultats obtenus. Conclure.
-Les enzymes Msp I (C/CGG) et Hpa II (CC/GG) reconnaissent et agissent sur la
séquence CCGG.
Exo : Décrire les résultats obtenus. Conclure.-
Notons que Msp I est insensible à la méthylation et permet donc d’étudier les
séquences CG dans un génome ; alors que Hpa II qui est son isoschizomère est
sensible à la méthylation des cytosines.
9.3 – Polymorphisme de restriction
C’est la variation individuelle d’une séquence de DNA par des modifications de
longueur de fragment de restriction. Ainsi, suite à l’électrophorèse, on observe un
polymorphisme de longueur des fragments de restriction connu sous l’abréviation
R F L P (Restriction Fragment Length Polymophism).
Le profil électrophorétique obtenu avec une enzyme de restriction donnée montre
des différences individuelles dans la taille des fragments de restriction.
Exemple chez l’homme : polymorphisme Msp I et gène de l’apoA-II
Il existe un polymorphisme dans le gène de l’apolipoprotéine A-II. Lorsqu’on
digère le DNA (gène apo AII) génomique de plusieurs individus choisis au hasard,
on obtient des fragments de tailles différentes entre chaque point de coupure par
l’enzyme.
La plupart des sujets (81%) qui possèdent trois sites de coupure autour du gène
donnent un fragment de 3000 paires de nucléotides (3,0kb).
D’autres sujets, plus rares (19%) qui ne possèdent pas le site de restriction ont un
fragment plus grand = 3700 paires de nucléotides (3,7kb).
9.4. Cartes de restriction
Une carte de restriction est une représentation situant les positions des ER ou
marqueurs génétiques.
Les ER peuvent caractériser les DNA responsables des maladies héréditaires
grâce aux cartes de restriction. La DNA du malade est digéré par de nombreuses
enzymes de restriction isolément ou associées entre elles. Les fragments de
restriction sont reconnus par une sonde spécifique du gène responsable de la
maladie. Il en résulte un grand nombre de fragments possibles dont les longueurs
(en kilobases) sont mesurées par électrophorèse à côté d’un marquer de masse
moléculaire.
Par exemple, les DNA d’un malade atteint d’une dysliproptoteinémie et celui d’un
témoin sain digérés par BamH I : le sujet sain montre un seul fragment long de
11,65 kb reconnaissable par la sonde du gène de l’apoA-I, alors que le DNA du
malade en montre deux de 7,5 et 10, 25 kb.
LES TECHNIQUES DE BASE DE LA BIOLOGIE MOLECULAIRE
INTRODUCTION
Le dernier des connaissances en biologie, la biologie moléculaire a favorisé un
progrès rapide de diverses techniques appliquées. Il existe maintenant de
nombreuses techniques propres à la biologie moléculaire. Certaines sont plutôt
pratiquées dans les laboratoires de recherche, d’autres sont non seulement
utilisées au laboratoire, mais aussi dans les centres de contrôle et de
biosurveillance des aliments et de l’environnent, dans les services sanitaires et
même judiciaire.
Des terminologies appropriées sont apparues avec les techniques biologiques et
doivent être maîtrisées par le bio - ingénieur. En général, l'étude des processus liés
à l’ADN nécessite un grand nombre de techniques expérimentales. Cela consiste à
utiliser des méthodes pour l'extraction, la purification, la séparation, restriction,
l'amplification, le séquençage etc…, des acides nucléiques.
* QUELQUES TERMINOLOGIES
- NOTION D’ADN RECOMBINANT
C’est un ADN hybride obtenu au laboratoire par combinaison de deux ADN
appartenant à deux espèces différentes.
- NOTION D’ADN VECTEUR
C’est l’ADN dans lequel on insère un fragment d’ADN à étudier ou à transférer.
Le fragment inséré est appelé « insert » ou ADN étranger ou ADN exogène. Cette
séquence nucléotidique est capable de s’auto-répliquer.
- NOTION DE CLONE
Un clone correspond à un grand nombre de molécules ou de de cellules identiques
provenant d’un seul ancêtre. L’opération qui consiste à obtenir ce grand nombre
s’appelle « clonage ».
- NOTION DE SONDE NUCLEOTIDIQUE
Une sonde nucléotidique est un segment de nucléotide qui permet de rechercher
de manière spécifique, un autre fragment d’acide nucléique que l’on désire
étudier. La réaction sonde – fragment recherché correspond à une hybridation.
- NOTION D’HYBRIDATION MOLECULAIRE
Après séparation des deux brins d’un ADN par fusion, si la solution d’ADN est
refroidie lentement et dans les conditions et milieux favorables, une réassociation
des brins est progressivement observée : c’est le phénomène d’hybridation
moléculaire. Cette réassociation peut concerner 2 séquences d’ADN d’une même
espèce ou d’espèces différentes ou encore une séquence d’ADN complémentaire.
Elle est donc d’une spécificité très grande.
- NOTION D’ADN COMPLEMENTAIRE (ADNc)
C’est l’ADN fabriqué comme copie d’un ARNm et qui de fait est dépourvu
d’introns.
- NOTION D’ADN GENOMIQUE
C’est l’ADN normal qui constitue le génome d’une cellule ou d’un organisme.
EXTRATION – PURIFICATION ET MIGRATION
ELECTROPHORETIQUE
I - EXTRACTION ET PURIFICATION DE l’ADN
1 Extraction et purification du DNA
*Définition et principe
Toute étude de biologie et génétique moléculaire implique la disposition
d'échantillon d'acides nucléiques. Les techniques d'extraction d'acides nucléiques
sont relativement simples. Il convient simplement d'éviter toute destruction
enzymatique ou mécanique. En effet les acides nucléiques qui sont stables dans la
cellule intacte, deviennent très vulnérables à la digestion par les nucléases
endogènes une fois la cellule lysée.
1 - EXTRACTION A PARTIR DU MATERIEL BIOLOGIQUE
Les méthodes d’extraction utilisent parfois les enzymes. Chaque fois que l’on a
été amené à traiter un acide nucléique par un enzyme, il est nécessaire de procéder
à une purification pour éliminer ces enzymes avant de passer à d’autres étapes de
travail. L’ADN doit impérativement être purifié à partir de matériels biologiques
propres et dans des conditions optimales de qualité au laboratoire.
Dans la pratique, les acides nucléiques peuvent être extraits du sang total, des
cheveux, des tissus broyés entre autres. Le procédé classique est l’extraction par
le couple phénol - chloroforme.
Le phénol est un excellant agent dénaturant des protéines. Il permet ainsi de
séparer les protéines et les acides nucléiques. Le phénol est ensuite éliminé par
extraction avec du chloroforme non miscible à l’eau. Il se forme alors deux
phases :
- une phase aqueuse contenant les acides nucléiques et les protéines
résiduelles;
- une phase organique contenant le chloroforme et phénol.
Les deux phases peuvent être séparées par la méthode de centrifugation. La phase
aqueuse contenant les acides nucléiques est recueillie puis traitée si nécessaire par
des protéolyses ou agents clivant les protéines. Ce traitement permet d’éliminer
les traces de protéines restantes. Les acides nucléiques sont finalement récupérés
sous forme solide à la suite de leur précipitation en présence d’alcool éthylique
ou isopropylique.
Actuellement, de nombreuses substances réactives permettant de faciliter les
opérations de purification sont disponibles. Il est ainsi possible d’extraire les
acides nucléiques à partir de plusieurs échantillons biologiques comme les
cultures cellulaires, les tissus animaux ou végétaux etc.…
*Méthode pratique : exemple de sang (Fig)
Fig. 1 : Extraction/Purification de DNA
Aussi les méthodes d’extraction au laboratoire doivent être adaptées au type de
tissus et au matériel disponible. Notons que lorsque les acides nucléiques viennent
des extraits cellulaires, les protéines sont au préalable hydrolysées par les
enzymes protéolytiques comme la protéinase k.
2. - ESTIMATION DE LA QUALITE ET DE LA QUANTITE DE L’ADN
a. - VERIFICATION DE LA PURETE DE L’ADN.
Elle se fait grâce au spectrophotomètre Une lecture de la densité optique (Do) en
U.V permet de vérifier la pureté du DNA obtenu. En général quand la pureté est
nette, un pic à 260 nm doit être observé. Par ailleurs, le rapport
RDO = Do(260nm) / Do(280mn)
doit normalement être égal à 1,8.
- Si RDO > 1,8 -→ contamination par des RNA
- Si RDO < 1,8 -----→ contamination par les protéines ou par du phénol.
b - ESTIMATION DE LA QUANTITE DU DNA
Cette étape est indispensable, après extraction de l’ADN à partir du matériel
biologique. Deux méthodes peuvent être utilisées :
* La spectrophotométrie
L’estimation quantitative de l’ADN peut se faire par spectrophotométrie dans
l’U.V à 260 mn. C’est la longueur d’onde correspondant à l’absorption maximale
du DNA.
Cette absorption se définit par unité de Do mesurée toujours à 260 mn (UDo)
1 UDO correspond à l’absorption d’une solution de DNA double brins à la
concentration de 50 microgr / ml ou à l’absorption d’une solution de DNA simple
brin (RNA) à la concentration de 25 microgr / ml.
* Méthode en minigel.
Elle est utilisée lorsque l’on ne dispose pas de DNA en quantité suffisante pour
mesurer la densité optique en UV.
Le principe consiste à comparer l’intensité de la tâche en UV de l’échantillon
étudié à celle donnée dans les mêmes conditions par un DNA standard déposé en
quantité connue.
II - TECHNIQUE DE SEPARATION ELECTROPHORETIQUE
C'est une technique de bioséparation permettant la séparation des biomolécules
selon leur charge et leur taille (ADN, ARN, protéines).
1 - Principe
L’ADN est soumis à un champ électrique dans une cuve électrophorétique. Cette
technique permet non seulement de séparer les fragments d’ADN mais aussi de
déterminer leurs tailles et leur poids moléculaire (PM).
Après purification, les ADN peuvent être digérés par des enzymes de restriction.
On obtient ainsi des fragments de DNA de tailles et de PM différents qui
permettent d’étudier les caractéristiques de l’ADN (PM, nature des bases…).
Il est fréquent au laboratoire d’avoir à séparer ces fragments de DNA par
électrophorèse. En effet, à pH neutre, le DNA est chargé négativement. Ainsi
encadré par l’anode et la cathode de la cuve électrophorétique, il migre vers
l’anode avec une vitesse de migration des fragments inversement proportionnelle
au logarithme de la taille.
2 - SUPPORTS ELECTROPHORETIQUES
a - Gel de polyacrylamide
Il est utilisé pour séparer des petits fragments de DNA de taille inférieure à 500
paires de bases. On prépare généralement des gels à 15% pour les DNA de 25 à
150 nucléotides, ou des gels à 5% pour les DNA de
80 à 500 nucléotides.
La migration est effectuée souvent en position verticale.
b - Gel d’agarose
Il sert plus spécifiquement à séparer des fragments de tailles comprises entre 0,2
– 80 kilobases. C’est un gel à 1,5% pour les DNA de 0,2 – 5kb ; à 0,9% pour les
DNA de 5-7 kb et inférieur à 0,9% pour les DNA de plus grande taille.
La migration est effectuée en position verticale.
c - Champ pulsé
Pour de très gros fragments de DNA de taille allant jusqu’à 104
kb, on utilise
souvent l’électrophorèse en champ pulsé pour la séparation.
3- ESTIMATION
Dans toutes les électrophorèses, des marqueurs de PM de DNA sont déposés et
migrent parallèlement au DNA à étudier. Le DNA est repéré par fluorescence aux
U.V après avoir été mis au contact avec le bromure d’éthidium (BET).
En comparant l’emplacement du DNA échantillon avec celui du DNA marqueur,
le PM et/ou la taille du DNA étudié peut être estimée.
Exemple de figure d’électrophorèse du DNA (gel et filme)
Fig.: Distance de migration en fonction du logarithme de la taille des fragments
d’ADN.
*Cas spécifique du gel d’agarose
Dans ce cas, les fragments vont migrer selon leur taille plus que selon leur charge.
Plus le fragment à une taille élevée, moins la migration électrophorétique, par
rapport au puit d’inclusion, sera importante.
La détermination précise des fragments séparés par électrophorèse est effectuée
en faisant migrer des marqueurs de taille et PM connus, en parallèle avec des
échantillons à analyser. La détection des fragments d’ADN sur ce type de gel est
réalisée par exposition aux rayons UV, après réaction avec un réactif spécifique
comme le BET par exemple. Le BET est un agent qui s’intercale entre les brins
d’ADN.
cDNA, HYBRIDATION ET SONDE
1. Le cDNA
*Définition et principe
Un cDNA est un DNA obtenue à partir d’un ARN.
La manipulation et l’étude des RNA est difficile à cause de leur grande
sensibilité aux ribonucléases qui les détruisent. Il est alors nécessaire de recopier
la séquence en DNA pour qu’elle soit plus stable et qu’on puisse l’amplifier en
fonction des besoins.
*Méthode pratique d’obtention du cDNA
Fig. : Synthèse de cDNA
Le mRNA purifié (chromatographie d’affinité sur une colonne d’oligo-d(T)) est
lié dans un premier temps avec des oligonucléotides poly(T) qui s’attachent à la
queue poly(A).
A partir de l’extrémité 3’ de cette amorce poly(T) la transcriptase réverse, qui
est une DNA polymérase, synthétise un brin de DNA complémentaire du
messager de départ.
Une fois cette synthèse achevée, on dégrade le RNA par une base forte ou par
une ribonucléase spécifique.
Le brin de DNA fabriqué, forme spontanément à son extrémité 3’ une boucle en
épingle à cheveux en s’hybridant sur lui-même.
L’extrémité 3’ de cette boucle va servir de site de démarrage pour la DNA
polymérase qui va synthétiser un brin de DNA complémentaire du premier.
Une nucléase spécifique du DNA simple brin supprimera la boucle de
l’extrémité. Le cDNA double brin est prêt.
On peut ainsi constituer autant de cDNA qu’il existe de messagers dans une
cellule : l’ensemble de ces cDNA forme une « banque de cDNA »
2. Les sondes et l’hybridation
-*Hybridation des acides nucléiques
L'hybridation est une propriété fondamentale des acides nucléiques qui repose
sur les règles de complémentarité. Il est possible d'apparier des brins d'ADN ou
ARN avec des oligonucléotides qui reconnaissent spécifiquement des séquences
sur les brins d'ADN de manière antiparallèle et complémentaire. Ces
oligonucléotides sont appelés sondes nucléiques
(fig. 5). Dans le cas de deux brins complémentaires de la même molécule
d'ADN (brins homologues), on parle de renaturation (hybridation à 100%).
Fig.5: Hybridation des acides nucléiques
*Hybridation et température d’hybridation
Chaque 1% de non homologie diminue la température d'hybridation (Th) de
1°C.
L'hybridation moléculaire est ainsi utilisée surtout dans la détection de
l'homologie entre les molécules d'ADN de sources différentes. La
complémentarité dépendra de la spécificité et de la sensibilité.
-Mécanisme d’hybridation
Un fragment de DNA double brin affecte normalement une structure secondaire
en double hélice.
En élevant la température jusqu’à la Tm, on disjoint 50% environ des liaisons
hydrogène qui unissent les brins de DNA, ce qui dénature partiellement la double
hélice.
Lorsque la température atteint 95°C, toutes les liaisons hydrogène sont rompues
et la dénaturation du DNA est complète. Le DNA simple brin obtenue, est qualifié
de « dénaturé ». Au cours de cette dénaturation, le coefficient d’extinction du
DNA à 260 nm augmente (hyperchromicité)
En refroidissant brutalement (glace) les structures secondaires ne se reforment pas
et le DNA reste dénaturé. Si on refroidit doucement, la double hélice se reforme
progressivement. Un oligonucléotide (soude) ajouté à ce moment peut s’hybrider
avec un fragment complémentaire du DNA, dès que la température descend en-
dessous de la Tm.
L’hybridation d’une sonde marquée (atomes radioactifs, radicaux fluorescents ou
ligands spécifiques) sur un DNA dénaturé permet de marquer spécifiquement tous
les fragments de ce DNA dont la séquence est complètement de la soude.
- Méthode de calcul de la Tm
Il est possible de mesurer directement la température de fusion (Tm) d’un DNA
double brin en mesurant l’augmentation de l’absorbance de la solution à 260 nm
en fonction de la température.
Toutefois, on se contente, la plupart du temps, d’une estimation à partir de la
composition de l’oligonucléotide. Si celui-ci a une longueur égale ou inférieur à
20 nt on compte 2°C par couple A : T et 4°C par couple G :C. A partir de N = 20,
on corrige d’un multiplicateur proportionnel à la longueur au-delà de ce chiffre :
1 + [(N-20)/20]
Lorsqu’il existe des mésappariements, il faut soustraire de la Tm calculée, autant
de degrés C que le pourcentage de séquence non-appariée de l’oligonucléotide.
- Sonde hybridée
Fig.5: Reaction d’hybridation
Pour pouvoir reconnaître spécifiquement une séquence du DNA, on utilise au
laboratoire un petit morceau de DNA synthétisé (sonde) dont la séquence
correspond au moins en partie à celle d’un des brins du DNA.
Parce qu’elle est complémentaire de l’autre brin du DNA, la sonde est capable de
se fixer spécifiquement sur l’autre brin à l’endroit où se lit la séquence
complémentaire,
En marquant cette sonde par un atome radioactif ou par une molécule fluorescente
liés covalentiellement à un des nucléotides de la sonde, on peut détecter la sonde et
le morceau de DNA complémentaire qui lui est hybridé.
TECHNIQUE D’AMPLIFICATION GENIQUE OU TECHNIQUE PCR.
I. DEFINITION ET PRINCIPE
1 - Définition
Cette technique dite « Polymerase Chain Reaction » c’est à dire réaction de
polymérisation en chaîne, décrite en 1985 permet d’augmenter et d’amplifier de
manière considérable, la quantité d’ADN dont on dispose initialement.
2 - Principe
Cette technique impose de connaître la séquence des régions qui délimitent le
segment d’ADN à amplifier. Connaissant chacune des deux séquences sur une
vingtaine ou une trentaine de nucléotides environs, on synthétisera des
oligonucléotides complémentaires. Ces oligonucléotides auront deux fonctions :
- ils permettent de repérer la partie du DNA à amplifier ;
- ils serviront d’amorce ou primer à la DNA polymérase qui sera introduite pour
les réactions de polymérisation.
Fig : Amplification du DNA
II - REALISATION PRATIQUE
A la différence d’un clonage bactérien, le PCR est caractérisé par une
amplification enzymatique in vitro.
1 - Cycles et phase de la PCR
La technique PCR comporte des cycles successifs et chaque cycle comprend une
succession de3 phases :
- une phase de dénaturation par la chaleur à la température comprise entre 92 et
95°C. Elle dure 30 secondes à 1 minute et permet de séparer les deux brins
d’ADN.
- une phase d’hybridation avec deux amorces spécifiques à la température de 55-
60°C. Une amorce va se fixer sur un brin, la seconde amorce sur le brin
complémentaire. Cette phase dure également 30 secondes à 1minute. Notons que
la fixation sur les brins est rendue possible grâce à l’abaissement de la température
de 95 à 55°C.
- une phase d’extension par l’ADN polymérase à partir des amorces à 70 -72°C
pendant 1 à 2 minutes.
A la fin de chaque cycle, le nombre de brin d’ADN est multiplié par deux.
L’amplification est donc exponentielle. En pratique, le rendement n’étant pas
souvent de 100%, 30 à 40 cycles sont nécessaires et permettent d’amplifier l’ADN
d’un facteur de 105
à 106
.
2. PCR ET POLYMERASES THERMOSTABLES
-Taq Polymérase.
La technique PCR connaît un grand essor depuis qu’il a été possible en 1988
d’utiliser une DNA polymérase non inactivée par la chaleur. Cette ADN
polymérase, appelée taq polymérase, est extraite d’une bactérie thermophile et
permet une automatisation des cycles. On peut ainsi effectuer un nouveau cycle
sans avoir à ajouter à chaque fois l’enzyme polymérase.
>Les différences entre l’ADN Taq Polymérase et l'ADN polymérase III.
-Pfu polymérase
L’ADN polymérase de l’hyper thermophile Pyrococcus furiosus (croissance
optimale à 100°C, la bactérie d’une source hydrothermale), appelée Pfu
polymérase est actuellement la meilleure polymérase thermostable pour la
correction des erreurs de réplication
(Fidélité élevée) grâce à son activité auto-correctrice. Cette enzyme est très
utilisée lorsqu’une haute précision est requise. De plus elle est plus stable que la
