Qu'est-ce que l' ADN?
A cide
D ésoxyribo
N ucléique
ucléique
Qu'est-ce que l'ADN?
L'ADN est un long filament composé
d'une succession de lettres (A, T, C et G).
La succession de ces l...
Qu'est-ce que l'ADN?
Lorsque la cellule travaille et fabrique des
protéines, son ADN doit être déroulé pour
pouvoir être l...
L'ADN
Chr omatine et
chr omosomes
 Les molécules
d’ADN forment de
longues fibrilles
appelées
chromatine.
 Un chromosome est
un...
de nos parents?

https://www.google.es/#q=gene-abc.ch
Qu'est-ce que nous allons hériter de
nos parents?
Pendant la réproduction sexuel,
un espermatozoide de notre père, avec
l'...
Qu'est-ce que nous allons hériter de
nos parents?
Le zigote va se diviser et developper
pour donner un nouveau individu, a...
Qu'est-ce que c'est le CARYOTYPE ?

Le caryotype est une photographie
de l'ensemble des chromosomes d'une
cellule (numero ...
Le caryotype humain normal comporte
46 chromosomes, organisés en 23 paires.
On distingue 22 paires de chromosomes
appelés ...
Vous remarquez qu'il y a toujours un
nombre pair de chromosomes.
En

effet,

les

chromosomes

vont

toujours par paires: ...
La cellule est dite diploïde si elle a 2
jeux de chaque chromosome
(un paire, 1 chromosome qui vient de la
mère et 1 qui v...
n

n

Caryotype d'une cellule somatique 2n
Reconocer el cariotipo de pares de
cromosomas y el cariotipo de pares
de cromosomas en división

A

B
La str uctur e de
l’ADN
Le manuel d’instructions des processus de la vie : l’ADN
Des scientifiques découvrent la structure de l'ADN, le
fondement ...
Watson et Crick élaborent un modèle de l’ADN à
partir des travaux de Franklin (1953)
1953 Rosalind FRANKLIN démontre que l...
La fonction de l'ADN
ADN est l'abréviation d'acide désoxyribonucléique. C'est la
molécule de hérédité. Elle contient sous ...
L’ADN est composé d’unités
appelées nucléotides
 Un nucléotide

sucre désoxyribose
Les nucléotides
Un nucléotide est une molécule formée de trois parties:
Une base azotée
Les bases azotées sont des molécul...
Nucléotide

Phosphate

Base

Sucre
Il y a quatre sortes de bases azotées :

Les bases azotées adénine et guanine appartiennent au groupe
des purines alors qu...
4 bases de l’ADN
Cytosine

Adénine

Thymine

Guanine
Les nucléotides peuvent se lier les uns aux autres par leur
sucre (désoxyribose) et leur groupement phosphate :
●

i

Donc...
Phosphates
Sucres
Bases
Les paires de bases

A

T

C

G

2 liaisons hydrogène

3

liaisons hydrogène
La séquence de nucléotides
Le code génétique

A
C
ACGTTCAC
TGCAAGTG

T
G
La séquence de nucléotides
Le code génétique

A
C
ACGTTCAC
TGCAAGTG

T
G
Quelle est la longueur totale de
l’ADN du corps humain?
 Longueur d’une molécule
d’ADN ?
 Environ 3 à 5 cm


http://hypertextbook.com/facts/1998/StevenChen.shtml
 Longueur totale de l’ADN dans
une cellule humaine ?
 Environ 2 à 3 m



http://hypertextbook.com/facts/1998/StevenChe...
Longueur totale de l'ADN du corps
humain

= 2.0 × 10 mètres
13
C’est l’équivalent de 70 voyages allerretour entre la Terre et le Soleil !
Exercice sur les nucléotides (compléter
le tableau)
Nom de la base

symbole

Adénine

A

Cytosine

C

Guanine

G

Thymine
...
Les OGM

Organismes génétiquement
modifiés
Un organisme
génétiquement
modifié (OGM) est
un organisme vivant
dont le patrimoine
génétique a été
modifié par
l'Homme.
Élaboration des organismes
transgéniques
Les différentes étapes de la création
d'un OGM sont 
•L'identification et le clon...
BACILLUS THURIGIENSIS EN LAS PLANTAS DEL
ALGODON
Un
animal
transgénique est
un
animal
au
génome auquel a
été introduit par
transgénèse un ou
plusieurs gènes.
En agronomie, les plantes
génétiquement modifiées représentent
une des dernières évolutions des
méthodes d'amélioration de...
Avantages
1. Des aliments
avec une plus
grande
productivité

2. Des
aliments
plus nutritifs
Désavantages
1. Des risques
pour le milieu
naturel

3. Faute
d’information et
transparence

2. Faute de sécurité pour la
s...
Les inconvénients:







-qu’ils peuvent entraîner des allergies.
-qu’ils peuvent créer de nouvelles substances toxiq...
http://www.agromeat.com/53295/fresas-modificadas-geneticamente-logran-durar-mas-sin-perder-sa
D'AUTRES EXEMPLES
LES PYRALES DU MAÏS
SAUMON MODIFIÉ GÉNÉTIQUEMENT
DORYPHORE DE LA POMME DE
TERRE
Comment fabrique-t-on un OGM ?
Cultures de OGM dans le
monde
Principaux producteurs
(source http://www.isaaa.org/)
Pays
Etats-Unis
Argentine
Brésil
Canad...
Savez-vous vraiment ce que
vous mangez?
Étiquettes des aliments transgéniques

Voyez la différence...
Quels OGM a-t-on déjà produits et dans quel but?

La technique de
transgène est
récente. Seul un petit
nombre de plantes
t...
Les applications de la transgénèse
●

a)L'agronomie
___Pâtes à papier

●

●

b) L'industrie
c)L'alimentation

___Qualités ...
SOLUTIONS
L'AGRONOMIE:
●

●

L'INDUSTRIE

Résistance aux
herbicides

●

Pâtes à papier
Colorants

●

Résistance aux insect...
El PGM
CCCCTGACGACCGATTCAAAAACCACTTTCCTCTTTTACGGCGCCCTAGCGCTATGGCGGTGAAGACTGCTTGACATTAACATGCCTGTTGAGGCTAGAGAATCCATGCGAAGGCGGTTCGG...
LA BIOTECHNOLOGIE ET LES
MALADIES GÉNÉTIQUES
Nous sommes tous atteints de
maladies génétiques
Actuellement sur
18,000 gènes humains
«connus», 1,600 sont
associés à des...
Génome et médecine
• Il est évident que beaucoup de choses seront
petit à petit possibles. Par exemple:
– Diagnostique pré...
Merci de votre
attention…
Somos lo que comemos
Que el alimento sea vuestra
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
Prochain SlideShare
Chargement dans…5
×

CMC chapitre 6 la révolution génétique

992 vues

Publié le

CMC Chapitre 6: La révolution génétique

Publié dans : Formation, Technologie
0 commentaire
2 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

Aucun téléchargement
Vues
Nombre de vues
992
Sur SlideShare
0
Issues des intégrations
0
Intégrations
20
Actions
Partages
0
Téléchargements
37
Commentaires
0
J’aime
2
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