Taq polymérase.
3 - OPTIMISATION DES RESULTATS PCR
Les résultats peuvent être optimisés en fonction d’un certain nombre de
paramètres notamment :
- concentration en Mg2+
;
- concentration en amorces ;
- spécificité des amorces.
Le choix des amorces est particulièrement crucial pour obtenir des résultats
satisfaisants (paramètres physico – chimiques, taille, spécificités). Cependant
d’autres facteurs peuvent également perturber cette optimisation C’est le cas par
exemple de la contamination ou du pouvoir d’édition.
* Cas des contaminations
Il faut s’assurer de la spécificité des fragments à amplifier car il existe toujours un
risque d’amplifier des DNA non désirés.
Le fait de former le DNA amorce avec des séquences atteignant une vingtaine de
nucléotides devrait rendre négligeable la possibilité de retrouver ailleurs la même
séquence de nucléotides. Mais les conditions opératoires font que parfois, on peut
amplifier d’autres fragments.
* Fonction d’édition de la Taq polymérase
La taq polymérase présente une activité exonucléasique 5’ – 3’, mais elle est
dénuée d’activité exonucléasique 3’ – 5’, c'est-à-dire, de la f onction d’édition.
Elle peut alors insérer des bases qui ne suivent pas la règle d’appariement. On
estime qu’elle réalise une mauvaise incorporation tous les 105
bases environs.
III - PCR CLASSIQUE ET PCR EN TEMPS REEL (recherche personnelle,
différences ?)
IV- UTILISATION DES PRODUITS PCR.
Les utilisations des produits PCR sont très nombreuses actuellement. Ces produits
ont permis de développer plusieurs techniques.
1 - TECHNIQUE DU DOT –BLOT
Elle utilise les produits PCR et permet de mettre en évidence des mutations
ponctuelles au niveau d’un gène donné. Les produits PCR peuvent après
transformation en monobrins, être hybridés avec des sondes oligonucléotidiques
libres ou fixées sur un support solide.
Ces sondes correspondent à des séquences normales ou pathogènes pour un gène
donné.
Les résultats de l’hybridation permettent de confirmer ou d’infirmer la présence
de mutations qui peuvent être pathogène ou non.
Ces techniques peuvent permettre de détecter entre autres certaines anomalies
génétiques chez le fœtus.
1.1- ANALYSE DE RESTRICION ET DREPANOCYTOSE
* Principe
Les enzymes de restriction sont des endonucléases naturelles qui dégradent les
brins d’ADN à partir des sites bien précis dits sites de restriction. Le produit PCR
est soumis à une digestion enzymatique par une enzyme de restriction. Si une
mutation ponctuelle modifie le site de restriction initialement présent, la taille des
fragments d’ADN obtenus après digestion sera modifiée et décelable après
électrophorèse des fragments d’ADN.
* Exemple d’application : Gène responsable de la drépanocytose
La mutation ponctuelle de GAG en GTG qui arrive sur le 6eme
codon du 1er
exon
du gène b de la globine humaine, entraîne l’apparition des hémoglobines S (HbS).
Ces HbS sont caractérisées par le remplacement dans la chaîne des acides aminés,
de la Glu par la Val suite à la mutation. Cette mutation est responsable à l’état
homozygote, d’une pathologie grave très répandue dans le monde : la
drépanocytose.
L’anomalie modifie ainsi le site de restriction GAG de l’enzyme Dde I qui est C
/ TGAG.
* Description de la technique
La séquence suivante représente les 9 premiers codons humains du 1er
exon du
gène b de la globine humaine.
1 2 3 4 5 6 7 8 9
GTG CAC CTC ACT CCT GAG GAG AAG TCT
Avec l’enzyme de restriction Dde I, on aura après digestion, 2 fragments après
électrophorèse dans les conditions normales.
La mutation HbS conduit à une mutation ponctuelle au niveau du codon numéro
6. Elle entraîne alors la disparition du site de restriction de l’enzyme Dde I en
transformant GAG en GTG. L’action de Dde I devient alors nulle.
L’électrophorèse des produits PCR après digestion par Dde I permet de confirmer
ou d’infirmer la présence de mutation GAG / GTG sur le codon N° 6 par
comparaison des tailles des fragments.
On peut donc confirmer l’état homo ou hétérozygote pour cette mutation
responsable de la drépanocytose.
3 – TECHNIQUE PCR DANS L’ANALYSE DES ALIMENTS ET DE L’EAU
Avec les techniques traditionnelles d’analyse microbiologiques, il faudra
plusieurs jours voire semaines pour confirmer ou infirmer l’origine d’une toxi-
infection. Ainsi, depuis quelques années, la technique PCR dans certains
laboratoires d’analyse de l’eau et surtout des aliments permet d’obtenir des
résultats précis. En quelques heures, il est possible, grâce à la PCR, de déterminer
le type de microorganisme responsable d’une infection ou d’une intoxication par
absorption d’eau ou d’aliment.
4 - TECHNIQUE DGGE ET SSCP
Ce sont des techniques d’analyse électrophorétique des produits PCR qui sont
particulièrement utilisées pour mettre en évidence les mutations ponctuelles au
niveau d’un gène.
Des produits PCR particuliers appelés amplimères sont formés si des mutations
sont présentes sur l’ADN étudié (ou initial). Les produits PCR seront différents
en fonction de la présence d’une séquence normale ou d’une séquence mutée.
a - TECHNIQUE DGGE
La DGGE « Denaturation Gel Gradien Eletrophoresis » c’est à dire électrophorèse
de gel en présence d’un gradient d’agent dénaturant.
C’est une technique qui permet de mettre en évidence une mutation ponctuelle en
utilisant la température de fusion de l’ADN et un produit PCR. En effet la
température de fusion d’un produit PCR c’est à dire la température moyenne de
séparation des deux brins est fonction de sa séquence. Une mutation ponctuelle
qui change la séquence entraîne une modification de la température de fusion
Autrement dit, le changement de la température de fusion d’un produit PCR
(ADN) suggère une modification de séquence et probablement une mutation.
Cette mutation peut être ensuite directement mise en évidence par électrophorèse
sur gel de polyacrylamide en présence d’un gradient d’agent dénaturant.
b - TECHNIQUE SSCP
La SSCP « Single Strand Chain Polymorphism » c’est à dire polymorphisme en
chaîne d’un simple brin, est une technique basée sur l’analyse électrophorétique
des produits PCR sous forme de fragments simples brin.
Il s’agit d’amplifier par PCR une région d’un gène ou d’un ADN que l’on désire
étudier, puis de comparer la mobilité de l’ADN dénaturée portant une mutation
avec celle d’un fragment de référence comportant une séquence normale.
Une mutation ponctuelle au sein d’une séquence modifie suffisamment la
structure primaire de l’ADN monobrin pour qu’il en résulte des changements de
migration électrophorétique sur gel.
Actuellement, la technique de chromatographie en phase liquide à haute
performance (HLPC) peut concurrencer la DGGE et la SSCP.
V - Exemple d’application des techniques de BM dans la recherche de
l’agent causal de l’ulcère de Buruli dans le district endémique de Tsévié
L’ulcère de Buruli (UB) est une maladie grave de la peau, causée par une infection à
Mycobacterium ulcerans. Elle entraîne la présence de plaies sur la peau qui sont en général des
ulcères.
C’est une maladie probablement liée au milieu de vie. Donc il s’est agi de rechercher les
marqueurs génétiques de la bactérie chez les malades et les comparer avec ceux détecter dans
l’environnement (plantes, eau, sol, ...)
Ces dernières, les techniques de la BM, notamment le PCR et l’hybridation, ciblant la séquence
génomique IS2404 jugée très sensible et spécifique, sont devenues des techniques de choix.
Chez les patients suspectés d’ulcère de Buruli, l’utilisation de ces techniques permet de
confirmer la maladie par la détection de l’insertion IS2404 sspécifique du gène de M. ulcerans.
Recherche de M. ulcerans par la PCR chez les patients
La PCR réalisée est dite classique ou conventionnelle.
Echantillons biologiques utilisés
On effectue des prélèvements chez le patient par aspiration de liquide sur les lésions pré-
ulcéreuses ou par écouvillonnage à partir des ulcères.
Etapes
Trois étapes essentielles sont nécessaires :
- Extraction d’ADN
- Amplification de la région incluant IS2404
- Révélation par la technique d’électrophorèse sur gel d’agarose.
Extraction d'ADN.
L’ADN de l’échantillon est extrait en utilisant les réactifs suivants :
- La solution de Lyse des cellules (CLS)
- La solution d’hydratation de l’ADN
- La solution de précipitation des protéines
- La Lysozyme (10 mg/ml)
- La Protéinase K (20 mg/ml)
- Le Glycogen (20 mg/ml)
- L’Ethanol 70% (Applichem)
- Le 2-Propanol (Isopropanol)
Cette extraction se fait en 4 étapes.
La lyse cellulaire :
La lyse des cellules est effectuée avec une solution de lyse des cellules et des enzymes en
particulier la protéinase K (incubation à 55°C toute une nuit).
La déprotéinisation : par l’utilisation d’une solution précipitant les protéines suivi d’une
centrifugation. Ces protéines sont ainsi déposées au fond du tube sous forme de débris.
La purification de l’ADN
Il s’agit de précipiter l’ADN avec une solution d’isopropanol dans le surnageant obtenu après
l’élimination des protéines. L’ADN obtenu est ensuite lavé avec de l'éthanol 70%.
Conservation de l’ADN
Le culot d'ADN est séché et réhydraté dans une solution d'hydratation d'ADN. Il est conservé
entre 2 et 8°C ou à -20o
C en cas d’une longue durée de conservation avant l’amplification.
Amplification de l’ADN de M. ulcerans - IS2404.
Matériel utilisé
- Thermocycleur
- Bille PCR PuReady-Go-Taq
• dNTPs
• Mgcl2
• Taq polymerase
- Amorces MU5 et MU6
- Eau distillée purifiée (DNAse/RNAse free)
Séquences des amorces : Sens (MU5) : 5'agcgaccccagtggattggt 3'
Anti-sens (MU6) : 5'cggtgatcaagcgttcacga 3'
Préparation du mélange réactionnel ou Master Mix
Réactifs N = 1 (µl) N+2 (µl)
Billes Pure Ready Go-Taq 1 Bille
Eau 20
Amorce MU5 1,25
Amorce MU6 1,25
Total 22,5
ADN 2,5
Le programme d’amplification utilisé dans le thermocycleur est le suivant :
Tableau du programme d’amplification :
Température Temps Cycles
95°C 10 min 1
95°C
58°C
72 °C
10 sec
10 sec
30 sec
40
72°C 10 min 1
15°C --- Prise en main
Électrophorèse des produits PCR (amplicons) sur gel d’agarose
Matériel
- Poudre d’agarose
- Tampon TBE, 10x
- GelRedMD
- Loading dye Blue juice, 10x
- Marqueur de poids d’ADN, 100 bp (Invitrogène)
Principe : Les produits PCR (amplicons) ont été séparés par électrophorèse sur gel d’agarose
selon leurs poids moléculaires.
Préparation du gel : Un gel d'agarose à 1,5% a été préparé en dissolvant 1,5g d'agarose dans
100 ml de tampon TBE 1X. Le résultat est le suivant :
MP 1 11 12 3 13 4 14 5 15 6 16 7 17 8 18 CP CN MP
Légende
MP : Marqueur de poids
Echantillons positifs :
A (1-11) ; B (2-12)
Bandes d’échantillons : 1 ; 2
Bandes de contrôle d’inhibition :
11 ; 12
Echantillons négatifs :
C (4-14)
Bandes échantillons : 4
Bandes de contrôle inhibition : 14
CP : Contrôle positif
CN : Contrôle négatif
500 Pb
MP 1 11 2 12 3 13 4 14 5 15 6 16 7 17 8 18 MP
A B C
C
CP
CN
P
Figure A : Electrophorèse sur gel d’agarose des
produits d’amplification PCR pour la détection de
l’insertion IS2404
Recherche de M. ulcerans par la PCR dans l’environnement
Exo : décrire comment procéder.
Examen comparatif des marqueurs M. ulcerans
Conclusion
Ce travail a permis grâce à l’analyse moléculaire de confirmer la présence de M. ulcerans dans
l'environnement des districts de Zio et de Yoto de la région maritime au sud Togo.
MP 1 11 2 12 3 13 4 14 5 15 6 16 7 17
Légende
MP : Marqueur de poids
Echantillons inhibés :
D (3-13)
Absence de bande
d’échantillon : 3
Absence de bande de
contrôle d’inhibition : 13
500 Pb
D
TECHNIQUES DE SEQUENÇAGE DE L’ADN
Le séquençage d’un ADN consiste à identifier les différentes bases qui constituent
les chaînes de cet ADN. Deux techniques sont généralement utilisées :
- technique de SANGER
- technique chimique de MAXAM et GILBERT
I - TECHNIQUE DE SANGER
1 - Principe
Cette technique enzymatique dite encore séquençage au didesoxyribonucléotide
triphosphate (ddNTP) est la plus utilisée actuellement pour effectuer le
séquençage d’un fragment d’ADN.
C’est une technique basée sur la copie d’un fragment d’ADN monocaténaire que
l’on désire séquencer par l’ADN polymérase. On utilise des ddNTP pour assurer
l’incorporation.
En effet le ddNTP est un analogue du dNTP mas ne possède pas de OH en 3,
du
désoxyribose. Ainsi, il s’incorpore normalement dans une chaîne nucléotidique
en cours de synthèse. Mais cette incorporation du ddNTP par l’ADN polymérase
bloque l’allongement de la molécule d’ADN en cours de synthèse.
Rappelons que l’allongement d’une chaîne polynucleotidique par un ADN
polymérase nécessité en effet un groupement – OH en 3 du ribose disponible
2- Synthèse des ddNTP
-Les différentes formes des nucléotides.
Exemple de synthèse du Didésoxyadénosine triphosphate ddATP
3- Réactions de Séquençage
a- Réactions enzymatiques de synthèse du brin complementaire
Les réactions s’effectuent en traitant de manière parallèle 4 tubes contenant
chacun :
- le brin d’ADN obtenu après fusion ;
- les 4 types de desoxyribonucléotides (dNTP) ;
- l’amorce universelle ; Mg2+
- la DNA polymérase qui est généralement la taq polymérase ou Pfu Polymérase.
Chacun des tubes contient en outre un type de ddNTP en quantité bien définie
proportionnellement aux desoxyribonucléotides associés. Le travail se fait
toujours dans des conditions dénaturantes.
NOTE si on change le sens du fragment, on aura pluto 2 AU LIEU DE 3
* Procédé pratiques
Soit l’ADN bicentenaire suivant dont on désire déterminer la séquence :
5 GGT CAT CCA TGG ATT CGA 3
3 CCA GTA GGT ACC TAA GCT 5
- Séparons préalablement les 2 brins de cet ADN par fusion et considérons le brin
orienté 3 - - - - - - -5
- Réalisons une hybridation avec l’amorce de séquençage suivant :
GGT CAT CC orienté 5 - - - - - - -3
5 GGT CAT CC- 3
3 CCA GTA GGT ACC TAA GCT- 5
- Laissons agir dans les 4 tubes : une réaction de séquençage démarre entre les
dNTP (dATP, ddTTP, dCTP, dGTP ), les ddNTP (ddATP, ddTTP, ddCTP,
ddGTP ) et la Taq polymerase.
Les 4 tubes sont identifies en A, T, G, C comme l’indique le tableau suivant :
TUBE A T C G
Taq poly + + + +
dNTP + + + +
ddNTP ddATP ddTTP ddCTP ddGTP
* Description des réactions
Considérons le cas du tube A.
Quand l’ADN polymérase en action arrive en face d’un T situé sur le brin de
l’ADN matrice qu’elle est entrain de copier, elle doit incorporer A sur le brin
complémentaire en voie de synthèse. Elle a alors le choix entre :
- incorporer le d’AMP et donc la réaction de polymérisation se poursuit ;
- incorporer le ddAMP et la réaction s’arrête.
En effet, si la Taq polymérase incorpore de l’AMP, la réaction de synthèse se
poursuit jusqu’au prochain A approprié et de nouveau, le choix s’offre entre
dAMP et ddAMP.
Ainsi, les molécules obtenues dans chaque tube sont très nombreuses. On a toute
une famille de fragments de DNA synthétisés avec des tailles différentes selon
que dNTP ou ddNTP a été au hasard incorporé. Mais dans tous les cas toutes les
molécules se termineront obligatoirement par un ddNMP.
Dans l’exemple choisi, il y aura dans le tube A, des fragments stoppés en face du
premier « T » situé sur le brin à séquencer et formés donc de 9 nucléotides ;
d’autres stoppés en face du 2nd
« T » et ayant donc 13 nucléotides et d’autres
encore devant le 3eme
« T » avec 18 nucléotides.
En appliquant le même raisonnement sur chacun des 3 autres tubes, on obtient
finalement pour chacun des 4 tubes, les résultats suivant :
TUBE A
5 – GGT CAT CCA 3’ ( 9 nucléotides)
5 – GGT CAT CCA TGGA 3’ (13 nucléotides)
5 –GGT CAT CCA TGG ATT GGA 3’ (18 nucleotides)
TUBE T
5 – GGT CAT CCAT 3’
5 – GGT CAT CCA TGGAT 3’
5 – GGT CAT CCA TGG ATT 3’
TUBE C
5 – GGT CAT CCA TGG ATTC 3’
TUBE G
5 – GGT CAT CCATG 3’
5 – GGT CAT CCAT TGG 3’
5 – GGT CAT CCATGG ATT CG 3’
2 - Séparation sur gel et autoradiographie
* Marquage
On voit finalement qu’avec cette technique, si l’amorce ajoutée est marquée en
5’P par un P radioactif 32
P, dans chaque tube, on aura différents fragments qui
présenteront tous un marquage en 5’ - P.
Dans le tube A on aura un brin 3’ - 5’ et l’amorce.
Fig. rechercher dans la bibliographie.
Ainsi, on verra les 3 espèces suivantes qui se terminent toutes par ddA en leur
extrémité 3’- OH.
Fig. rechercher dans la bibliographie.
Le même raisonnement s’applique aux autres tubes T , C , et G et montre les
différentes espèces ou fragments avec un marquage radioactif en 5’ – P.
* Electrophorèse
Après les réactions de séquençage, on dépose sur 4 pistes électrophorétiques
séparés, les produits contenus dans les tubes A , T , C et G. Les fragments
nucléotidiques sont alors séparés selon leur taille par électrophorèse. Les plus
petits migrent plus loin. La distance de migration par rapport à leur position
initiale varie selon la taille des fragments.
* Autoradiographie et révélation
A la fin de l’électrophorèse, le gel est séché, un film est appliqué sur ce gel ;
et une révélation est effectuée après plusieurs heures de contact.
Chaque petit trait vu sur le film correspond à un fragment nucléotidique radioactif
terminé par un ddNTP.
Si par exemple dans la piste 1 on repère 3 trais successifs en .9, 13 et 18, cela veut
dire qu’il y a un « A » en position 9, 13 et18 dans le brin synthétisé. Le même
raisonnement s‘applique aux 3 autres tubes.
Fig. rechercher dans la bibliographie.
La lecture de ce gel se fait de bas en haut c’est à dire des fragments de petite taille
aux fragments de grande taille. Cette lecture nous donne comme résultat de
Séquençage :
5’ - ATGGATTCGA - 3’
Connaissant la séquence du brin complémentaire qui vient d’être synthétisé, il est
maintenant facile d’en déduire la séquence du brin matrice, soit :
3’ –TACCTTGCT – 5’
Soulignons que de nos jours, la radioactivité étant connue pour sa pollution et sa
toxicité, le marquage se fait de plus en plus grâce à la fluorescence.
Considérons un autre fragment de DNA à séquencer. Interpréter le schéma
suivant :
La détermination de l'enchaînement des nucléotides dans un fragment d'ADN
simple brin par la méthode de Sanger comporte deux étapes, lesquels ?
- Séquençage automatique : marquage des produits d'extension
Dans le séquençage automatique, des marqueurs fluorescents sont utilisés, un
marqueur différent pour chaque ddNTP (bleu, rouge, vert, orange...etc.). La
polymérisation se fait dans un seul tube contenant le mélange réactionnel et les
quatre ddNTPs. La séparation est faite selon la figure suivante.
•Pour connaître la séquence des DNA, on fait synthétiser un brin du DNA par
une enzyme spécifique.
• L’enzyme commence son travail à partir de l’extrémité 3’ d’une sonde
hybridée qui sert d’amorce. Elle ajoute des nucléotides complémentaires de ceux
du brin de DNA qu’elle copie.
• On lui donne pour substrats des désoxynucléosides triphosphates normaux
mélangés avec des didésoxynucléotides dont la fonction alcool secondaire en 3’
est réduite ce qui empêche la synthèse de se poursuivre au delà.
• Les didésoxynucléotides incorporés en dernier sont marqués spécifiquement
par des molécules fluorescentes (vert pour didésoxyA, bleu pour didésoxyC,
jaune pour didésoxyG et rouge pour didésoxyT)
• On sépare ensuite les fragments synthétisés dans un champ électrique
(électrophorèse : les DNA sont des anions, ils vont donc vers le pôle +), en
fonction de leur longueur (les plus petits vont plus vite).
• On lit ensuite les taches successives, identifiées par leur couleur, ce qui révèle
la séquence des fragments synthétisés.
II - TECHNIQUE CHIMIQUE DE MAXAM ET GILBERT
Elle est peu utilisée actuellement pour des raisons de pollution. L’ADN à
séquencer est tout d’abord marqué en 5’ avec du 32
P puis clivé après A, C, G ou
T par divers réactifs chimiques.
Exemples :
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf
BCH205 ACIDE NUCLEIQUE ET   SYNTHESE.pdf