CMC chapitre 6 la révolution génétique

  1. 1. Qu'est-ce que l' ADN?
  2. 2. A cide D ésoxyribo N ucléique ucléique
  3. 3. Qu'est-ce que l'ADN? L'ADN est un long filament composé d'une succession de lettres (A, T, C et G). La succession de ces lettres dans un ordre bien déterminé constitue la séquence de l'ADN. La séquence de l'ADN contient toutes les informations nécessaires à la cellule pour fabriquer ces protéines.
  4. 4. Qu'est-ce que l'ADN? Lorsque la cellule travaille et fabrique des protéines, son ADN doit être déroulé pour pouvoir être lu: c'est la chromatine Cependant, lorsque la cellule veut se diviser, elle va devoir enrouler ce long filament afin de pouvoir le partager plus facilement. Ces sont les chromosomes.
  5. 5. L'ADN
  6. 6. Chr omatine et chr omosomes  Les molécules d’ADN forment de longues fibrilles appelées chromatine.  Un chromosome est un filament de chromatine enroulé plusieurs fois autour de protéines (histones)
  7. 7. de nos parents? https://www.google.es/#q=gene-abc.ch
  8. 8. Qu'est-ce que nous allons hériter de nos parents? Pendant la réproduction sexuel, un espermatozoide de notre père, avec l'information génetique à lui, et un ovule de notre mère, avec l'information génetique à elle, vont se fondre pour constituer le zigote
  9. 9. Qu'est-ce que nous allons hériter de nos parents? Le zigote va se diviser et developper pour donner un nouveau individu, avec des caracteres de la mère et du père
  10. 10. Qu'est-ce que c'est le CARYOTYPE ? Le caryotype est une photographie de l'ensemble des chromosomes d'une cellule (numero et forme). Il permet de dépister d'éventuelles anomalies chromosomiques.
  11. 11. Le caryotype humain normal comporte 46 chromosomes, organisés en 23 paires. On distingue 22 paires de chromosomes appelés autosomes, et 1 paire de chromosomes sexuels, présentant des caractéristiques différentes selon le sexe : ils sont notés XX chez la femme et XY chez l'homme.
  12. 12. Vous remarquez qu'il y a toujours un nombre pair de chromosomes. En effet, les chromosomes vont toujours par paires: un des membres de la paire vient la mère et l'autre membre vient du père.
  13. 13. La cellule est dite diploïde si elle a 2 jeux de chaque chromosome (un paire, 1 chromosome qui vient de la mère et 1 qui vient du père). Si n représente le nombre de chromosomes de chaque type, la formule chromosomique d'un individu s'écrit 2n = 46. Seulement les gametes (espermatozoides et ovules) sont des cellules haploïdes (n), car ils ont juste un chromosome de chaque paire
  14. 14. n n Caryotype d'une cellule somatique 2n
  15. 15. Reconocer el cariotipo de pares de cromosomas y el cariotipo de pares de cromosomas en división A B
  16. 16. La str uctur e de l’ADN
  17. 17. Le manuel d’instructions des processus de la vie : l’ADN Des scientifiques découvrent la structure de l'ADN, le fondement matériel de l'hérédité (1953) L'équipe de Watson et Crick propose un modèle de l'ADN à partir des travaux de Rosalind Franklin Crick Watson
  18. 18. Watson et Crick élaborent un modèle de l’ADN à partir des travaux de Franklin (1953) 1953 Rosalind FRANKLIN démontre que l'ADN possède une structure hélicoïdale grâce à sa radiographie par diffraction de rayons X. Elle en conclue que les squelettes désoxyribosephosphate sont à l'extérieur de la double hélice. • Rosalind Franklin • Morte à 38 ans d'un cancer • Son équipe a reçu le prix Nobel en 1962 mais pas elle !!! Radiographie de l'ADN par diffraction de rayons X
  19. 19. La fonction de l'ADN ADN est l'abréviation d'acide désoxyribonucléique. C'est la molécule de hérédité. Elle contient sous forme codée toutes les informations relatives à la vie d'un organisme vivant, du plus simple au plus complexe, animal, végétal, bactérien, viral. La fonction de l'ADN est de fabriquer les protéines dont l'organisme a besoin. L'ADN contient donc toutes les informations susceptibles de créer et de faire vivre un organisme.
  20. 20. L’ADN est composé d’unités appelées nucléotides  Un nucléotide sucre désoxyribose
  21. 21. Les nucléotides Un nucléotide est une molécule formée de trois parties: Une base azotée Les bases azotées sont des molécules organiques formées d'un ou deux cycles où alternent des atomes de carbone et d'azote. Un sucre, le désoxyribose. Le désoxyribose est un pentose (sucre à 5 carbones). Il a une formule semblable à celle du ribose . Un groupement phosphate
  22. 22. Nucléotide Phosphate Base Sucre
  23. 23. Il y a quatre sortes de bases azotées : Les bases azotées adénine et guanine appartiennent au groupe des purines alors que les bases thymine et cytosine appartiennent au groupe des pyrimidines. Les purines sont formées de deux cycles alors qu'il n'y en a qu'un pour les pyrimidines. Il y a donc quatre sortes de nucléotides
  24. 24. 4 bases de l’ADN Cytosine Adénine Thymine Guanine
  25. 25. Les nucléotides peuvent se lier les uns aux autres par leur sucre (désoxyribose) et leur groupement phosphate : ● i Donc, deux chaînes de nucléotides peuvent s'unir l'une à l'autre si leurs bases sont complémentaires, c'est à dire si le A d'une chaîne fait face à un T de l'autre et si le C d'une chaîne fait face au G de l'autre:
  26. 26. Phosphates Sucres Bases
  27. 27. Les paires de bases A T C G 2 liaisons hydrogène 3 liaisons hydrogène
  28. 28. La séquence de nucléotides Le code génétique A C ACGTTCAC TGCAAGTG T G
  29. 29. La séquence de nucléotides Le code génétique A C ACGTTCAC TGCAAGTG T G
  30. 30. Quelle est la longueur totale de l’ADN du corps humain?
  31. 31.  Longueur d’une molécule d’ADN ?  Environ 3 à 5 cm  http://hypertextbook.com/facts/1998/StevenChen.shtml
  32. 32.  Longueur totale de l’ADN dans une cellule humaine ?  Environ 2 à 3 m   http://hypertextbook.com/facts/1998/StevenChen.shtml
  33. 33. Longueur totale de l'ADN du corps humain = 2.0 × 10 mètres 13