Contenu connexe

Similaire à BCH205 ACIDE NUCLEIQUE ET SYNTHESE.pdf

Physiologie bactérienne
Physiologie bactériennePhysiologie bactérienne
Physiologie bactérienne
Dr Taoufik Djerboua
 
Revue des recommandations éthiques dans le contexte des études génomiques
Revue des recommandations éthiques dans le contexte des études génomiquesRevue des recommandations éthiques dans le contexte des études génomiques
Revue des recommandations éthiques dans le contexte des études génomiques
Geneviève David
 
De l’ADN à l’individu
De l’ADN à l’individuDe l’ADN à l’individu
De l’ADN à l’individu
Achelouji Jawad
 
Origine de la vie
Origine de la vieOrigine de la vie
Origine de la vieAya299
 
Poly biochimie 10 11
Poly biochimie 10 11Poly biochimie 10 11
Poly biochimie 10 11
amis-med
 
Chimie Organique.pptx
Chimie Organique.pptxChimie Organique.pptx
Chimie Organique.pptx
BtnPrinciiIsral
 
Biochimie clinique
Biochimie clinique Biochimie clinique
Biochimie clinique
S/Abdessemed
 
Le cytoplasme
Le cytoplasmeLe cytoplasme
Le cytoplasme
SimpliceSibamutaki
 
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdfCOURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
paterne6
 
Cinetique enzymatique
Cinetique enzymatiqueCinetique enzymatique
Cinetique enzymatique
abdesselam2015
 
point-presse.ppt
point-presse.pptpoint-presse.ppt
point-presse.ppt
Betman3
 
132presentation cours Microbio parasitologie éàé'
132presentation cours Microbio parasitologie éàé'132presentation cours Microbio parasitologie éàé'
132presentation cours Microbio parasitologie éàé'
adrioiche
 
PARCOURS-BCPP_infos_2016-17
PARCOURS-BCPP_infos_2016-17PARCOURS-BCPP_infos_2016-17
PARCOURS-BCPP_infos_2016-17Mehdi Felfli
 
Cours acides amines_lakhiari
Cours acides amines_lakhiariCours acides amines_lakhiari
Cours acides amines_lakhiari
Lakhiarii
 
Activité antioxydante
Activité antioxydanteActivité antioxydante
Activité antioxydante
Nora Mahfouf
 
BIOCHIMIE-MICROBIENNE- explication étude
BIOCHIMIE-MICROBIENNE- explication étudeBIOCHIMIE-MICROBIENNE- explication étude
BIOCHIMIE-MICROBIENNE- explication étude
MdBourabah
 
cours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdfcours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdf
FatimaZohra85
 
Biologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdfBiologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdf
NadiaBenAyedKoubaa
 
Fiche educative - unité 1 - consommation de la matière organique et flux de l...
Fiche educative - unité 1 - consommation de la matière organique et flux de l...Fiche educative - unité 1 - consommation de la matière organique et flux de l...
Fiche educative - unité 1 - consommation de la matière organique et flux de l...
KhalidShorts
 

Similaire à BCH205 ACIDE NUCLEIQUE ET SYNTHESE.pdf (20)

Physiologie bactérienne
Physiologie bactériennePhysiologie bactérienne
Physiologie bactérienne
 
Revue des recommandations éthiques dans le contexte des études génomiques
Revue des recommandations éthiques dans le contexte des études génomiquesRevue des recommandations éthiques dans le contexte des études génomiques
Revue des recommandations éthiques dans le contexte des études génomiques
 
De l’ADN à l’individu
De l’ADN à l’individuDe l’ADN à l’individu
De l’ADN à l’individu
 
Origine de la vie
Origine de la vieOrigine de la vie
Origine de la vie
 
Poly biochimie 10 11
Poly biochimie 10 11Poly biochimie 10 11
Poly biochimie 10 11
 
Chimie Organique.pptx
Chimie Organique.pptxChimie Organique.pptx
Chimie Organique.pptx
 
Biochimie clinique
Biochimie clinique Biochimie clinique
Biochimie clinique
 
Le cytoplasme
Le cytoplasmeLe cytoplasme
Le cytoplasme
 
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdfCOURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
COURS DE GENETIQUE MOLECULAIRE_Document etudiant.pdf
 
Cinetique enzymatique
Cinetique enzymatiqueCinetique enzymatique
Cinetique enzymatique
 
point-presse.ppt
point-presse.pptpoint-presse.ppt
point-presse.ppt
 
132presentation cours Microbio parasitologie éàé'
132presentation cours Microbio parasitologie éàé'132presentation cours Microbio parasitologie éàé'
132presentation cours Microbio parasitologie éàé'
 
PARCOURS-BCPP_infos_2016-17
PARCOURS-BCPP_infos_2016-17PARCOURS-BCPP_infos_2016-17
PARCOURS-BCPP_infos_2016-17
 
Cours acides amines_lakhiari
Cours acides amines_lakhiariCours acides amines_lakhiari
Cours acides amines_lakhiari
 
Activité antioxydante
Activité antioxydanteActivité antioxydante
Activité antioxydante
 
BIOCHIMIE-MICROBIENNE- explication étude
BIOCHIMIE-MICROBIENNE- explication étudeBIOCHIMIE-MICROBIENNE- explication étude
BIOCHIMIE-MICROBIENNE- explication étude
 
Robert.Barouki
Robert.BaroukiRobert.Barouki
Robert.Barouki
 
cours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdfcours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdf
 
Biologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdfBiologie-Cellulaire-examens-11.pdf
Biologie-Cellulaire-examens-11.pdf
 
Fiche educative - unité 1 - consommation de la matière organique et flux de l...
Fiche educative - unité 1 - consommation de la matière organique et flux de l...Fiche educative - unité 1 - consommation de la matière organique et flux de l...
Fiche educative - unité 1 - consommation de la matière organique et flux de l...
 

BCH205 ACIDE NUCLEIQUE ET SYNTHESE.pdf

  • 1. UNIVERSITE DE LOME Ecole Supérieure des Techniques Biologiques et Alimentaires (E.S.T.B.A.) Domaine : Sciences et techniques, Sciences de la santé, Sciences agronomiques Licence professionnelle Ecole Supérieure des Techniques Biologiques et Alimentaires (ESTBA) UE BCH 205 – ACIDES NUCLEIQUES ET SYNTHESE PROTEIQUE Crédits : 3 Public cible : Etudiants Semestre : 4 Pré-requis : Biologie cellulaire, Biochimie Responsible: Pr. TCHACONDO Tchadjobo, Professeur Titulaire, Chronophysiologie et Toxicologie moléculaire/environnement Tel. +228. 92 20 23 92. tchacondotchadjobo@yahoo.fr Disponibilité : samedi, 10 h à 15h 30
  • 2. Objectif général : Cette UE vise à offrir aux apprenants des notions essentielles de la biologie et physiologie moléculaires et sur des techniques et outils biologiques de base nécessaires pour la pratique et recherche aux laboratoires de biologie moléculaire. Objectifs spécifiques : Les apprenants seront capables de : - décrire les différentes structures chimiques des biomolécules. - reconnaître par leur nature chimique, les différents composants des biomolécules. - maitriser les mécanismes d’action moléculaire caractérisant les différentes biosynthèse. - maitriser les différentes techniques et tests de base de la biologie moléculaire. CONTENU Cette UE est composée de trois grandes parties et terminée par des exemples de pratiques de laboratoire. La première partie traite de la structure des acides nucléiques et des mécanismes de synthèse des protéines. La deuxième partie est une récapitulation des différents enzymes de restriction utilisés au laboratoire pour cliver et digérer les ADN et ARN. La troisième partie décrit les différentes techniques de base de la biologie moléculaire. Ainsi, les étudiants se familiariseront aux notions de base de la biologie moléculaires. Ils compléteront aussi leurs connaissances acquises en biochimie et en biologie cellulaire sur l’expression des gènes. PLAN DU COURS Séance N° Objectifs spécifiques Titres/Sous titres 1 Historique et intérêt Histoire de la naissance de la Biologie moléculaire, prix Nobel et relation avec d’autres UE 2 Connaitre la structure détaillée des RNA et DNA -structure des acides nucléiques - les propriétés fondamentales - Les différents DNA et RNA 3 Maitriser les mécanismes de synthèses, du DNA à la protéine -Réplication, synthèse du DNA -Transcription, synthèse du RNA -Code génétique et traduction, synthèse protéique 4 Comprendre les systèmes de réparations lors des dommages cellulaires - Dommage et erreurs apparus au niveau du DNA - Les différents systèmes de réparations pour la fidélité du DNA 5 -Connaitre les enzymes de restriction -Utiliser ces enzymes Sites des enzymes de restriction Origine et différentes classes Utilisation des enzymes de restriction 6 -Comprendre les phénomènes de substituions et mutation -Les interpréter -Substitutions et fidélité du DNA -Mutation et modification géniques -Etude de cas de maladies congénitales
  • 3. 7 -Connaitre les mécanismes d’insertion et de délétions - Les interpréter -Insertion, délétion et maladies génétique - Etude de cas de maladies congénitales 8 Savoir extraire, purifier et quantifier le DNA -Extraction et purification du DNA -Electrophorèse du DNA 9 -Comprendre l’amplification génique -Savoir utiliser un thermocycleur -PCR et réplication -Les différents PCR -Les étapes de réalisation -Les produits PCR -Les applications pratiques 10 -Comprendre les principes de séquençage du DNA -Savoir l’interpréter -Différentes techniques de séquençage du DNA -Principe et interprétation 11 -Comprendre les techniques de Southern et de Northern -Savoir les appliquer -Différentes étapes de la technique de Southern -Les applications de la technique de Southern -Différentes étapes de la technique de Northern -Les applications de la technique de Northern 12 Répondre aux questions et inquiétudes des apprenants en révision générale Dépends des questions et inquiétudes des apprenants MODALITE D’EVALUATION Contrôle continu des connaissances − Devoir sur table (33.33%) − Examen finale (66.67%) Bibliographie 1. Françoise Quentin, Paul-françois Gallet, Michel Guilloton & Bernadette Quintard. Biochimie en 84 fiches, Dunod, Paris, 2015, 5 rue Laromiguière, 75005 Paris, www.dunod.com ISBN 978-2-10-073922-6 2. Simon Beaumont. Biochimie-UE1 ,1ère année santé, Dunod, Paris, 2015, 5 rue Laromiguière, 75005 Paris, www.dunod.com , © Dunod, Paris, 2005, ISBN 978-2-10- 073044-5 3. Weinman S., 2004. Toute la Biochimie. ISBN 2 10 006734 6. Dunod, Paris 4. David L. Nelson & Michael M. Cox, Lehninger, Principles of Biochemistry, Fourth Edition; 1130p. 5. Jacques Kruh. Biochimie Etudes Médicales et Biologiques. Tome 1, Biologie Cellulaire Et Moléculaire, Editions Hermann 6. Jacques Kruh. Biochimie Etudes Médicales et Biologiques. Tome 2, Métabolismes, Edition Hermann 1989. 7. Etienne J. & Clauser E. Biochimie génétique, biologie moléculaire. Masson, 1999.
  • 4. 8. Stryer L. La biochimie. Flammarion, Médecine – sciences, 1992. 9. Alberts B. & al. Biologie moléculaire de la cellule. Flammarion, Médecine – sciences, 1995. 10. MAMAN I., TCHACONDO T., BANLA-KERE A. Ulcer de Buruli. Edition Universitaire Européenne, 2019 ; 207p. 11. Biologie moléculaire et médecine. Flammarion, Médecine – sciences, 1993. 12. Boyard E. Cancer et médicaments, Masson, 1993.
  • 5. INTRODUCTION A LA BIOLOGIE MOLECULAIRE 1- Définition La Biologie Moléculaire (BM) est le champ de la biologie qui concerne les phénomènes biologiques en termes d’interaction moléculaire ou chimique. Elle se consacre au monde vivant par la connaissance des molécules qui lui sont propres. Ces molécules sont des constituants élémentaires des organismes vivants (ADN, ARN). 2- Historique L’histoire de la Biologie Moléculaire commence en 1953 avec la découverte de la structure en double hélice de l’ADN par Watson et Crick (Prix Nobel 1962). Cette découverte très importante ouvre la voie à la compréhension de plusieurs fonctions cellulaires. On sait dès lors que c’est à partir des gènes portés par l’ADN que sont synthétisées des molécules qui permettront la vie de la cellule, des tissus et de l’organisme. Les hormones, les enzymes, les facteurs de croissance et les fonctions de développement constituent quelques exemples de ces molécules essentielles de la vie. 3- Biologie Moléculaire : Science particulière La Biologie Moléculaire diffère de la biochimie par le fait que cette dernière concerne principalement le comportement chimique des substances biologiques importantes et de leur analogue. Elle diffère également des autres champs biologiques par son emphase sur les interactions chimiques particulières entre autres celles impliquées dans la réplication de l’ADN, sa transcription en ARN et sa traduction en protéine ; en résumé dans les réactions chimiques reliant le génotype et le phénotype. 4- Importance de la Biologie Moléculaire La biologie moléculaire a favorisé l’évolution rapide de diverses techniques biologiques avec des domaines d’application assez variés. - En médecine : exemple de la Fabrication de l’insuline, de la lutte contre le cancer (Cancer génétique). - En agriculture - Environnement - Nutrition
  • 6. STRUCTURE DES ACIDES NUCLEIQUES I – Définition Les acides nucléiques sont des macromolécules comportant des sous – unités appelées nucléotides. On distingue deux grands groupes d’acides nucléiques : - Les acides ribonucléiques (ARN) ; - Les acides désoxyribonucléiques (ADN). qui sont surtout localisés dans le noyau. II – Les Nucléotides 1- Définition Ce sont des macromolécules formées de 03 composants qui sont les bases (T, A, G, U, C), les oses (ribose, désoxyribose) et l’aide phosphorique. a- Les bases Elles sont classées selon la nature de leur noyau en bases puriques et pyrimidiques. - Les principales bases pyrimidiques c’est à dire issues d’un noyau pyrimidine sont l’Uracile(U), la Cytosine(C) et la Thymine(T). - Les principales bases puriques c’est à dire dérivées d’un noyau purine sont : la Guanine(G) et l’Adénine(A).
  • 7. b- Les oses Elles sont de deux sortes : le ribose et le désoxyribose. Ces deux sucres sont des pentoses dont la structure de base se présente comme suit : c- L’acide phosphorique Il est caractérisé par trois fonctions acides. Deux de ces fonctions sont estérifiées dans les ADN et les ARN. La troisième est libre. 2- Liaisons dans les nucléotides a- Liaison base – ose C’est une liaison glucosidique appelée b- osidique. L’association ose – base donne un nucléoside. b- Liaison acide phosphorique – ose Il s’agir d’une liaison ester. Il y a élimination d’une molécule d’eau entre un OH de l’H3PO4 et un H de la fonction alcool de l’ose. Fig.
  • 8. 3- Nomenclature des acides nucléiques a- Nucléotides à bases pyrimidiques Le nom des nucléosides se termine par « idine » et celui des nucléotides se termine par « idylique ». b- Nucléotides à bases puriques Le nom des nucléosides se termine par « ine » et celui des nucléotides par « ylique ». L’appellation est complétée, si l’ose est un désoxyribose, en faisant précéder l’abréviation du nucléotide par la lettre « d » dans les deux cas. Le tableau de la nomenclature des principaux nucléotides est le suivent Nomenclature des principaux nucléotides BASE NUCLEOSIDE NUCLEOTIDE ARN Monophosphate ADN Monophosphate Adénine Adénosine Acide adenylique AMP d- AMP Guanine Guanosine Acide guanylique GMP d- GMP Cytosine Cytidine Acide cytidylique CMP d- CMP Thymine Thymidine Acide thymidylique - d- TMP Uracile Uridine Acide uridylique UMP -
  • 9. III- Les acides nucléiques 1- Liaison entre les acides nucléiques Dans un acide nucléique, les nucléotides sont rassemblés entre eux par des liaisons esters. Une molécule d’eau est donc éliminée entre OH de l’H3PO4 et H de la fonction alcool située en position 3’ de l’ose. Quand l’ H3PO4 présente ses deux fonctions acides bloquées dans la formation de l’ester, on parle de liaison phosphodiester. On peut indiquer les lettres a et b pour préciser les liaisons concernées. - La liaison phosphodiester « a » correspond à la liaison ester entre l’acide H3PO4 et le OH en 3’ de l’ose. - La liaison « b » correspond à la liaison ester entre l’acide H3PO4 et le OH en 5’ de l’ose. - Fig. 2- Sens de lecture d’un acide nucléique Par convention, l’acide nucléique est lu dans le sens de l’extrémité 5’ extrémité comportant un groupement phosphate, vers l’extrémité 3’ qui possède un OH libre. Exemple : 5’ –AACTTGG-3’ IV- Les Acides Désoxyribonucléiques (ADN ou DNA) 1- Constituants Ce sont les acides nucléiques faits de 02 chaînes de nucléotides. Les ADN présentent quelques caractéristiques particulières notamment : - l’ose : désoxyribose ; - les bases : sont A, T, G, C soient 2 bases puriques et 2 bases pyrimidiques. 2 - Propriétés caractéristiques de l’ADN Trois propriétés caractérisent l’ADN : - la complémentarité - l’antiparallélisme
  • 10. - la forme hélicoïdale * Antiparallélisme Les 2 brins de la molécule d’ADN sont disposés dans le sens opposé. L’un est orienté dans le sens 5’-3’ et l’autre parallèle, s’oriente dans le sens 3’-5. * Complémentarité Les 2 brins composant l’ADN sont appariés par des bases. Cet appariement des bases se fait selon une règle dite de complémentarité : A est appariée à T et C à G. Cette complémentarité repose sur des raisons structurales et sur la formation des liaisons hydrogènes. Ces liaisons hydrogènes sont au nombre de 2 entre A et T, et de 3 entre C et G. Fig. * Forme hélicoïdale Dans l’espace, les 2 chaînes d’une molécule de DNA, présentent une conformation hélicoïdale. Elles s’enroulent autour d’un axe imaginaire pour former une double hélice en rotation droite (la forme A et B) ou plus exceptionnellement à rotation gauche (forme Z). Fig.
  • 11. - Les formes d’ADN Il existe plusieurs formes d’ADN dont les plus connues sont A, B et Z. La forme B est la forme biologique la plus importante décrite par WATSON et CRICK. Les caractéristiques de B sont les suivantes : • Environ 10 paires de bases par tour de spire • Le diamètre est de 2,4nm, 3- Priorités physico-chimiques de l’ADN a- Température de fusion A une certaine température, les liaisons hydrogènes entre les 2 brins d’un ADN se rompent et les 2 brins se séparent. On dit que l’ADN est dénaturé. C’est la fusion de l’ADN caractérisée par une température Tf dite température de fusion. Cette dénaturation est cependant réversible. Les 2 brins peuvent se réassocier suivant la règle de complémentarité. b- Absorption dans l’ultraviolet Dans l’UV, les bases pyrimidiques permettent de doser l’ADN grâce à leur pouvoir d’absorption. Généralement l’ADN absorbe à 260 nm. Cette propriété permet au laboratoire de détecter facilement la présence d’ADN dans un milieu. c- Hybridation des acides nucléiques et notion de sondes nucléiques L’hybridation est l’une des propriétés fondamentales des acides nucléiques qui reposent sur la règle de complémentarité. Il est possible d’apparier les brins d’ADN avec les oligonucléotides ou les polynucléotides qui reconnaissent spécifiquement des séquences sur les brins d’ADN de manière antiparallèle et complémentaire. Ces oligo et polynucléotides sont appelés des sondes et l’ADN obtenu, est dit hybride.
  • 12. 4 - Chromatine et Nucléosomes Dans les cellules eucaryotes, la molécule d’ADN est fortement associée à des protéines pour constituer la chromatine. Les nucléosomes sont constitués d’environ 200 paires de bases associées à des protéines appelées Histones. Au niveau des nucléosomes, l’ADN est associé à un octamère d’histones. Le traitement doux de la chromatine par une endonucléase, libère des particules qui sont l’ADN, les protéines d’histone et quelques protéines non histones (voir purification). II - Les Acides Ribonucléiques : ARN ou RNA 1- Caractéristiques Les ARN sont des acides nucléiques dont les caractéristiques générales sont les suivantes : - Sucre : ribose - bases : A, U, C, G. - appariement : les règles d’appariement dans les bases complémentaires peuvent s’observer aussi au niveau des ARN. En effet dans une même chaîne d’ARN, des parties peuvent être bicaténaires avec des appariements tels que A=U et C=G. Ceci donne au niveau de la portion appariée, des sortes de lignes alors que les régions non appariées présentent des formes en boucle. Ainsi les ARN peuvent prendre plusieurs formes. 2- Différents types d’ARN Les cellules contiennent essentiellement 4 types d’ARN : - les ARNr (ribosomique) - les ARNt (transfert) - les ARNm (messager) - les ARN de petites tailles (sRNA, cytoplasmique). a- Les ARNr Ce sont les plus nombreux des ARN. Les ARNr jouent un rôle essentiel dans la structure et le maintien de l’intégrité des ribosomes en association avec les protéines ribosomales. Les ribosomes sont des organites situés dans le cytoplasme et qui constitue l’usine de fabrication des protéines chez les procaryotes et les eucaryotes. Chaque ribosome comporte 2 sous unités : - Une grande sous-unité de 50 S (procaryote) ou de 60 S (eucaryote) ; - Une petite sous-unité de 30 S (procaryote) ou de 40 S (eucaryote). b- Les ARNt * Rôle Leur rôle est essentiel dans la synthèse protéique. Ce sont des vecteurs qui vont transférer les acides aminés jusqu’à l’usine ribosome où s’effectue la synthèse des protéines.
  • 13. * Structure des ARNt En plus de la structure générale des ARN, les ARNt possèdent des particularités propres : - des bases inhabituelles comme l’hypoxanthine dont le nucléotide correspondant est IMP (Inosine monophosphate), mais aussi la thiamine ou encore des bases méthylées. - structure spatiale : chaînes constituées d’une centaine de nucléotides avec des zones d’appariement et des boucles non appariées. La forme générale est celle d’une L qui prend la forme de trèfle en structure spatiale. - des sites importants : on note plusieurs sites dont les plus importants sont : * l’extrémité 3’-OH portant 3 nucléotides caractéristiques. C-C-A-3’-OH et qui fixera l’acide aminé qui sera véhiculé par l’ARNt. * l’anticodon qui correspond à un groupe de 3 nucléotides ou triplet situé sur une boucle d’ARN. Ce triplet joue un rôle important lors de la synthèse protéique. En effet, c’est ce triplet qui s’apparie à un autre triplet appelé codon présent sur l’ARNm. Cet appariement se fait par des liaisons hydrogènes et selon les règles de complémentarité. Le codon et l’anticodon sont disposés de façon antiparallèle. Fig. Il existe naturellement une vingtaine d’acides aminés, mais on dénombre 61 codons différents reconnus et transportés par plusieurs ARNt spécifiques. - l’extrémité 5’ de l’ARNt comporte un groupement phosphate
  • 14. e - ARNm C’est le support essentiel de l’information génétique entre l’ADN et les ribosomes du cytoplasme où s’effectue la synthèse protéique. Leur durée de vie est très courte à la différence des ARNt. Chez la bactérie, la durée de vie d’un ARNm est de quelques minutes. Les ARNm sont très rapidement synthétisés. Ils sont formés d’une seule chaîne de nucléotides avec des bases communes aux ARN (A,G,C et U). Cette chaîne comporte une succession de triplets nucléotidiques et chaque triplet constitue un codon spécifique d’un acide aminé. d- Petits ARN nucléaires Présents dans le noyau, ils sont impliqués dans certaines étapes de la transcription, c'est-à-dire de la copie de l’ADN en ARNm.
  • 15. LA REPLICATION I – Généralités Lors de la division cellulaire, quand une cellule mère donne deux cellules filles, il est essentiel que l’ADN présent dans ces cellules filles soit la copie identique de l’ADN parental. On parle de réplication de l’ADN. Ainsi, préalablement à la division cellulaire, la quantité d’ADN est multipliée par 2. Le mécanisme de réplication conditionne donc le déroulement de la division cellulaire. Ce mécanisme comporte en générale trois étapes : Initiation, Elongation et Terminaison. II – Réplication chez les procaryotes 1- Caractéristiques La réplication est dite semi-conservative c'est-à-dire que sur les deux brins d’ADN fils on a toujours un qui provient d’un des deux brins de l’ADN parental et un brin nouvellement synthétisé. Fig. A chaque réplication les deux brins d’ADN parental se séparent ; chacun de ces deux brins sert de matrice pour la synthèse d’un brin qui lui est complémentaire. 2- Eléments nécessaires à la réplication La réplication d’ADN nécessite : - Une matrice d’ADN constituée par un brin parental ; - La présence de nombreuses enzymes : hélicase, ADN polymérases …. ; - La présence de certains ions comme Mg2+ . Ces différents éléments interviennent dans le bon déroulement de chacune des trois étapes de la réplication. 3- Mécanisme d’initiation de la réplication 3-1- Notion de réplicon L’unité d’ADN où se produit la réplication est appelée réplicon. Ce réplicon a une origine où est initiée la réplication, et une terminaison où s’arrête la réplication. A partir d’un point d’initiation, la réplication peut progresser soit d’une manière unidirectionnelle soit d’une manière bidirectionnelle.