  34. 34. C’est l’équivalent de 70 voyages allerretour entre la Terre et le Soleil !
  35. 35. Exercice sur les nucléotides (compléter le tableau) Nom de la base symbole Adénine A Cytosine C Guanine G Thymine Nucléotide complémentaire T Exemple d'un segment d'ADN de votre choix: filament codant (brin codant): TAC GAC CAC CTC TCC ACG GAC ATT filament complémentaire: ___ ___ ___ ___ ___ ___ ___ ___
  36. 36. Les OGM Organismes génétiquement modifiés
  37. 37. Un organisme génétiquement modifié (OGM) est un organisme vivant dont le patrimoine génétique a été modifié par l'Homme.
  38. 38. Élaboration des organismes transgéniques Les différentes étapes de la création d'un OGM sont  •L'identification et le clonage de la séquence d'intérêt à introduire dans l'organisme cible. •La réalisation du transgène, c'est-à-dire la molécule d'ADN à introduire dans l'organisme cible, il peut s'agir de la séquence d'intérêt seule, ou d'une séquence comportant plusieurs gènes. •L'introduction du transgène dans une cellule de l'organisme cible, puis son intégration au génome. •Dans certains cas une étape de régénération d'un organisme complet est nécessaire.
  39. 39. BACILLUS THURIGIENSIS EN LAS PLANTAS DEL ALGODON
  40. 40. Un animal transgénique est un animal au génome auquel a été introduit par transgénèse un ou plusieurs gènes.
  41. 41. En agronomie, les plantes génétiquement modifiées représentent une des dernières évolutions des méthodes d'amélioration des plantes.
  42. 42. Avantages 1. Des aliments avec une plus grande productivité 2. Des aliments plus nutritifs
  43. 43. Désavantages 1. Des risques pour le milieu naturel 3. Faute d’information et transparence 2. Faute de sécurité pour la santé des personnes
  44. 44. Les inconvénients:     -qu’ils peuvent entraîner des allergies. -qu’ils peuvent créer de nouvelles substances toxiques ou produire des substances déjà existantes, et donc polluer l’environnement. -qu’ils peuvent entraîner un non-fonctionnement des antibiotiques dans l’organisme et donc le laisser avec des défenses faible face aux maladies. -qu’ils peuvent infecter les champs voisins.
  45. 45. http://www.agromeat.com/53295/fresas-modificadas-geneticamente-logran-durar-mas-sin-perder-sa
  46. 46. D'AUTRES EXEMPLES
  47. 47. LES PYRALES DU MAÏS
  48. 48. SAUMON MODIFIÉ GÉNÉTIQUEMENT
  49. 49. DORYPHORE DE LA POMME DE TERRE
  50. 50. Comment fabrique-t-on un OGM ?
  51. 51. Cultures de OGM dans le monde Principaux producteurs (source http://www.isaaa.org/) Pays Etats-Unis Argentine Brésil Canada Chine Paraguay Inde Afrique du Sud Uruguay Australie Mexique Roumanie Philippines Espagne Millions d’Ha de PGM (2005) 49.8 17.1 9.4 5.8 3.3 1.8 1.3 0.5 0.3 0.3 0.1 0.1 0.1 0.1 62
  52. 52. Savez-vous vraiment ce que vous mangez?
  53. 53. Étiquettes des aliments transgéniques Voyez la différence...