  • 16. 3-2- Initiation de la réplication Chez E. coli, il existe au niveau de l’ADN, une origine unique de la réplication appelée Ori C. Ce locus Ori C est constitué d’une séquence de 245 bases. Cette séquence contient : - 3 séquences nucléotidiques presque identiques faites de 13 nucléotides chacune et riches en thymine. - 4 sites de liaison comportant un motif de 9 paires de bases pour une protéine appelée dna A qui est une protéine d’initiation de la réplication codée par le gène du même nom dna A. Au début de la réplication, des copies de cette protéine s’associent avec l’ADN à l’origine de la réplication. Ces liaisons nécessitent de l’ATP. C’est une étape indispensable à la transformation localisée de l’ADN double brin en ADN simple brin. Ces complexes viennent ensuite fixer l’ADN hélicase ou protéine dna B, enzyme qui catalyse le déroulement de la double hélice d’ADN en présence d’ATP. Ce qui définira la future fourche de réplication. Une protéine appelée dna C est indispensable à cette étape, mais elle sera ensuite relâchée après fixation de la protéine dna B à la fourche de réplication. Les brins séparés de l’ADN sont ensuite stabilisés sous forme de simples brins grâce à la fixation d’autres protéines appelées SSB (Simple Strand Binding). Il se formera ensuite un complexe appelé Primosome ou protéine dna G entre l’hélicase et un autre enzyme appelé Primase ; complexe qui synthèse une amorce d’ARN de 9 bases. Après synthèse de l’amorce, une enzyme dite ADN polymérase III s’insère au niveau de la fourche de la réplication pour commencer la synthèse de l’ADN à partir de l’extrémité 3’-OH de l’amorce. Le complexe de protéine qui se déplacera le long de l’ADN pour catalyser la réplication est appelé Réplisome. 4- Discontinuité de la réplication et élongation 4-1- Discontinuité Le déroulement de la réplication n’est pas identique entre les deux brins d’ADN. En effet sur l’un des deux brins en synthèse, la réplication s’effectue de manière continue : c’est le brin avancé. Alors que sur l’autre brin, elle est discontinue et on parle de brin retardé. 4-2- Elongation Sur le brin avancé, la progression de la réplication se fait dans le sens 5’-3’ en utilisant comme modèle, le brin d’ADN parental orienté dans le sens 5’-3’. Sur le brin retardé, de petits fragments d’ADN sont synthétisés : ce sont des fragments d’Okazaki. Chaque fragment est synthétisé dans le sens 5’-3’. Le brin modèle correspondant (de l’ADN) est orienté de manière antiparallèle 3’-5’. *ADNp III et étape d’élongation L’intervention de l’ADNp III est essentielle dans l’incorporation des nucléotides. L’ADNp III synthétise un brin complémentaire à partir de l’extrémité 3’-OH de
  • 17. l’amorce d’ARN, en utilisant les brins d’ADN comme matrice. Cet enzyme comportant 10 polypeptides, synthétise le brin avancé et les fragments discontinus sur le brin retardé et toujours dans le même sens 5’-3’. En résumé, la copie d’un brin parental nécessite donc l’intervention d’une amorce d’ARN, une synthétase qui synthétise l’amorce d’ARN puis l’ADNp III qui allonge cette amorce d’ARN pour fabriquer le brin complémentaire d’ADN. 5- Hydrolyse et remplacement des amorces d’ARN Ce mécanisme est caractérisé par l’intervention d’une ADN polymérase appelée ADNp I. Les amorces d’ARN sont ensuite détruites et hydrolysées par l’intervention d’un enzyme appelé RNase H. Les lacunes engendrées par l’RNase H sont comblées par l’ADNp I. Finalement les fragments d’ADN deviennent contigus et soudés les uns aux autres grâce à un enzyme appelé DNA ligase. Notons que l’ADNp I est aussi capable d’hydrolyser les amorces d’ARN. 6- Remarques générales sur la fonction des ADN polymérases Les ADNp présentent plusieurs fonctions enzymatiques : - Fonction polynucléasique permettant de constituer la chaîne polynucléotidique, l’enzyme ajoute les nucléotides à l’extrémité 3’-OH d’un acide nucléique. - Fonction exonucléasique 3’-5’ : elle permet de vérifier les derniers nucléotides mis en place. En cas d’un défaut d’appariement, elle enlève ce dernier nucléotide et insère le nucléotide correct ; ce mécanisme capital est appelé fonction d’édition des ADNp. Il permet la correction d’erreurs au cours de la réplication. 7- Terminaison de la réplication Il existe plusieurs sites de terminaison dans le génome bactérien. Une protéine spécifique appelée Tus, se lie au site de terminaison. Cette liaison arrête la protéine hélicase en même temps que la réplication. III – Réplication de l’ADN chez les Eucaryotes 1- Caractéristiques générales La réplication est en général comparable à celle des ADN procaryotes. Elle est bidirectionnelle, discontinue, complémentaire, antiparallèle et se fait dans le sens 5’-3’. Elle utilise également les amorces d’ARN. 2- Caractéristiques particulières • La réplication chez le Eucaryotes se fait en de nombreux points d’initiation. Elle fait intervenir un nombre d’ADNp plus important et de nombreuses protéines comme facteurs de réplication.
  • 18. • Il existe au moins 05 ADNp chez les Eucaryotes qui sont ADN alpha, β, gama, Δ, et epsilon. • L’ADN simple brin au cours de la réplication est stabilisé par des protéines SSB particulières. • Les télomères : ce sont des extrémités des chromosomes d’eucaryotes formées des séquences répétitives. - A l’extrémité 3’ des chromosomes, on trouve des copies répétées de séquences de type TTGGGG ou TTAGGG. - A l’extrémité 5’, on a les séquences complémentaires riches en cytosine. Ainsi, la réplication de l’ADN à l’extrémité des chromosomes eucaryotes fait donc intervenir un enzyme spécifique : la Télomérase. Cet enzyme ajoute des séquences spécifiques en 3’-OH des brins d’ADN. Il assure également la protection de ces extrémités chromosomiques. Figure résumé.
  • 19. LA TRANSCRIPTION I – Généralités La transcription constitue l’ensemble des mécanismes par lesquels l’ARNm est synthétisé. L’ARNm est une copie d’une portion d’ADN. Seules certaines parties de l’ADN sont transcrites. Ces séquences d’ADN sont appelées des gènes. Seul l’un des deux brins de l’ADN est copié en ARNm. La transcription constitue l’étape préliminaire essentielle pour la biosynthèse des protéines. II – Caractères généraux 1- Règles de base La synthèse d’un ARNm à partir d’une ADN s’effectue toujours : - dans le sens 5’-3 de l’ARNm en synthèse - de manière antiparallèle par rapport à la portion d’ADN copiée. - de façon complémentaire c'est-à-dire G - C et A - U. 2- Eléments nécessaires La synthèse d’ARNm nécessite : - La présence de nucléotides propres aux ARN c'est-à-dire contenant des bases A, C, G, U ; - La présence d’un sucre : le ribose ; - La présence d’ARNp et des sels de Mg2+ ; - La présence d’une matrice d’ADN servant de modèle : on parle d’ARN polymérase – ADN dépendant. III – Différentes étapes de la transcription La transcription ne concernant qu’une portion de l’ADN, il faut déterminer son début et sa fin, puis préciser les mécanismes par lesquels l’ARNp reconnaît la portion d’ADN à transcrire. On parle d’unité transcriptionnelle. La synthèse de l’ARNm comprend trois phases : l’initiation, l’élongation et la terminaison. 1- Initiation a- Généralités Par convention, on donne le chiffre +1 au 1er nucléotide à partir duquel commence la transcription, puis le chiffre –1, au nucléotide qui le précède. Le signal pour initier une transcription correcte est appelé Promoteur. Ce promoteur est situé en avant et au début de la zone où commence la transcription.
  • 20. b- Promoteur des gènes procaryotes Ils sont généralement situés en 5’ du site +1 d’initiation. Ces promoteurs ne sont pas donc transcrits. Dans la plupart des cas, les séquences nucléotidiques des promoteurs sont courtes et assez similaires. Deux de ces séquences sont remarquables : - Une première située entre -30 et -35 paires de bases en avant de l’origine de la transcription. On l’appelle séquence -35, constituée de six paires de bases. - Une deuxième séquence dite séquence -10 située à environ dix nucléotides par rapport à l’origine de la transcription +1. Fig. 5’ TTGACA TATAAT II +1 3’ 3’ AACTGT ATATTA 5’ - 35 - 10 c- ARNp des procaryotes L’ensemble des ARN est synthétisé par l’ARNp chez les procaryotes. Cet enzyme reconnaît les sites promoteurs, puis se positionne sur ces sites. Il recouvre une région située entre les positions -60 et +20. Dès lors placée sur cette région, l’ARNp protège l’ADN de l’action d’autres enzymes. Chez les eucaryotes l’initiation est plus complexe. 2- Elongation a- Mécanisme La progression de la transcription se fait par formation de la liaison entre les nucléotides. Les nucléotides à ajouter sont sous formes de nucléosides triphosphates riches en énergie. Chaque nucléoside forme une liaison ester par extrémité 5’ avec l’extrémité 3’ de l’ARN en cours d’élongation. Le 1er nucléotide comporte toujours une base purique. Ce 1er nucléotide va conserver son groupement triphosphate. La progression de la transcription se fait dans le sens 5’-3’ de l’ARN en synthèse. Fig. rechercher dans la bibliographie. Au fur et à mesure qu’elle se réalise, les 2 brins d’ADN se séparent et un seul brin est copié. L’ARN formé, initialement apparié au brin d’ADN, se détache par la suite. La liaison hydrogènes des brins d’ADN se forme après passage de l’ARNp. Puis les 2 brins de l’ADN matrice reprennent leur forme hélicoïdale. Fig. rechercher dans la bibliographie.
  • 21. b- Identification de brins Considérons la séquence d’ADN suivante comme matrice : +1 5’ AGCTTAACGCGTA 3’ 3’ TCGAATTGCGCAT 5’ Le chiffre +1 ci-dessus sur la base A, désigne le site d’initiation, c’est la 1ère base transcrite. Au cours de la transcription et dans le cas d’une ARNp progressant dans le sens gauche - droit sur la séquence ci-dessus, l’ARNp synthétisera un ARNm dans le sens 5’-3’ ; ce qui signifie que la séquence d’ARNm commerce par A soit 5’ –AACGCGUA- 3’ Par définition, - le brin d’ADN qui a le même sens que l’ARN est appelé brin sens. - Le brin d’ADN opposé est nommé brin non-sens ou brin antisens. Le brin sens est aussi dit non transcrit c'est-à-dire qu’il ne sert pas de brin matrice de lecture de l’ARNp. Par contre le brin d’ADN orienté 3’-5’ est appelé brin transcrit. Par référence à la synthèse protéique, on parlera de brin non transcrit (sens) ou brin codant et de brin transcrit ou non codant. Considérons une autre séquence d’ADN suivante : 5’-GCAATCG-3’ 3’-CGTTAGC- 5’ Si l’ARNp progresse dans le sens gauche - droit, le brin sens est constitué par le brin 5’-3’. Par contre si l’ARNp progresse dans le sens droit - gauche, le brin sens est 3’- 5’. 3- Terminaison L’arrêt de la transcription s’effectue par l’intervention des signaux de fin de transcription. Les signaux formés par les séquences de polyadénylation de type 5’AATAAAA3’ sur le brin sens annoncent la terminaison de la transcription chez les eucaryotes. L’ARNp reconnaît ce signal sur l’ADN mais poursuit la transcription. Dans ces conditions les produits primaires de la transcription. Dans ces conditions les produits primaires de la transcription sont appelés transcrits primaires
  • 22. Chez les procaryotes la terminaison est caractérisée par un site dit Terminateur. Il apparaît à l’extrémité de l’ARNm, des boucles qui déstabilisent la liaison ARNp et matrice d’ADN. Fig. rechercher dans la bibliographie. 4- Produits de la transcription Ces produits peuvent être principalement : - ARNm qui sera traduit en protéine et peut être polycistronique c'est-à-dire pour plusieurs chaînes polypeptidiques (Procaryotes) avec un ARNm issu de plusieurs gènes) ou monocistronique (Eucaryotes). - ARNt, ARNr, sARN. IV- Modifications Post-transcriptionnelles chez les procaryotes Après la synthèse de l’ARN, ARNm sort de l’ADN et du noyau pour le cytoplasme. Les cassures réalisées au niveau de l’ADN matrice sont comblées et réparées par les ADNp I ou II et les ligases. Fig. rechercher dans la bibliographie. Après la synthèse protéique, les ARNm sont rapidement dégradés. La dégradation des ARNm bactériens est réalisée par la combinaison des fonctions d’endo et d’exonucléases. Les clivages par les endonucléases s’effectuent dans le sens 5’-3’ et en arrière des ribosomes qui assurent la traduction protéique. Les fragments seront ensuite dégradés par les exonucléases qui travaillent dans le sens 3’-5’. Fig. rechercher dans la bibliographie. V- Modifications post-transcriptionnelles chez les eucaryotes Chez les eucaryotes on a 03 groupes d’ARNp : - ARNp I : qui transcrit les ARNr - AAARNp II : qui transcrit les précurseurs des ARNm appelés transcrits primaires. - ARNp III : qui transcrit les ARNt Ces 03 ARNp sont des protéines constituées de sous-unités et ont besoin de facteurs multiples pour se positionner au point de départ (+1) au niveau des gènes. 1- Structure des gènes eucaryotes Chez les eucaryotes les gènes possèdent une structure discontinue comportant des sous-unités appelées Exons et Introns.
  • 23. * Les exons sont des séquences d’ARN qui seront traduites en protéine. * Les introns sont des séquences non traduites intercalées par les exons. 2- Unité de transcription et transcrit primaire a- Définition On appelle unité de transcription, un ensemble comportant une origine ou point de départ de la transcription +1 et un point de fin de transcription ou site de terminaison. Elle va donc de la 1ère base transcrite à la dernière base transcrite. L’ARNm correspondant s’appelle Prè-ARNm ou transcrit primaire (eucaryote). Ce pré-ARNm comprend outre les exons et les introns, des régions extrêmes non- traduites appelées UTR (Untranslated region) : 5 UTR et 3’ UTR. Le schéma général se présente comme suit : b- Structure détaillée et sites de Pré-ARNm Au niveau du transcrit primaire, les séquences de bases d’un intron commencent par GU et se terminent par les bases AG. L’exon d’amont se termine par CAG ou AAG et l’exon d’aval par G ou A. Le transcrit primaire comporte 02 sites appelés site d’épissage : le site 3’-OH et le site 5’P. Ces sites sont respectivement receveurs et donneurs d’électron lors de la maturation de l’ARNm. D’autres sites dits régulateurs assurent la régulation de cette maturation. En amont du site 3’-OH d’épissage entre 20 et 30 nucléotides, se trouve un autre site appelé site de branchement A, qui joue un rôle important dans les mécanismes d’excision – épissage. Fig. rechercher dans la bibliographie. 3- Les modifications du transcrit primaire a- Addition de la coiffe La coiffe est une macromolécule indispensable ajoutée à l’ARNm pour la protection contre l’attaque des enzymes de dégradation. b- Addition des poly A à l’extrémité La présence de poly A à l’extrémité 3’-OH aurait également une fonction protectrice des ARNm. c- Excision – épissage L’excision-épissage est un mécanisme qui permet la maturation du transcrit primaire en ARNm. Il se déroule dans le noyau des cellules eucaryotes. * Mécanisme L’excision-épissage fait intervenir deux réactions de tranestérification. Considérons le schéma suivant :
  • 24. 5’ 3’ A 5’ 3’ 5’ 3’ Exon 1 2’-OH Exon 2 Intron Deux grandes étapes caractérisent les mécanismes d’excision – épissage. - Etape 1 : Clivage en 5’ de l’intron et formation d’un boucle appelé Lasso. A’ - Etape 2 : Clivage en 3’ de l’intron, il y a simultanément soudure des deux exons avec formation d’une liaison phosphodiester entre 3’- OH de l’exon 1 et 5’ –P de l’exon 2 ; puis libération de Lasso qui sera ensuite dégradé. L’exclusion des introns détermine la maturation des pré-ARNm en ARNm. • Intervention des SnARN Les SnARN s’associent aux facteurs ribonucléoprotéiques (RNP) pour donner le complexe SnRNP. Ce complexe va se fixer au niveau de l’intron à éliminer. Il se forme ainsi un autre complexe appelé Splicéosome nécessaire pour un déroulement correct du mécanisme de l’excision – épissage. VI – Contrôle de la transcription et régulation post – transcriptionnelle 1- Contrôle de la transcription La transcription étant un mécanisme assez complexe, des erreurs peuvent apparaître. Ainsi un système de contrôle est mis en marche depuis l’étape d’initiation jusqu’à l’étape de la terminaison. Ce système est constitué en général des protéines appelées Facteurs de Transcription (TF) qui s’associent à chaque étape, aux différentes structures de transcription. Exemples : TF II –A ; TF II –D. E 1 E 2
  • 25. 2- Régulation post – transcriptionnelle Elle est assurée par un système de régulateur composé de protéines dites régulatrices. Ces protéines sont caractérisées par : - leur situation à proximité du promoteur - leur interaction avec les protéines fixées sur le promoteur - leur variation d’un gène à l’autre. Ces protéines ne peuvent se rencontrer très en amont ou en aval d’un site d’initiation. On distingue deux grands groupes, le groupe des cis –régulateurs et le groupe des trans – régulateurs. L’association des deux groupes de facteurs de régulation joue un rôle quantitatif important dans la synthèse des ARNm. a- Régulation quantitative • Epissage alternatif Une cellule peut épisser le pré – ARNm de diverses façons pour donner plusieurs protéines différentes à parti d’un seul gène. Ce processus est appelé épissage alternatif ou différentiel, et l’exon éliminé est dit optionnel. • Edition La correction d’un ARN concerne tout traitement par addition, suppression ou substitution d’un ou plusieurs nucléotides aboutissant à la formation d’un ARNm dont la séquence diffère de celle du brin d’ADN lu au cours de la transcription. On distingue : - Edition par insertion d’une base et décalage du cadre de lecture. - Edition avec changement d’un codon ou triplet (substitution) . b- Régulation qualitative Elle fait intervenir les facteurs régulateurs de : - la stabilité de l’ARNm : cette stabilité peut être très variable et conditionne la durée de vie de l’ARNm. - Stockage de l’ARNm.
  • 26. TRADUCTION ET CODE GENETIQUE I – Le Code Génétique A – Définition Le code génétique correspond à l’enchaînement ordonné de trois bases (triplet) permettant de déterminer le code d’un acide aminé. Ce codage c'est-à-dire "séquence nucléotidique" correspond à séquence protéique, est assuré par un système de traduction présent dans le cytoplasme. Il faut noter qu’il existe dans la nature 20 acides aminés et 04 bases susceptibles de former des codons. La combinaison des bases donne 43 = 64 triplets. Ainsi un acide aminé peut être déterminé par plus d’un triplet. B- Caractéristiques principales 1- Code génétique défini par trois lettres Sur 64 codons disponibles 03 ne peuvent pas être traduits en acides aminés et sont appelés codons non – sens ou codons stop. Il s’agit de : UAA, UAG et UGA. 2- Code universel Le code génétique est le même dans tous les organismes vivants à quelques exceptions près. 3- Code génétique dégénéré Un même acide aminé peut être codé par plusieurs codons. Dans beaucoup de cas, les triplets nucléotidiques codant pour un même acide aminé ne diffèrent que par la troisième base.