  54. 54. Quels OGM a-t-on déjà produits et dans quel but? La technique de transgène est récente. Seul un petit nombre de plantes transgéniques sont disponibles, mais les applications sont nombreuses..
  55. 55. Les applications de la transgénèse ● a)L'agronomie ___Pâtes à papier ● ● b) L'industrie c)L'alimentation ___Qualités nutritionnelles ___Résistance aux herbicides ___Maturation des fruits ___Résistance aux insectes ___Vaccins ● d) La santé ___Produits sanguins ___Colorants
  56. 56. SOLUTIONS L'AGRONOMIE: ● ● L'INDUSTRIE Résistance aux herbicides ● Pâtes à papier Colorants ● Résistance aux insectes L'alimentation La santé Qualités nutritionnelles ● ● Maturation des fruits ● ● Vaccins Produits sanguins
  57. 57. El PGM
  58. 58. CCCCTGACGACCGATTCAAAAACCACTTTCCTCTTTTACGGCGCCCTAGCGCTATGGCGGTGAAGACTGCTTGACATTAACATGCCTGTTGAGGCTAGAGAATCCATGCGAAGGCGGTTCGGAAACTGCTTCGAAGGCGTGGGGTGGTGCGGGGGGTGG GATTTGAACCCACGCAGGCCTACGCCATCGGGTCCTAAGCCCGACCCCTTTGGCCAGGCTCGGGCACCCCCGCACCGTGTAGTCTTTAGGTTTAGCTTTCAGGGTTAAAACGGTTTAACACTCATGAGTATCACTGGGCTGGCTGTGACTGGGCTCTGC ATTCCCGAGGCCATGCTGCCCGTGAGGAATAACGGGTCTGAGGAGCCGTTGACAGGTTGCCATTTGGCCTTGCCCCCAAAAGTGATGCTGTGGATCACGACCTCCTCGGAGGAGGGGAGCCTCAGCATACACTTTATAATGAAGGCTTTAAGGGTTTAG CCGGATAATGTTGTTGGGGCGTGCAGCGGCAAGTGCTGCAGCTCATGGGTATGGTATGCGGCTTTGCCTGGTGATGCGGTTTGGCCCCCGTTGTCTGCGACGTCTGCGGTGTTAGGAGGGCTGTGGTGCTGCAGCGCCACACGGGAAGGCGGCTCTGCA GGGAGTGCTTTAGGGAGGATATAGTGGGGAGGGTCAGGAGGGAGGTTGAGAGGTGGGGGATGATAGGCCCTGGGGAGACGGTCCTCCTAGGCCTGAGCGGCGGTAAGGACAGCTATGTCCTGCTGGACGCCCTCTCCGAGATAGTCGGGCCCTCGAGGC TGGTGGCGGTGTCTATAGTGGAGGGCATACCGGGGTACAACAGGGAGGGAGATATCGAGAAGATCAGGAGGGTGGCCGCGGCTAGGGGCGTCGACGTGATAGTGACGAGCATAAGGGAGTACGTGGGGGCCAGCCTCTATGAGATATACTCCAGGGCCC GAGGGAGGGGGGCGGGCCACGCCGCCTGCACCTACTGCGGCATAAGCAGGAGGAGGATACTTGCCCTCTACGCCCGCCTCTACGGCGCCCACAAGGTCGCTACGGCCCACAACCTCGACGACGAGGCGCAGACAGCTATAGTGAACTTCCTCAGGGGGG ACTGGGTTGGCATGCTGAAAACACACCCCCTCTACAGGAGCGGGGGCGAGGACCTGGTTCCAAGGATAAAGCCTCTTAGGAAAGTCTACGAGTGGGAGACGGCCAGCTACGTGGTACTCCACCGCTACCCCATCCAGGAGGCTGAATGCCCCTTCATAA ACATGAACCCAACCCTCAGGGCGAGGGTGAGGACGGCCCTGAGGGTGCTAGAGGAGAGGAGCCCGGGCACCCTGCTCAGGATGATGGAGAGGCTCGACGAGGAGCTGAGGCCGCTGGCCCAGGCCATGAAGCCCTCCTCCCTAGGCAGGTGCGAGAGAT GCGGGGAGCCGACCAGCCCGAAGAGGAGGCTCTGCAAGCTCTGCGAGCTCCTGGAGGAGGCCGGGTTCCAGGAGCCCATCTACGCGATCGCAGGGAGAGGCAAGAGATTAAGGCTTCAGAGCCCCACCGCTAGCCCTGGGTGAACGCGCTATGGCAAAG CCAAAGGTTAGCCTGCCGGAGGATGTGGAGCCCCCCAAGGCTATAGTCAAGAAGCCTAGGCTAGTGAAGCTAGGCCCCGTAGACCCGGGGGTCAGGAGGGGAAGGGGGTTCAGCCTAGGCGAGCTCGCGGAGGCTGGGCTAGACGCTAAAAAGGCGAGG AAGCTTGGCCTGCACGTGGACACGAGGAGGAGGACGGTCCACCCGTGGAACGTGGAGGCCCTCAAGAAGTATATAGAGAGGCTTAGAGAGGCGGGCGTAGAGGTCTAGACCCCGGGGCTATATACTACCACTTCGCCCTCCCCATTATACTATCCACAT CCACCCTGGCCCTCCCCACCTCCAGGACCTCAATATCCCCCTCAGCCCTGGTGTACACGCTCAAAGACGGCTCCCTGTAGGAGGCCCTGGTCACCACCCCCACGTGAATCACCCCTCCCGCGTGTACGGCGGCTATAAGCCCCCTCTCCCAGCCCTCCC GGAGGACGCGGAGCCCGGAGCCTACTCCGACCCTACCGCCCCTCCTCGCCACAACCACTATGTCCCCGTCAACACTCTCACCATAGAGGGCGGCTGGGTGTAGGGCCTTGAGGGCCTCGTGGGCCAGAGGCTCCCCCCGGAATATCGGCGCGCCAACTA