  • 27. 4- Code génétique non chevauchant La partie exprimée en protéine d’un ADN est transcrite en ARNm, puis traduite triplet pat triplet selon un ordre bien précis. Les triplets nucléotidiques sont lus d’un point de départ jusqu’à un point de terminaison et ceci sans chevauchement. a- Notion de cadre de lecture (RF) Considérons l’exemple suivant : 1 2 3 4 5 6 7 8 9 ACG ACG ACG ACG ACG ACG ACG ACG ACG * Première façon de lecture : ACG ACG ………………. ACG (9) * Deuxième façon de lecture : CGA CGA ……………… CGA (8) * Troisième façon de lecture : GAC GAC ……………… GAC (8) Il y a donc trois cas de lecture possibles pour cet exemple. b- Cadre ouvert de lecture (ORF) C’est un cadre de lecture fait exclusivement de triplets représentant les acides aminés. c- Séquences traduites en protéines C’est un cadre portant un codon d’initiation généralement AUG (méthionine) et un codon de terminaison. d- Cadre de lecture bloqué C’est un cadre qui ne peut être lu et traduit en protéine car riche en codons stop. C- Les adaptateurs de synthèse protéique Il s’agit des aminoacyl- tRNA qui jouent un rôle important dans la traduction. 1- Synthèse des aminoacyl – ARNt Cette synthèse se fait en deux étapes en présence de l’ATP et de l’aminoacyl – synthétase. E1 : acides aminés + ATP aminoacyl – AMP + 2Pi E2 : aminoacyl – AMP + ARNt aminoacyl – ARNt + AMP 2- Fonction d’édition des aminoacyl – synthétase activation Aminoacyl – synthétase
  • 28. Cet enzyme reconnaît d’une part les bons acides aminés et d’autre part les tRNA correspondant. Il intervient donc dans les deux réactions précédentes et peut jouer le rôle de correcteur dans le cas de 02 acides aminés à structure proche. II – Traduction A- Localisation et éléments nécessaires La traduction s’effectue dans le cytoplasme au niveau des ribosomes et en présence d’autres éléments nécessaires pour la synthèse de la chaîne polypeptidique. Ces éléments sont les acides aminés, l’ARNm, l’ARNt, les aminoacyl – tRNA – synthétase, les peptidyl – synthétases. *ARNm : Il est porteur du message de l’ADN et indique par un codage nucléotidique, l’ordre des acides aminés dans la future chaîne polypeptidique. * ARNt : ce sont des adaptateurs entre les ARNm et les acides aminés. Ils transportent les acides aminés par leur extrémité 3’-OH et possèdent l’anticodon permettant de reconnaître les codons correspondants sur l’ARNm. B- Différentes étapes de la traduction Il y a trois étapes : Initiation, Elongation et Terminaison. Notons que la synthèse protéique se déroule de l’extrémité N- terminale à l’extrémité C- terminale du polypeptide en synthèse. Les ribosomes lisent l’ARNm dans le sens 5’-3’. La synthèse se déroule avec des polysomes. Chaque ribosome réalise sa propre synthèse protéique en décodant l’ARNm. Chaque ARNm peut être décodé par plusieurs ribosomes à la fois. 1- Initiation L’ARNm porte le codon initiateur en 5’-P, généralement le codon AUG codant pour la méthionine. Toutes les chaînes polypeptidiques commencent alors par la méthionine. Ainsi chez les procaryotes comme chez les eucaryotes, l’initiation nécessite la reconnaissance du codon AUG et la présence de ribosome.
  • 29. Au début de l’initiation de la traduction, les deux sous – unités du ribosome se dissocient, puis la petite sous – unité forme au niveau du codon initiateur, un complexe avec l’ARNm et l’ARNt portant la formyl –méthionine (procaryote) ou la méthionine (eucaryote). Fig. rechercher dans la bibliographie. La grande sous – unité viendra par la suite s’ajouter à cet ensemble. Les ribosomes possèdent deux sites de fixation des ARNt : - Un site A où se fixe l’ARNt porteur des acides aminés. - Un site P pour l’ARNt porteur de la chaîne peptidique en cours d’élongation. Fig. rechercher dans la bibliographie. 2- Elongation Elle comprend trois étapes permettant d’accrocher les acides aminés les uns aux autres par des liaisons peptidiques grâce aux peptidyl – synthétases. • Etape1 : Accrochage d’un aminoacyl – tRNA Un deuxième aminoacyl – tRNA vient se fixer sur le site A, le codon situé après le codon initiateur détermine l’anticodon qui va se fixer, c'est-à-dire l’aminoacyl – tRNA. ARNm 5’ 3’ • Etape 2 : Formation des liaisons peptidiques Elle commence par la rupture de la liaison entre la méthionine et le premier ARNt. Ce dernier est éjecté du ribosome, puis il y a formation d’une liaison peptidique grâce à une peptidyl – transférase, entre le groupement carboxylique de l’acide aminé N°1 (méthionine) et le groupement amine de l’acide aminé N°2. ARNm 5’ 3’
  • 30. A la fin de cette phase, on a la formation d’un dipeptide est logé dans le site A, le site P est alors libre. 5’ 3’ • Etape3 : Translocation Le ribosome se déplace d’un cran sur l’ARNm dans le sens 5’-3’ d’une distance de 03 paires de base. Ceci correspond à un déplacement de trois nucléotides. Un nouveau codon (codon 3) est placé en face du site A des acides aminés ; et le mécanisme recommence. La répétition de ce mécanisme, allonge la chaîne peptidique et conduit à l’étape de terminaison. 5’ 3’ 3- Terminaison La traduction est terminée quand le ribosome se déplaçant, se trouve en présence d’un des trois codons stop sur l’ARNm. Ces trois codons ne codant pour aucun acide aminé, il n’y a donc pas d’ARNt correspondant. Il se produit une rupture entre le dernier ARNt et le dernier acide aminé de la chaîne polypeptidique. Puis une molécule d’eau viendra former avec l’extrémité C terminal, le COOH de la nouvelle protéine. 5’ 3’ C – Intervention des facteurs de régulation La synthèse peptidique fait intervenir des facteurs protéiques essentiels pour le déroulement correct des étapes.
  • 31. Au niveau de l’initiation on a les facteurs d’initiation appelés IF (Initiation Factors) pour les procaryotes ou eIF pour les eucaryotes. Au niveau de l’élongation on a les EF (Elongation Factors) pour les procaryotes et les eEF pour les eucaryotes. Au niveau de la terminaison on a les RF pour les procaryotes et les eRF pour les eucaryotes. Notons l’existence des ARNt dits suppresseurs capables en cas d’erreurs, de supprimer les effets de certaines mutations. Ces tRNA sont aussi capables de supprimer des codons stop apparus prématurément et susceptibles d’arrêter la traduction et permettent ainsi d’éviter la synthèse de protéines raccourcies.
  • 32. OUTILS ENZYMATIQUES DE LA BIOLOGIE MOLECULAIRE LES ENZYMES DE RESTRICTION 1-GENERALITE La révolution technologique du début des années 70 a été fortement marquée par la notion et l’utilisation des enzymes de restriction. Cette utilisation a ouvert la voie à une exploitation technologique du matériel génétique (clonage, séquençage…). On assiste dès lors à une évolution importante du concept de gène et de la notion de polymorphisme. C’est en fait le début de l’ère des biotechnologies avec l’usage sous forme purifiée de courtes séquences nucléotidiques directement analysables, rendu possible grâce à la caractérisation d’endonucléases sites-spécifiques nommées enzymes de restriction ou endonucléases de restrictions ou ciseaux moléculaires. Ces enzymes de restriction sont en fait, des outils utilisés au laboratoire pour cliver les ADN. La coupure se fait en un site particulier reconnu spécifiquement par un enzyme et appelé site de restriction. Très nombreuses, ses enzymes sont capables de cliver les liaisons phosphodiesters entre deux nucléotides à l’intérieur d’un acide nucléique. Examples: Eco RI, Sma I. .2- Séquences d’ADN Reconnues par les Enzymes de Restriction Les séquences reconnues par les Enzymes de restriction sont souvent des séquences dites palindromique. Ce sont des séquences où la succession des nucléoniques lus dans le sens 5’ – 3’ pour le premier brin est identique à la séquence lue dans le sens droite-gauche pour le second brin. Exemple : 5’CCGG3’ 3’GGCC5’ . 3- Fréquence théorique des sites de restriction Les séquences palindromiques son généralement constitué de 4 à 6 paires de bases et sont rencontrées dans l’ADN avec une fréquence donnée. En général, la fréquence de coupure d’un ADN par un enzyme de restriction, peut être estimée statistiquement en considérant le nombre de nucléotide de la séquence spécifique reconnue par cet enzyme et/ou la fraction GC du DNA. Ainsi, en ne considérant que le site de restriction : F = 1/4n ; avec n, le nombre de nucléotide de la séquence spécifique Exemple : la séquence GATC reconnue par l’enzyme de restriction Mbo I est présente avec une fréquence statistique de 1/44 soit 1/256.
  • 33. En prenant en considération le nombre de nucléotides de la séquence spécifique reconnue par cet enzyme et la fraction GC du DNA, on estime que la probabilité P de rencontrer un site est : P= p² (1-p)²/2n P: fraction GC 1-p : Fraction AT n: le nombre de nucléonique de séquence spécifique L’inverse de cette probabilité représente la distance moyenne entre 2 sites pour cette enzyme dans cet ADN Exo : On considère un DNA contenant 40% de GC et 2 ER Sau3AI (GATC) et BamHI (GGATCC). 1- Calculer la probabilité de rencontre chaque site sur ce DNA 2- Déterminer la distance moyenne entre 2 sites de chacune des ER. La distance moyenne entre les sites prédit comment est centrée la distribution des tailles réelles des fragments. En réalité l’analyse est purement probabilistique car la distribution des bases n’est pas toujours régulière ; de plus pour des raisons de mutation et réparation, certaines séquences ne sont pas présentes aussi fréquemment qu’il est prédit par les analyses statistiques. 4.- Origine des Enzymes de Restriction Les enzymes des restrictions sont extraites de microorganismes en particulier des bactéries, et le plus souvent des bactéries parasitées par des virus à ADN. Une souche peut porter jusqu’à une dizaine de ER. Ces enzymes servent à cliver les ADN étrangers comme ceux des virus en reconnaissant de courtes séquences de nucléotides qu’elle hydrolyse en présence de Mg2+ . 5 – Nomenclature des Enzymes de Restriction Le nom d’un enzyme de restriction comporte des lettres et est lié à la bactérie sources. - La première lettre est écrite en majuscule et correspond au genre de la bactérie source. - La seconde et la troisième lettre écrites en minuscules, correspondent à l’espèce de la bactérie source. - Une probable quatrième lettre écrite en majuscules, est en rapport avec la souche bactérienne. - Un chiffre romain vient indiquer l’ordre de caractérisation de l’enzyme de restriction. Exemples : voir tableau
  • 34. . 6- Types de coupures réalisées par les enzymes de restriction Les enzymes de restriction coupent l’ADN autant de fois qu’il y a de sites de restriction leur correspondant. L’ADN est donc découpé en fragments de taille variable. D’où l’importance de ce type d’outil enzymatique dans les techniques biologiques. Les enzymes de restriction peuvent donner deux types de coupure selon la forme des bouts obtenus : - Coupure à bout franc : coupure en milieu de la séquence palindromique. - Coupure à bout collant ou à extrémité adhésive qui se fait de part et d’autre d’un centre de symétrie imaginaire. On peut considérer ici les exemples de HaeIII, et de EcroRI Exemple 1 : Coupure de l'ADN double brin par HaeIII, générant des extrémités franches. Hea III est une enzyme de restriction produite par Haemophilus aegypticus. Le site de liaison à l’ADN est formé de quatre paires de nucléotides 3’CC/GG 5’
  • 35. Lorsque l’hydrolyse des liaisons phosphodiesters se fait au centre de symétrie du palindrome, toutes les paires de nucléotides restent appariées : les fragments qui en résultent sont dits « à bouts frances. Exemple 2 : Coupure de l'ADN double brin par EcoRI, générant des extrémités cohésives. EcoR I est une enzyme de restriction produite par Escherichia coli, souche R. Le site de liaison à l’ADN est formé de six paires de nucléotides 5’G/AATTC 3’ Lorsque l’hydrolyse des liaisons phosphodiesters se fait loin du centre de symétrie du palindrome, certaines paires de nucléotides restent non appariées. Les fragments qui en résultent sont dits « à bouts collants ou à extrémités cohésives». 7 – Classes des Enzymes de Restriction Les enzymes de restriction sont groupés en trois classes (I, II, III) selon la position du site de coupure par rapport au site de reconnaissance. 7.1 – Enzymes de type I Ils coupent non pas au niveau de la séquence de reconnaissance, mais 1000 à 5000 pb plus loin. 7.2 Enzymes de type II Ils sont caractérisés par un site de reconnaissance identique ou proche du site de coupure. Ce groupe est le plus utilisé au laboratoire à cause des propriétés suivantes : - L’attaque endonucléolytique a lieu dans la séquence reconnue ou à une distance proche du site (moins de 25 pb) - Les fonctions d’endonucléase et de méthylation sont dissociables car portées par des protéines distinctes ; on peut purifier et utiliser les deux enzymes indépendamment. - Les extrémités générées peuvent être cohésives ou franches; la coupure laisse une extrémité 3’OH et une extrémité 5’P ; extrémités qui sont des substrats de ligases. Cette dernière propriété est intéressante pour la manipulation des gènes. Exple : EcoRI, HaeIII,….. 7.3- Enzymes de type III
  • 36. Leur site de reconnaissance est séparé du site de coupure par une vingtaine de nucléotides au moins. .8- Inactivation des Enzymes de restriction et Méthylation L’ADN bactérien présente des sites de restriction repérables par les enzymes de restriction que possède la bactérie. Pour éviter une autodestruction, la bactérie fait intervenir ses enzymes de restriction que possède la bactérie. Pour éviter une autodestruction, la bactérie fait intervenir ses enzymes de modification de l’ADN qui sont souvent des méthylases. Ces enzymes reconnaissent le même site que l’ER et lient de façon covalente un groupement méthyle aux résidus adénine et guanine de la séquence cible. Cette méthylation peut se réaliser sur une ou plusieurs bases appartenant à un site de restriction. Ce qui entraine l’inactivation du site. La méthylation ne modifie pas les propriétés d’appariement des bases, mais fait saillit dans l’un des sillons de l’hélice, empêchant ainsi l’ER de s’associer à l’ADN; le chromosome devient alors résistant. On parle de systèmes de Restriction/modification(RM). Exemple de EcoR I Fig.: Systèmes de restriction et de méthylation. Considérons par exemple l’enzyme de restriction Hind III reconnaissant la séquence spécifique palindromique suivante : 5’AAGCTT 3’ 3’TTCGAA 5’ La méthylation de l’adénine ou de cytosines aboutit à une absence de reconnaissance de ce site (A/AGCTT) spécifique par Hind III et donc à une absence de coupure enzymatique.
  • 37. L’ADN, d’une bactérie ainsi méthylé, n’est pas hydrolysé alors que l’ADN parasite qui n’est pas méthylé sera hydrolysé. Exo : décrire les résultats de l’action de Hind III avant et après la méthylation. .9 – Utilisations des Enzymes de Restriction Les utilisations des enzymes de restriction sont très nombreuses en biologie moléculaire, en génie génétique, en biotechnologie etc. ………. On peut citer quelques exemples - Electrophorèse Les enzymes de restriction permettent la fragmentation de l’ADN pour séparation. Fig.: Gel d'agarose des produits de digestion d'un fragment de 5kb par deux enzymes de restriction. La figure au-dessous montre la digestion d'un fragment d'ADN de 5 kb par deux enzymes de restriction (BamHI et EcoRI). - Utilisation des ER de restriction pour établir la mappe de restriction
  • 38. Fig. 7: Les différentes possibilités de localisation des sites de restriction des deux enzymes (EcoRI, et BamHI). -Insertion et transfert de gènes Préparation des fragments d’ADN d’un gène destiné à être inséré dans vecteur pour un transfert -Recherche de mutation dans un génome -Recherche des méthylations de bases dans l’ADN Elle concerne des cellules eucaryotes. En effet, ces méthylations provoquent parfois le verrouillage de l’expression des gènes dans un tissu. Les méthylations concernent généralement les cytosines impliquées dans les doublets nucléotidiques CG. En pratique, la recherche de ces doublets et de la présence ou non d’une méthylation sur les cytosines est réalisée à l’aide de deux enzymes de restriction, une insensible et l’autre sensible à cette méthylation. Exemple de Msp I insensible et de Hpa II sensible. Des notions sont à retenir pour maitriser l’utilisation des enzymes de restriction notamment la notion d’enzymes compatibles et la notion d’isoschizomère . .9.1-Notion d’enzymes compatibles C’est une notion importante dans l’utilisation des enzymes de restriction. Deux enzymes sont dites compatibles si elles génèrent, après digestion, des fractions aux extrémités cohésives complémentaires. Ces fragments peuvent être facilement ligaturés. Exemple 1 : BamH I et BgtII (fig)
  • 39. *Exemple 2 : Bam HI (G/GATCC) et Mbo I (/GATC Considérons les fragments suivant reconnus et digérés respectivement par Bam HI et Mbo I. Action de Bam HI 5’ GGATCC 3’ 5’ G 3’ + 5’ GATC 3’ 3’ CCTAGG 3’ 3’ CCTAG 5’ 3’ G 5’ Action de Mbo I 5’ AGATCAGC 3’ 5’ A 3’ + 5’ GATCAGC 3’ 3’ TCTAGTCG 5’ 3’ TCTAG 5’ 3’ TCG 5’ Exo : Quels sont les fragments à bouts cohésifs ? .9.2 – Les Isoschiromère Ce sont des enzymes de restriction qui reconnaissent la même séquence nucléotidique, mais les fragments obtenus après leur action, ont des extrémités différentes. *Quelques exemples - les enzymes de restriction Kpn I (GGTAC/C ) et Acc 65 I (G/GTACC) agissent sur la séquence GGTACC. Exo : Décrire les résultats obtenus. Conclure. -Les enzymes Msp I (C/CGG) et Hpa II (CC/GG) reconnaissent et agissent sur la séquence CCGG. Exo : Décrire les résultats obtenus. Conclure.-
  • 40. Notons que Msp I est insensible à la méthylation et permet donc d’étudier les séquences CG dans un génome ; alors que Hpa II qui est son isoschizomère est sensible à la méthylation des cytosines. 9.3 – Polymorphisme de restriction C’est la variation individuelle d’une séquence de DNA par des modifications de longueur de fragment de restriction. Ainsi, suite à l’électrophorèse, on observe un polymorphisme de longueur des fragments de restriction connu sous l’abréviation R F L P (Restriction Fragment Length Polymophism). Le profil électrophorétique obtenu avec une enzyme de restriction donnée montre des différences individuelles dans la taille des fragments de restriction. Exemple chez l’homme : polymorphisme Msp I et gène de l’apoA-II Il existe un polymorphisme dans le gène de l’apolipoprotéine A-II. Lorsqu’on digère le DNA (gène apo AII) génomique de plusieurs individus choisis au hasard, on obtient des fragments de tailles différentes entre chaque point de coupure par l’enzyme. La plupart des sujets (81%) qui possèdent trois sites de coupure autour du gène donnent un fragment de 3000 paires de nucléotides (3,0kb). D’autres sujets, plus rares (19%) qui ne possèdent pas le site de restriction ont un fragment plus grand = 3700 paires de nucléotides (3,7kb). 9.4. Cartes de restriction Une carte de restriction est une représentation situant les positions des ER ou marqueurs génétiques. Les ER peuvent caractériser les DNA responsables des maladies héréditaires grâce aux cartes de restriction. La DNA du malade est digéré par de nombreuses enzymes de restriction isolément ou associées entre elles. Les fragments de restriction sont reconnus par une sonde spécifique du gène responsable de la maladie. Il en résulte un grand nombre de fragments possibles dont les longueurs (en kilobases) sont mesurées par électrophorèse à côté d’un marquer de masse moléculaire. Par exemple, les DNA d’un malade atteint d’une dysliproptoteinémie et celui d’un témoin sain digérés par BamH I : le sujet sain montre un seul fragment long de 11,65 kb reconnaissable par la sonde du gène de l’apoA-I, alors que le DNA du malade en montre deux de 7,5 et 10, 25 kb.