TCTCGGCCTCGCCGGGCCTGACCCTCCTCTCCCTCCCTCCCGAGGTCCTAAGGGCTATCAGCCTCTCCCTATGAAGAGCCCTCTCCCCCCGGCTCTTGCCCGCCTCTCCAGCCAGCCTCTCCACAGACAGAGTGTCAAGCCCCCACACCCTCTCGAGCA GCCTGGCCCGTCGGCTGGCTATGCCCACCGCGACTACAAGCCTTGCTCTAGAGGCTATGGCGAGGGCTGCCTTAGACTCGAGCCCCTCCCACAGTGATATCCAGCCATCTGTATCCACTACCACCTGGCTGGCCAGTGAGGCCAATCTAGATGCGCAGG CGAGGTAGCGGGACTCCGACCCCCGGGGGGTGAAGCCGCCGACGAAACACGGCTCGACACTCGAGAACGAGTCGTCTAGGCCCGGGACGGCCACGCCCTGTGGAGACGCCAGCGCCATAAACCCCGGGGCGAAGACCTCGTTCTGGCCTATATCCGCCG ACAGCAGTCTATACCCACCACCGCCCCTGTTAACTATCCAAGCCGCTAGTGTGCTCTTACCGGAGTCGCTCGGCCCCACAATAGCCACCCTGCCCCGCTGAGAGGCCTCCCTGGCTATGGAGTCGAACCTGTTGTAAGCCTCCTCCACGCCCCCTGTGG AGACTACACCGGACACAATAGCCCTCCCCTCAACCCTGGCGAGCACCGACCTGCCTGCAGGGACCACTAGAGTAGAGCCCTCCCCCAGCCTTCCACCCAAAACCTCTGCAGCACCCTCTACAACCTCTATCCTCCCCGGGCCGCGGACTAGCGCCGAGC CCCATGCAATCTCCACAGGCAAAGCTTTAAACCCCCAGTGGTAAGATATGTGAACCGGGCCGCGGTAGTATAGCCTGGACTAGTATGCGGGCCTGTCAAGGGCCCCGCCTCCGCCCCACCCTCATTCTACTACACGCTTATCAGGATAAACAGCCGGGC AAACGTTTTTAACCCCGCCGAAATTCATACTCTTCCCGGGGCGGAGGCGGGCCTGCGGAGAGCCCGTGACCCGGGTTCAAATCCCGGCCGCGGCGCCAATAATCCTCGCGGCCCGCCTTCAAGACTCACTAAACCCCGGTTGAGCACCCGCAGCATCGA TGCTAAGGCTCGAGCCATGCATAGTGCCCGCGGGGGGTGGGGGGATTTGGCGAGGCCTGTTGAGGCGGTAAAGAGGCTGCTGGAGAGGTGGCTGGAGGGTAGGAGGAGGGGTTATGTCCTTACGCTTGTAGCTCTTAGAAGGCTTGAGGAGAGGGGGGA GGAGGCTACTGTAGAGAGGGTTAGGGAGGAGGGCCTGAGGATTCTGGAGAGGACGGAGGGGAGGATAGACTGGGGTGTTACTAGGGATGAGTACACTGTCAACATGGTCTCCAGCGTTCTTCGCGAGCTGGCCGAGAGCGGCCTTGTCGAGATGGTGGA CGGCGGGAGGAGTATCGTCAGGTACAGGATAGCGAGGGATGCTGAGGAGGAGTTCCTCTCCAGCTTCGGCCACCTCCTGCAGCTTGTGAGGATGCCGAAGTAGCGTTAAAGCCCTAGGTGCCAGAGGCCGCCGGAGGCTAAGAGGCCGATGAAGGCCTT GAGAGGCTCTGCCGCCAAGCTATCCCTATCCCTGCTGCTCTTTTGGGCTAGCTACTCGATCTACTACACTATAACGAGGCGTGCTGTAGAGGAGGGCCTAGGAGAGGGATCCTACCTCCTGGGCGTCTTGATGTCGGGGGCTGAGGAGGCGCCGCTCGC GGCGTCAATAGTCCTTGGCTACCTGGCGGACAGGCTAGGCTACCGCTTACCCCTGGCCCTGGGCCTGTTTGAGGCTGGGCTGGTCGCTGCAATGGCCTTCACCCCCCTAGAGACCTACCCCATACTGGCTGGGGCTGCGTCGCTAGTCTACGCCCTCTC ATACTCCGCCCTAATGGGCCTCGTCCTGGGTGAGAGCGGGGGGAGCGGCTTCAGGTACAGTGTTATAGCAGCCTTCGGCAGCCTTGGCTGGGCTCTCGGCGGGTTGGCGGGGGGAGCGGCTTACTCCCGCCTGGGGTCACTGGGGCTCCTAGTGGCCGC AGCCCTCATGGCCGCCTCATACCTAGTCGCCCTCTCAGCCTCGCCCCCCCGCGGCGGCGCGGCGCCCAGTGTGGGGGAGACGATAACCGCTCTGAAGGGGGTTCTGCCCCTATTTGCAAGCCTCTCAACCAGCTGGGCGGCCTTGGGCTTCTTCTTCGG GGCTGCCAGCATAAGGCTTAGCGAGGCGCTCGAGAGCCCTATCGCCTACGGGCTAGTGCTGACCACCGTCCCCGCACTCCTAGGCTTCCTGGCGAGGCCTGCGGCGGGCAGGCTGGTCGACAAGGCCGGGGCTGTGGCAGTGCTTGCGTTGTCCAACGC GGCATACTCCCTTCTCGCCCTAGTTTTCGGCCTGCCCACCAGTCCGGCCCTGCTGGCCCTTGCATGGAGCCTGCCCCTATACCCCTTTAGGGATGCCGCCGCGGCCATCGCAGTTAGCAGCAGGCTTGAGAGGAGGCTGCAGGCGACGGCCGCGGGGCT GCTCTCAGCGAGCGAGAGCGTCGGCGGCGCTGCAACCCTTGCCCTGGCACTGCTCCTGGATGGGGGGTTTAGGGAGATGATGACGGCTTCAATAGCCCTTATGCTCCTCTCCACCCTACTCCTGGCCGCAGACCACTCTACGGCTCCACGCCGAGAGCC CTGTCCCCGGCGTCGCCAAGGCCCGGCACTATGAAGTAGTTCTCGTCCAGCTCGGGGTCTAGGGCTAGCGTGTATATGGGGGTGTCGCCGTAGAGGGATGATATGTACTCGACGCCCTGCCTGGACGCTATTATAGAGCCTATAACGACCTTGCTGGCC CCCCTGTCTCTGGCCAGCCTCACGGCCTCCGCCACAGTCTTGCCCGTGGCCAGCATCGGGTCTAGAACGACGGCGGGGCCGTCGAACATGCGGGGTAGCCTGGAGTAGTAGACCTCTATCTTGAGCCTGCCCGGCTCCTCGACCCTCCTGGCTGCTACG