  • 41. LES TECHNIQUES DE BASE DE LA BIOLOGIE MOLECULAIRE INTRODUCTION Le dernier des connaissances en biologie, la biologie moléculaire a favorisé un progrès rapide de diverses techniques appliquées. Il existe maintenant de nombreuses techniques propres à la biologie moléculaire. Certaines sont plutôt pratiquées dans les laboratoires de recherche, d’autres sont non seulement utilisées au laboratoire, mais aussi dans les centres de contrôle et de biosurveillance des aliments et de l’environnent, dans les services sanitaires et même judiciaire. Des terminologies appropriées sont apparues avec les techniques biologiques et doivent être maîtrisées par le bio - ingénieur. En général, l'étude des processus liés à l’ADN nécessite un grand nombre de techniques expérimentales. Cela consiste à utiliser des méthodes pour l'extraction, la purification, la séparation, restriction, l'amplification, le séquençage etc…, des acides nucléiques. * QUELQUES TERMINOLOGIES - NOTION D’ADN RECOMBINANT C’est un ADN hybride obtenu au laboratoire par combinaison de deux ADN appartenant à deux espèces différentes. - NOTION D’ADN VECTEUR C’est l’ADN dans lequel on insère un fragment d’ADN à étudier ou à transférer. Le fragment inséré est appelé « insert » ou ADN étranger ou ADN exogène. Cette séquence nucléotidique est capable de s’auto-répliquer. - NOTION DE CLONE Un clone correspond à un grand nombre de molécules ou de de cellules identiques provenant d’un seul ancêtre. L’opération qui consiste à obtenir ce grand nombre s’appelle « clonage ». - NOTION DE SONDE NUCLEOTIDIQUE Une sonde nucléotidique est un segment de nucléotide qui permet de rechercher de manière spécifique, un autre fragment d’acide nucléique que l’on désire étudier. La réaction sonde – fragment recherché correspond à une hybridation. - NOTION D’HYBRIDATION MOLECULAIRE Après séparation des deux brins d’un ADN par fusion, si la solution d’ADN est refroidie lentement et dans les conditions et milieux favorables, une réassociation des brins est progressivement observée : c’est le phénomène d’hybridation moléculaire. Cette réassociation peut concerner 2 séquences d’ADN d’une même
  • 42. espèce ou d’espèces différentes ou encore une séquence d’ADN complémentaire. Elle est donc d’une spécificité très grande. - NOTION D’ADN COMPLEMENTAIRE (ADNc) C’est l’ADN fabriqué comme copie d’un ARNm et qui de fait est dépourvu d’introns. - NOTION D’ADN GENOMIQUE C’est l’ADN normal qui constitue le génome d’une cellule ou d’un organisme.
  • 43. EXTRATION – PURIFICATION ET MIGRATION ELECTROPHORETIQUE I - EXTRACTION ET PURIFICATION DE l’ADN 1 Extraction et purification du DNA *Définition et principe Toute étude de biologie et génétique moléculaire implique la disposition d'échantillon d'acides nucléiques. Les techniques d'extraction d'acides nucléiques sont relativement simples. Il convient simplement d'éviter toute destruction enzymatique ou mécanique. En effet les acides nucléiques qui sont stables dans la cellule intacte, deviennent très vulnérables à la digestion par les nucléases endogènes une fois la cellule lysée. 1 - EXTRACTION A PARTIR DU MATERIEL BIOLOGIQUE Les méthodes d’extraction utilisent parfois les enzymes. Chaque fois que l’on a été amené à traiter un acide nucléique par un enzyme, il est nécessaire de procéder à une purification pour éliminer ces enzymes avant de passer à d’autres étapes de travail. L’ADN doit impérativement être purifié à partir de matériels biologiques propres et dans des conditions optimales de qualité au laboratoire. Dans la pratique, les acides nucléiques peuvent être extraits du sang total, des cheveux, des tissus broyés entre autres. Le procédé classique est l’extraction par le couple phénol - chloroforme. Le phénol est un excellant agent dénaturant des protéines. Il permet ainsi de séparer les protéines et les acides nucléiques. Le phénol est ensuite éliminé par extraction avec du chloroforme non miscible à l’eau. Il se forme alors deux phases : - une phase aqueuse contenant les acides nucléiques et les protéines résiduelles; - une phase organique contenant le chloroforme et phénol. Les deux phases peuvent être séparées par la méthode de centrifugation. La phase aqueuse contenant les acides nucléiques est recueillie puis traitée si nécessaire par des protéolyses ou agents clivant les protéines. Ce traitement permet d’éliminer les traces de protéines restantes. Les acides nucléiques sont finalement récupérés sous forme solide à la suite de leur précipitation en présence d’alcool éthylique ou isopropylique. Actuellement, de nombreuses substances réactives permettant de faciliter les opérations de purification sont disponibles. Il est ainsi possible d’extraire les acides nucléiques à partir de plusieurs échantillons biologiques comme les cultures cellulaires, les tissus animaux ou végétaux etc.… *Méthode pratique : exemple de sang (Fig)
  • 44. Fig. 1 : Extraction/Purification de DNA Aussi les méthodes d’extraction au laboratoire doivent être adaptées au type de tissus et au matériel disponible. Notons que lorsque les acides nucléiques viennent des extraits cellulaires, les protéines sont au préalable hydrolysées par les enzymes protéolytiques comme la protéinase k. 2. - ESTIMATION DE LA QUALITE ET DE LA QUANTITE DE L’ADN a. - VERIFICATION DE LA PURETE DE L’ADN. Elle se fait grâce au spectrophotomètre Une lecture de la densité optique (Do) en U.V permet de vérifier la pureté du DNA obtenu. En général quand la pureté est nette, un pic à 260 nm doit être observé. Par ailleurs, le rapport RDO = Do(260nm) / Do(280mn) doit normalement être égal à 1,8. - Si RDO > 1,8 -→ contamination par des RNA - Si RDO < 1,8 -----→ contamination par les protéines ou par du phénol. b - ESTIMATION DE LA QUANTITE DU DNA Cette étape est indispensable, après extraction de l’ADN à partir du matériel biologique. Deux méthodes peuvent être utilisées :
  • 45. * La spectrophotométrie L’estimation quantitative de l’ADN peut se faire par spectrophotométrie dans l’U.V à 260 mn. C’est la longueur d’onde correspondant à l’absorption maximale du DNA. Cette absorption se définit par unité de Do mesurée toujours à 260 mn (UDo) 1 UDO correspond à l’absorption d’une solution de DNA double brins à la concentration de 50 microgr / ml ou à l’absorption d’une solution de DNA simple brin (RNA) à la concentration de 25 microgr / ml. * Méthode en minigel. Elle est utilisée lorsque l’on ne dispose pas de DNA en quantité suffisante pour mesurer la densité optique en UV. Le principe consiste à comparer l’intensité de la tâche en UV de l’échantillon étudié à celle donnée dans les mêmes conditions par un DNA standard déposé en quantité connue. II - TECHNIQUE DE SEPARATION ELECTROPHORETIQUE C'est une technique de bioséparation permettant la séparation des biomolécules selon leur charge et leur taille (ADN, ARN, protéines). 1 - Principe L’ADN est soumis à un champ électrique dans une cuve électrophorétique. Cette technique permet non seulement de séparer les fragments d’ADN mais aussi de déterminer leurs tailles et leur poids moléculaire (PM). Après purification, les ADN peuvent être digérés par des enzymes de restriction. On obtient ainsi des fragments de DNA de tailles et de PM différents qui permettent d’étudier les caractéristiques de l’ADN (PM, nature des bases…). Il est fréquent au laboratoire d’avoir à séparer ces fragments de DNA par électrophorèse. En effet, à pH neutre, le DNA est chargé négativement. Ainsi encadré par l’anode et la cathode de la cuve électrophorétique, il migre vers l’anode avec une vitesse de migration des fragments inversement proportionnelle au logarithme de la taille. 2 - SUPPORTS ELECTROPHORETIQUES a - Gel de polyacrylamide Il est utilisé pour séparer des petits fragments de DNA de taille inférieure à 500 paires de bases. On prépare généralement des gels à 15% pour les DNA de 25 à 150 nucléotides, ou des gels à 5% pour les DNA de 80 à 500 nucléotides. La migration est effectuée souvent en position verticale. b - Gel d’agarose
  • 46. Il sert plus spécifiquement à séparer des fragments de tailles comprises entre 0,2 – 80 kilobases. C’est un gel à 1,5% pour les DNA de 0,2 – 5kb ; à 0,9% pour les DNA de 5-7 kb et inférieur à 0,9% pour les DNA de plus grande taille. La migration est effectuée en position verticale. c - Champ pulsé Pour de très gros fragments de DNA de taille allant jusqu’à 104 kb, on utilise souvent l’électrophorèse en champ pulsé pour la séparation. 3- ESTIMATION Dans toutes les électrophorèses, des marqueurs de PM de DNA sont déposés et migrent parallèlement au DNA à étudier. Le DNA est repéré par fluorescence aux U.V après avoir été mis au contact avec le bromure d’éthidium (BET). En comparant l’emplacement du DNA échantillon avec celui du DNA marqueur, le PM et/ou la taille du DNA étudié peut être estimée. Exemple de figure d’électrophorèse du DNA (gel et filme)
  • 47. Fig.: Distance de migration en fonction du logarithme de la taille des fragments d’ADN. *Cas spécifique du gel d’agarose Dans ce cas, les fragments vont migrer selon leur taille plus que selon leur charge. Plus le fragment à une taille élevée, moins la migration électrophorétique, par rapport au puit d’inclusion, sera importante. La détermination précise des fragments séparés par électrophorèse est effectuée en faisant migrer des marqueurs de taille et PM connus, en parallèle avec des échantillons à analyser. La détection des fragments d’ADN sur ce type de gel est réalisée par exposition aux rayons UV, après réaction avec un réactif spécifique comme le BET par exemple. Le BET est un agent qui s’intercale entre les brins d’ADN. cDNA, HYBRIDATION ET SONDE 1. Le cDNA *Définition et principe Un cDNA est un DNA obtenue à partir d’un ARN. La manipulation et l’étude des RNA est difficile à cause de leur grande sensibilité aux ribonucléases qui les détruisent. Il est alors nécessaire de recopier la séquence en DNA pour qu’elle soit plus stable et qu’on puisse l’amplifier en fonction des besoins. *Méthode pratique d’obtention du cDNA
  • 48. Fig. : Synthèse de cDNA Le mRNA purifié (chromatographie d’affinité sur une colonne d’oligo-d(T)) est lié dans un premier temps avec des oligonucléotides poly(T) qui s’attachent à la queue poly(A). A partir de l’extrémité 3’ de cette amorce poly(T) la transcriptase réverse, qui est une DNA polymérase, synthétise un brin de DNA complémentaire du messager de départ. Une fois cette synthèse achevée, on dégrade le RNA par une base forte ou par une ribonucléase spécifique. Le brin de DNA fabriqué, forme spontanément à son extrémité 3’ une boucle en épingle à cheveux en s’hybridant sur lui-même. L’extrémité 3’ de cette boucle va servir de site de démarrage pour la DNA polymérase qui va synthétiser un brin de DNA complémentaire du premier. Une nucléase spécifique du DNA simple brin supprimera la boucle de l’extrémité. Le cDNA double brin est prêt. On peut ainsi constituer autant de cDNA qu’il existe de messagers dans une cellule : l’ensemble de ces cDNA forme une « banque de cDNA » 2. Les sondes et l’hybridation -*Hybridation des acides nucléiques L'hybridation est une propriété fondamentale des acides nucléiques qui repose sur les règles de complémentarité. Il est possible d'apparier des brins d'ADN ou ARN avec des oligonucléotides qui reconnaissent spécifiquement des séquences
  • 49. sur les brins d'ADN de manière antiparallèle et complémentaire. Ces oligonucléotides sont appelés sondes nucléiques (fig. 5). Dans le cas de deux brins complémentaires de la même molécule d'ADN (brins homologues), on parle de renaturation (hybridation à 100%). Fig.5: Hybridation des acides nucléiques *Hybridation et température d’hybridation Chaque 1% de non homologie diminue la température d'hybridation (Th) de 1°C. L'hybridation moléculaire est ainsi utilisée surtout dans la détection de l'homologie entre les molécules d'ADN de sources différentes. La complémentarité dépendra de la spécificité et de la sensibilité. -Mécanisme d’hybridation
  • 50. Un fragment de DNA double brin affecte normalement une structure secondaire en double hélice. En élevant la température jusqu’à la Tm, on disjoint 50% environ des liaisons hydrogène qui unissent les brins de DNA, ce qui dénature partiellement la double hélice. Lorsque la température atteint 95°C, toutes les liaisons hydrogène sont rompues et la dénaturation du DNA est complète. Le DNA simple brin obtenue, est qualifié de « dénaturé ». Au cours de cette dénaturation, le coefficient d’extinction du DNA à 260 nm augmente (hyperchromicité) En refroidissant brutalement (glace) les structures secondaires ne se reforment pas et le DNA reste dénaturé. Si on refroidit doucement, la double hélice se reforme progressivement. Un oligonucléotide (soude) ajouté à ce moment peut s’hybrider avec un fragment complémentaire du DNA, dès que la température descend en- dessous de la Tm. L’hybridation d’une sonde marquée (atomes radioactifs, radicaux fluorescents ou ligands spécifiques) sur un DNA dénaturé permet de marquer spécifiquement tous les fragments de ce DNA dont la séquence est complètement de la soude. - Méthode de calcul de la Tm
  • 51. Il est possible de mesurer directement la température de fusion (Tm) d’un DNA double brin en mesurant l’augmentation de l’absorbance de la solution à 260 nm en fonction de la température. Toutefois, on se contente, la plupart du temps, d’une estimation à partir de la composition de l’oligonucléotide. Si celui-ci a une longueur égale ou inférieur à 20 nt on compte 2°C par couple A : T et 4°C par couple G :C. A partir de N = 20, on corrige d’un multiplicateur proportionnel à la longueur au-delà de ce chiffre : 1 + [(N-20)/20] Lorsqu’il existe des mésappariements, il faut soustraire de la Tm calculée, autant de degrés C que le pourcentage de séquence non-appariée de l’oligonucléotide. - Sonde hybridée
  • 52. Fig.5: Reaction d’hybridation Pour pouvoir reconnaître spécifiquement une séquence du DNA, on utilise au laboratoire un petit morceau de DNA synthétisé (sonde) dont la séquence correspond au moins en partie à celle d’un des brins du DNA. Parce qu’elle est complémentaire de l’autre brin du DNA, la sonde est capable de se fixer spécifiquement sur l’autre brin à l’endroit où se lit la séquence complémentaire, En marquant cette sonde par un atome radioactif ou par une molécule fluorescente liés covalentiellement à un des nucléotides de la sonde, on peut détecter la sonde et le morceau de DNA complémentaire qui lui est hybridé.
  • 53. TECHNIQUE D’AMPLIFICATION GENIQUE OU TECHNIQUE PCR. I. DEFINITION ET PRINCIPE 1 - Définition Cette technique dite « Polymerase Chain Reaction » c’est à dire réaction de polymérisation en chaîne, décrite en 1985 permet d’augmenter et d’amplifier de manière considérable, la quantité d’ADN dont on dispose initialement. 2 - Principe Cette technique impose de connaître la séquence des régions qui délimitent le segment d’ADN à amplifier. Connaissant chacune des deux séquences sur une vingtaine ou une trentaine de nucléotides environs, on synthétisera des oligonucléotides complémentaires. Ces oligonucléotides auront deux fonctions : - ils permettent de repérer la partie du DNA à amplifier ; - ils serviront d’amorce ou primer à la DNA polymérase qui sera introduite pour les réactions de polymérisation. Fig : Amplification du DNA II - REALISATION PRATIQUE A la différence d’un clonage bactérien, le PCR est caractérisé par une amplification enzymatique in vitro.
  • 54. 1 - Cycles et phase de la PCR La technique PCR comporte des cycles successifs et chaque cycle comprend une succession de3 phases : - une phase de dénaturation par la chaleur à la température comprise entre 92 et 95°C. Elle dure 30 secondes à 1 minute et permet de séparer les deux brins d’ADN. - une phase d’hybridation avec deux amorces spécifiques à la température de 55- 60°C. Une amorce va se fixer sur un brin, la seconde amorce sur le brin complémentaire. Cette phase dure également 30 secondes à 1minute. Notons que la fixation sur les brins est rendue possible grâce à l’abaissement de la température de 95 à 55°C. - une phase d’extension par l’ADN polymérase à partir des amorces à 70 -72°C pendant 1 à 2 minutes. A la fin de chaque cycle, le nombre de brin d’ADN est multiplié par deux. L’amplification est donc exponentielle. En pratique, le rendement n’étant pas souvent de 100%, 30 à 40 cycles sont nécessaires et permettent d’amplifier l’ADN d’un facteur de 105 à 106 . 2. PCR ET POLYMERASES THERMOSTABLES -Taq Polymérase. La technique PCR connaît un grand essor depuis qu’il a été possible en 1988 d’utiliser une DNA polymérase non inactivée par la chaleur. Cette ADN polymérase, appelée taq polymérase, est extraite d’une bactérie thermophile et permet une automatisation des cycles. On peut ainsi effectuer un nouveau cycle sans avoir à ajouter à chaque fois l’enzyme polymérase. >Les différences entre l’ADN Taq Polymérase et l'ADN polymérase III. -Pfu polymérase L’ADN polymérase de l’hyper thermophile Pyrococcus furiosus (croissance optimale à 100°C, la bactérie d’une source hydrothermale), appelée Pfu polymérase est actuellement la meilleure polymérase thermostable pour la correction des erreurs de réplication (Fidélité élevée) grâce à son activité auto-correctrice. Cette enzyme est très utilisée lorsqu’une haute précision est requise. De plus elle est plus stable que la Taq polymérase. 3 - OPTIMISATION DES RESULTATS PCR Les résultats peuvent être optimisés en fonction d’un certain nombre de paramètres notamment :
  • 55. - concentration en Mg2+ ; - concentration en amorces ; - spécificité des amorces. Le choix des amorces est particulièrement crucial pour obtenir des résultats satisfaisants (paramètres physico – chimiques, taille, spécificités). Cependant d’autres facteurs peuvent également perturber cette optimisation C’est le cas par exemple de la contamination ou du pouvoir d’édition. * Cas des contaminations Il faut s’assurer de la spécificité des fragments à amplifier car il existe toujours un risque d’amplifier des DNA non désirés. Le fait de former le DNA amorce avec des séquences atteignant une vingtaine de nucléotides devrait rendre négligeable la possibilité de retrouver ailleurs la même séquence de nucléotides. Mais les conditions opératoires font que parfois, on peut amplifier d’autres fragments. * Fonction d’édition de la Taq polymérase La taq polymérase présente une activité exonucléasique 5’ – 3’, mais elle est dénuée d’activité exonucléasique 3’ – 5’, c'est-à-dire, de la f onction d’édition. Elle peut alors insérer des bases qui ne suivent pas la règle d’appariement. On estime qu’elle réalise une mauvaise incorporation tous les 105 bases environs. III - PCR CLASSIQUE ET PCR EN TEMPS REEL (recherche personnelle, différences ?) IV- UTILISATION DES PRODUITS PCR. Les utilisations des produits PCR sont très nombreuses actuellement. Ces produits ont permis de développer plusieurs techniques. 1 - TECHNIQUE DU DOT –BLOT Elle utilise les produits PCR et permet de mettre en évidence des mutations ponctuelles au niveau d’un gène donné. Les produits PCR peuvent après transformation en monobrins, être hybridés avec des sondes oligonucléotidiques libres ou fixées sur un support solide. Ces sondes correspondent à des séquences normales ou pathogènes pour un gène donné. Les résultats de l’hybridation permettent de confirmer ou d’infirmer la présence de mutations qui peuvent être pathogène ou non. Ces techniques peuvent permettre de détecter entre autres certaines anomalies génétiques chez le fœtus. 1.1- ANALYSE DE RESTRICION ET DREPANOCYTOSE * Principe
  • 56. Les enzymes de restriction sont des endonucléases naturelles qui dégradent les brins d’ADN à partir des sites bien précis dits sites de restriction. Le produit PCR est soumis à une digestion enzymatique par une enzyme de restriction. Si une mutation ponctuelle modifie le site de restriction initialement présent, la taille des fragments d’ADN obtenus après digestion sera modifiée et décelable après électrophorèse des fragments d’ADN. * Exemple d’application : Gène responsable de la drépanocytose La mutation ponctuelle de GAG en GTG qui arrive sur le 6eme codon du 1er exon du gène b de la globine humaine, entraîne l’apparition des hémoglobines S (HbS). Ces HbS sont caractérisées par le remplacement dans la chaîne des acides aminés, de la Glu par la Val suite à la mutation. Cette mutation est responsable à l’état homozygote, d’une pathologie grave très répandue dans le monde : la drépanocytose. L’anomalie modifie ainsi le site de restriction GAG de l’enzyme Dde I qui est C / TGAG. * Description de la technique La séquence suivante représente les 9 premiers codons humains du 1er exon du gène b de la globine humaine. 1 2 3 4 5 6 7 8 9 GTG CAC CTC ACT CCT GAG GAG AAG TCT Avec l’enzyme de restriction Dde I, on aura après digestion, 2 fragments après électrophorèse dans les conditions normales. La mutation HbS conduit à une mutation ponctuelle au niveau du codon numéro 6. Elle entraîne alors la disparition du site de restriction de l’enzyme Dde I en transformant GAG en GTG. L’action de Dde I devient alors nulle. L’électrophorèse des produits PCR après digestion par Dde I permet de confirmer ou d’infirmer la présence de mutation GAG / GTG sur le codon N° 6 par comparaison des tailles des fragments. On peut donc confirmer l’état homo ou hétérozygote pour cette mutation responsable de la drépanocytose. 3 – TECHNIQUE PCR DANS L’ANALYSE DES ALIMENTS ET DE L’EAU Avec les techniques traditionnelles d’analyse microbiologiques, il faudra plusieurs jours voire semaines pour confirmer ou infirmer l’origine d’une toxi- infection. Ainsi, depuis quelques années, la technique PCR dans certains laboratoires d’analyse de l’eau et surtout des aliments permet d’obtenir des résultats précis. En quelques heures, il est possible, grâce à la PCR, de déterminer le type de microorganisme responsable d’une infection ou d’une intoxication par absorption d’eau ou d’aliment.
  • 57. 4 - TECHNIQUE DGGE ET SSCP Ce sont des techniques d’analyse électrophorétique des produits PCR qui sont particulièrement utilisées pour mettre en évidence les mutations ponctuelles au niveau d’un gène. Des produits PCR particuliers appelés amplimères sont formés si des mutations sont présentes sur l’ADN étudié (ou initial). Les produits PCR seront différents en fonction de la présence d’une séquence normale ou d’une séquence mutée. a - TECHNIQUE DGGE La DGGE « Denaturation Gel Gradien Eletrophoresis » c’est à dire électrophorèse de gel en présence d’un gradient d’agent dénaturant. C’est une technique qui permet de mettre en évidence une mutation ponctuelle en utilisant la température de fusion de l’ADN et un produit PCR. En effet la température de fusion d’un produit PCR c’est à dire la température moyenne de séparation des deux brins est fonction de sa séquence. Une mutation ponctuelle qui change la séquence entraîne une modification de la température de fusion Autrement dit, le changement de la température de fusion d’un produit PCR (ADN) suggère une modification de séquence et probablement une mutation. Cette mutation peut être ensuite directement mise en évidence par électrophorèse sur gel de polyacrylamide en présence d’un gradient d’agent dénaturant. b - TECHNIQUE SSCP La SSCP « Single Strand Chain Polymorphism » c’est à dire polymorphisme en chaîne d’un simple brin, est une technique basée sur l’analyse électrophorétique des produits PCR sous forme de fragments simples brin. Il s’agit d’amplifier par PCR une région d’un gène ou d’un ADN que l’on désire étudier, puis de comparer la mobilité de l’ADN dénaturée portant une mutation avec celle d’un fragment de référence comportant une séquence normale. Une mutation ponctuelle au sein d’une séquence modifie suffisamment la structure primaire de l’ADN monobrin pour qu’il en résulte des changements de migration électrophorétique sur gel. Actuellement, la technique de chromatographie en phase liquide à haute performance (HLPC) peut concurrencer la DGGE et la SSCP. V - Exemple d’application des techniques de BM dans la recherche de l’agent causal de l’ulcère de Buruli dans le district endémique de Tsévié L’ulcère de Buruli (UB) est une maladie grave de la peau, causée par une infection à Mycobacterium ulcerans. Elle entraîne la présence de plaies sur la peau qui sont en général des ulcères.
  • 58. C’est une maladie probablement liée au milieu de vie. Donc il s’est agi de rechercher les marqueurs génétiques de la bactérie chez les malades et les comparer avec ceux détecter dans l’environnement (plantes, eau, sol, ...) Ces dernières, les techniques de la BM, notamment le PCR et l’hybridation, ciblant la séquence génomique IS2404 jugée très sensible et spécifique, sont devenues des techniques de choix. Chez les patients suspectés d’ulcère de Buruli, l’utilisation de ces techniques permet de confirmer la maladie par la détection de l’insertion IS2404 sspécifique du gène de M. ulcerans. Recherche de M. ulcerans par la PCR chez les patients La PCR réalisée est dite classique ou conventionnelle. Echantillons biologiques utilisés On effectue des prélèvements chez le patient par aspiration de liquide sur les lésions pré- ulcéreuses ou par écouvillonnage à partir des ulcères. Etapes Trois étapes essentielles sont nécessaires : - Extraction d’ADN - Amplification de la région incluant IS2404 - Révélation par la technique d’électrophorèse sur gel d’agarose. Extraction d'ADN. L’ADN de l’échantillon est extrait en utilisant les réactifs suivants : - La solution de Lyse des cellules (CLS) - La solution d’hydratation de l’ADN - La solution de précipitation des protéines - La Lysozyme (10 mg/ml) - La Protéinase K (20 mg/ml) - Le Glycogen (20 mg/ml) - L’Ethanol 70% (Applichem) - Le 2-Propanol (Isopropanol) Cette extraction se fait en 4 étapes. La lyse cellulaire : La lyse des cellules est effectuée avec une solution de lyse des cellules et des enzymes en particulier la protéinase K (incubation à 55°C toute une nuit).
  • 59. La déprotéinisation : par l’utilisation d’une solution précipitant les protéines suivi d’une centrifugation. Ces protéines sont ainsi déposées au fond du tube sous forme de débris. La purification de l’ADN Il s’agit de précipiter l’ADN avec une solution d’isopropanol dans le surnageant obtenu après l’élimination des protéines. L’ADN obtenu est ensuite lavé avec de l'éthanol 70%. Conservation de l’ADN Le culot d'ADN est séché et réhydraté dans une solution d'hydratation d'ADN. Il est conservé entre 2 et 8°C ou à -20o C en cas d’une longue durée de conservation avant l’amplification. Amplification de l’ADN de M. ulcerans - IS2404. Matériel utilisé - Thermocycleur - Bille PCR PuReady-Go-Taq • dNTPs • Mgcl2 • Taq polymerase - Amorces MU5 et MU6 - Eau distillée purifiée (DNAse/RNAse free) Séquences des amorces : Sens (MU5) : 5'agcgaccccagtggattggt 3' Anti-sens (MU6) : 5'cggtgatcaagcgttcacga 3' Préparation du mélange réactionnel ou Master Mix Réactifs N = 1 (µl) N+2 (µl) Billes Pure Ready Go-Taq 1 Bille Eau 20 Amorce MU5 1,25 Amorce MU6 1,25 Total 22,5 ADN 2,5 Le programme d’amplification utilisé dans le thermocycleur est le suivant :
  • 60. Tableau du programme d’amplification : Température Temps Cycles 95°C 10 min 1 95°C 58°C 72 °C 10 sec 10 sec 30 sec 40 72°C 10 min 1 15°C --- Prise en main Électrophorèse des produits PCR (amplicons) sur gel d’agarose Matériel - Poudre d’agarose - Tampon TBE, 10x - GelRedMD - Loading dye Blue juice, 10x - Marqueur de poids d’ADN, 100 bp (Invitrogène) Principe : Les produits PCR (amplicons) ont été séparés par électrophorèse sur gel d’agarose selon leurs poids moléculaires. Préparation du gel : Un gel d'agarose à 1,5% a été préparé en dissolvant 1,5g d'agarose dans 100 ml de tampon TBE 1X. Le résultat est le suivant : MP 1 11 12 3 13 4 14 5 15 6 16 7 17 8 18 CP CN MP Légende MP : Marqueur de poids Echantillons positifs : A (1-11) ; B (2-12) Bandes d’échantillons : 1 ; 2 Bandes de contrôle d’inhibition : 11 ; 12 Echantillons négatifs : C (4-14) Bandes échantillons : 4 Bandes de contrôle inhibition : 14 CP : Contrôle positif CN : Contrôle négatif 500 Pb MP 1 11 2 12 3 13 4 14 5 15 6 16 7 17 8 18 MP A B C C CP CN P
  • 61. Figure A : Electrophorèse sur gel d’agarose des produits d’amplification PCR pour la détection de l’insertion IS2404 Recherche de M. ulcerans par la PCR dans l’environnement Exo : décrire comment procéder. Examen comparatif des marqueurs M. ulcerans Conclusion Ce travail a permis grâce à l’analyse moléculaire de confirmer la présence de M. ulcerans dans l'environnement des districts de Zio et de Yoto de la région maritime au sud Togo. MP 1 11 2 12 3 13 4 14 5 15 6 16 7 17 Légende MP : Marqueur de poids Echantillons inhibés : D (3-13) Absence de bande d’échantillon : 3 Absence de bande de contrôle d’inhibition : 13 500 Pb D
  • 62. TECHNIQUES DE SEQUENÇAGE DE L’ADN Le séquençage d’un ADN consiste à identifier les différentes bases qui constituent les chaînes de cet ADN. Deux techniques sont généralement utilisées : - technique de SANGER - technique chimique de MAXAM et GILBERT I - TECHNIQUE DE SANGER 1 - Principe Cette technique enzymatique dite encore séquençage au didesoxyribonucléotide triphosphate (ddNTP) est la plus utilisée actuellement pour effectuer le séquençage d’un fragment d’ADN. C’est une technique basée sur la copie d’un fragment d’ADN monocaténaire que l’on désire séquencer par l’ADN polymérase. On utilise des ddNTP pour assurer l’incorporation. En effet le ddNTP est un analogue du dNTP mas ne possède pas de OH en 3, du désoxyribose. Ainsi, il s’incorpore normalement dans une chaîne nucléotidique en cours de synthèse. Mais cette incorporation du ddNTP par l’ADN polymérase bloque l’allongement de la molécule d’ADN en cours de synthèse. Rappelons que l’allongement d’une chaîne polynucleotidique par un ADN polymérase nécessité en effet un groupement – OH en 3 du ribose disponible 2- Synthèse des ddNTP -Les différentes formes des nucléotides. Exemple de synthèse du Didésoxyadénosine triphosphate ddATP
  • 63. 3- Réactions de Séquençage a- Réactions enzymatiques de synthèse du brin complementaire Les réactions s’effectuent en traitant de manière parallèle 4 tubes contenant chacun : - le brin d’ADN obtenu après fusion ; - les 4 types de desoxyribonucléotides (dNTP) ; - l’amorce universelle ; Mg2+ - la DNA polymérase qui est généralement la taq polymérase ou Pfu Polymérase. Chacun des tubes contient en outre un type de ddNTP en quantité bien définie proportionnellement aux desoxyribonucléotides associés. Le travail se fait toujours dans des conditions dénaturantes. NOTE si on change le sens du fragment, on aura pluto 2 AU LIEU DE 3 * Procédé pratiques Soit l’ADN bicentenaire suivant dont on désire déterminer la séquence : 5 GGT CAT CCA TGG ATT CGA 3 3 CCA GTA GGT ACC TAA GCT 5
  • 64. - Séparons préalablement les 2 brins de cet ADN par fusion et considérons le brin orienté 3 - - - - - - -5 - Réalisons une hybridation avec l’amorce de séquençage suivant : GGT CAT CC orienté 5 - - - - - - -3 5 GGT CAT CC- 3 3 CCA GTA GGT ACC TAA GCT- 5 - Laissons agir dans les 4 tubes : une réaction de séquençage démarre entre les dNTP (dATP, ddTTP, dCTP, dGTP ), les ddNTP (ddATP, ddTTP, ddCTP, ddGTP ) et la Taq polymerase. Les 4 tubes sont identifies en A, T, G, C comme l’indique le tableau suivant : TUBE A T C G Taq poly + + + + dNTP + + + + ddNTP ddATP ddTTP ddCTP ddGTP * Description des réactions Considérons le cas du tube A. Quand l’ADN polymérase en action arrive en face d’un T situé sur le brin de l’ADN matrice qu’elle est entrain de copier, elle doit incorporer A sur le brin complémentaire en voie de synthèse. Elle a alors le choix entre : - incorporer le d’AMP et donc la réaction de polymérisation se poursuit ; - incorporer le ddAMP et la réaction s’arrête. En effet, si la Taq polymérase incorpore de l’AMP, la réaction de synthèse se poursuit jusqu’au prochain A approprié et de nouveau, le choix s’offre entre dAMP et ddAMP. Ainsi, les molécules obtenues dans chaque tube sont très nombreuses. On a toute une famille de fragments de DNA synthétisés avec des tailles différentes selon que dNTP ou ddNTP a été au hasard incorporé. Mais dans tous les cas toutes les molécules se termineront obligatoirement par un ddNMP. Dans l’exemple choisi, il y aura dans le tube A, des fragments stoppés en face du premier « T » situé sur le brin à séquencer et formés donc de 9 nucléotides ; d’autres stoppés en face du 2nd « T » et ayant donc 13 nucléotides et d’autres encore devant le 3eme « T » avec 18 nucléotides.
  • 65. En appliquant le même raisonnement sur chacun des 3 autres tubes, on obtient finalement pour chacun des 4 tubes, les résultats suivant : TUBE A 5 – GGT CAT CCA 3’ ( 9 nucléotides) 5 – GGT CAT CCA TGGA 3’ (13 nucléotides) 5 –GGT CAT CCA TGG ATT GGA 3’ (18 nucleotides) TUBE T 5 – GGT CAT CCAT 3’ 5 – GGT CAT CCA TGGAT 3’ 5 – GGT CAT CCA TGG ATT 3’ TUBE C 5 – GGT CAT CCA TGG ATTC 3’ TUBE G 5 – GGT CAT CCATG 3’ 5 – GGT CAT CCAT TGG 3’ 5 – GGT CAT CCATGG ATT CG 3’ 2 - Séparation sur gel et autoradiographie * Marquage On voit finalement qu’avec cette technique, si l’amorce ajoutée est marquée en 5’P par un P radioactif 32 P, dans chaque tube, on aura différents fragments qui présenteront tous un marquage en 5’ - P. Dans le tube A on aura un brin 3’ - 5’ et l’amorce. Fig. rechercher dans la bibliographie. Ainsi, on verra les 3 espèces suivantes qui se terminent toutes par ddA en leur extrémité 3’- OH. Fig. rechercher dans la bibliographie. Le même raisonnement s’applique aux autres tubes T , C , et G et montre les différentes espèces ou fragments avec un marquage radioactif en 5’ – P. * Electrophorèse Après les réactions de séquençage, on dépose sur 4 pistes électrophorétiques séparés, les produits contenus dans les tubes A , T , C et G. Les fragments nucléotidiques sont alors séparés selon leur taille par électrophorèse. Les plus
  • 66. petits migrent plus loin. La distance de migration par rapport à leur position initiale varie selon la taille des fragments. * Autoradiographie et révélation A la fin de l’électrophorèse, le gel est séché, un film est appliqué sur ce gel ; et une révélation est effectuée après plusieurs heures de contact. Chaque petit trait vu sur le film correspond à un fragment nucléotidique radioactif terminé par un ddNTP. Si par exemple dans la piste 1 on repère 3 trais successifs en .9, 13 et 18, cela veut dire qu’il y a un « A » en position 9, 13 et18 dans le brin synthétisé. Le même raisonnement s‘applique aux 3 autres tubes. Fig. rechercher dans la bibliographie. La lecture de ce gel se fait de bas en haut c’est à dire des fragments de petite taille aux fragments de grande taille. Cette lecture nous donne comme résultat de Séquençage : 5’ - ATGGATTCGA - 3’ Connaissant la séquence du brin complémentaire qui vient d’être synthétisé, il est maintenant facile d’en déduire la séquence du brin matrice, soit : 3’ –TACCTTGCT – 5’ Soulignons que de nos jours, la radioactivité étant connue pour sa pollution et sa toxicité, le marquage se fait de plus en plus grâce à la fluorescence. Considérons un autre fragment de DNA à séquencer. Interpréter le schéma suivant :
  • 67. La détermination de l'enchaînement des nucléotides dans un fragment d'ADN simple brin par la méthode de Sanger comporte deux étapes, lesquels ? - Séquençage automatique : marquage des produits d'extension Dans le séquençage automatique, des marqueurs fluorescents sont utilisés, un marqueur différent pour chaque ddNTP (bleu, rouge, vert, orange...etc.). La polymérisation se fait dans un seul tube contenant le mélange réactionnel et les quatre ddNTPs. La séparation est faite selon la figure suivante.
  • 68. •Pour connaître la séquence des DNA, on fait synthétiser un brin du DNA par une enzyme spécifique. • L’enzyme commence son travail à partir de l’extrémité 3’ d’une sonde hybridée qui sert d’amorce. Elle ajoute des nucléotides complémentaires de ceux du brin de DNA qu’elle copie. • On lui donne pour substrats des désoxynucléosides triphosphates normaux mélangés avec des didésoxynucléotides dont la fonction alcool secondaire en 3’ est réduite ce qui empêche la synthèse de se poursuivre au delà. • Les didésoxynucléotides incorporés en dernier sont marqués spécifiquement par des molécules fluorescentes (vert pour didésoxyA, bleu pour didésoxyC, jaune pour didésoxyG et rouge pour didésoxyT) • On sépare ensuite les fragments synthétisés dans un champ électrique (électrophorèse : les DNA sont des anions, ils vont donc vers le pôle +), en fonction de leur longueur (les plus petits vont plus vite). • On lit ensuite les taches successives, identifiées par leur couleur, ce qui révèle la séquence des fragments synthétisés. II - TECHNIQUE CHIMIQUE DE MAXAM ET GILBERT Elle est peu utilisée actuellement pour des raisons de pollution. L’ADN à séquencer est tout d’abord marqué en 5’ avec du 32 P puis clivé après A, C, G ou T par divers réactifs chimiques. Exemples :