AGGGCTATCCTCGCCTCCGGCATCATCGAGGCGAAACCCTCTACCATGGGGAGGCTAGCCCCGAGTATCCCTACGAGGTAGACGGGCCCCGCTGGCGCCAGCTCCTTGGCCTTAGCCCCCAGGGGGGTCTCCACCTCCTCCTCCACCCACCCGAGCTCG CCCGCAATGTACACCGCCAGTATGGAGCCCGCTATCCTGACGTACCTCCTAAACTCCGGGAACCCGGTTGTCCGGTCCCTGAGAACCTTGAGGACGTAGCGCGCTAGGGGTGTTTCGCCCCCAATAACCCTAACTGCCGCCACCATGGGAACCTCTAGG TAGTGGTTGAGGCTCCGGAGCTTAAGAGGGTTAAACTCCAGGATGGCCACCTGGGTGCCGCCGGGGATTGGACAGTAGGGTTCTAGAGTCCGCGTTGAGAGCCCTATCCCGCTACCCCCTCTGCGACCGCTGCCTCGGCAGGCTCTTCGCTAGGCTTGG GAGAGGCTGGAGCAATAGGGAGCGGGGAGAGGCTGTCAAGAGGGTTCTGGTGATGGAGCTTCACAGGAGGGTCCTCGAGGGGGATGAGGCGGCGTTGAAAACCCTGGTCTCTGCAGCTCCGAACATAGGGGAGGTGGCAAGGGATGTCGTGGAGCACCT CTCCCCAGGTTCCTACAGGGAGGGCGGCCCATGCGCTGTCTGCGGCGGGCGGCTGGAGAGTGTTATAGCCTCAGCGGTGGAGGAGGGGTACAGGCTGCTAAGGGCTTACGATATCGAGAGGTTCGTAGTCGGGGTCCGGCTAGAGAGAGGTGTTGCCAT GGCTGAGGAGGAGGTAAAGCTGGCCGCCGGCGCCGGGTACGGCGAGTCCATTAAGGCTGAGATCAGGAGGGAGGTGGGCAAGCTCCTGGTGAGCCGGGGTGGAGTGACCGTGGACTTCGACAGCCCTGAAGCGACCCTAATGGTGGAGTTCCCCGGGGG CGGGGTTGACATACAGGTCAACAGCCTGCTCTACAAGGCTAGGTACTGGAAGCTTGCCAGGAACATAAGCCAGGCATACTGGCCCACGCCAGAGGGGCCGAGGTACTTCAGCGTGGAGCAGGCTCTATGGCCGGTTCTAAAGCTCACTGGGGGGGAGAG GCTGGTTGTACACGCTGCTGGCAGGGAGGATGTAGACGCCAGGATGCTGGGCAGCGGGAGGCCCATGATAGTCGAGGTCAAGTCGCCTAGGCGCAGGAGGATCCCGCTTGAGGAGCTGGAGGCGGCCGCCAACGCCGGCGGGAAGGGGCTGGTTAGGTT CAGGTTCGAGACGGCTGCCAAGCGTGCCGAGGTCGCGCTTTACAAGGAGGAGACTGCGAGGGTTAGGAAGGTGTACCGCGCCCTGGTAGCGGTGGAGGGTGGTGTTAGTGAGGTGGATGTTGAAGGGTTGAGGAGGGCTCTCGAGGGCGCGGTTATAAT GCAGAGGACGCCCTCCAGGGTCCTCCATAGGAGGCCGGATATACTGAGGAGGCGGAGGCTCTACAGCCTAGACTGCAGCCCCCTGGAGGGGGCGCCTCTGATGGAGTGCATATTGGAGGCGGAAGGGGGTCTCTACATCAAGGAGCTGGTCAGCGGTGA TGGCGGGAGAACCAGGCCAAGCTTCGCTGAGGTCCTCGGCAGGGAGGCTGTGTGTATAGAGCTCGACGTGGTGTGGGTGGAGCATGAAGCTCCAGCCGCACCCGGCTAAAGCTAAATTAAGCTGGGCTGAGCAAAATACCGGGGGGAGCGTAGGTTGGT CAAGGCACCTAGAGGCTATAGGAACAGGACTAGGAGGCTGTTGAGGAAGCCTGTGAGGGAGAAGGGCAGCATACCCAGGCTCAGCACCTACCTTAGGGAGTACAGGGTGGGCGATAAGGTGGCTATAATCATAAACCCCTCCTTCCCAGACTGGGGCAT GCCCCACAGGAGGTTCCACGGGCTGACGGGAACCGTGGTGGGGAAGAGGGGCGAGGCCTACGAGGTAGAGGTCTATCTGGGTAGGAAGAGGAAGACCCTCTTCGTCCCCCCCGTGCACCTCAAACCCCTCAGCACAGCCGCCGAGAGGCGGGGCAGCTA GAGCTGTCCCCACGGTTCCACGCTGGAGTAGGGGGTGCTAGTGTTGGAGAGGAGGATCCTAGAGTATAAGGCGGTGCCCTACCAGGTAGCCAAGAAGTATATGTACGAGAGGGTTAGGGAGGGCGACATAATATCGATACAGGAGTCGACTTGGGAGTA CTTCAGGAAGGTAGTGTTCTGGGACGACCCGGAGGCTGCCTCCGAGCTTGTTGAGGAGATTGTGAAGGAGGGTGTCAGCCGTGAGGCGCGGCGAACATCGCGAGCATATGCCCCAAGACCGAGGGCGAGCTCAGGAGCATTCTCGAGATGGACAGGAGC ATAACCTCCGTACACGAGATGGCTAGCAAACTGTACCCCATAGTTTCCAAATACTGCAAGGACTAGACCCCGCCCCCCTTCAGCCCGGGGATTAACAGTTTAATCTCCGCGTCCCAACCATATTTATGTTGATAGCGGCTGTACGGAGAGTGTTGAGAA GTGTCTAGACAGCCCCGCCCCCGCGACAGGAAGCCCCCCCACCAGGGGAGGCCGCAGCCCCACATCGCCGCCCTTGAGGTGGAGGCTATAGTTCTGGACTACATACCCGAGGGCTACCCGAGAGACCCCCACAGGGAGCACCGCAGTAAGCCCGTCGTT CAGGGTCTCGGGGTTAGGAGGCTGCACCTAGTCGACGGTGTCCCCCTCCATGAGGTCGATATACTGGAGCGGGTCACCCTGGCTAGGGAGGTTGTGTATAGCGTCCCCATAGTGGCCCGGCTCCCCGGGGGGGTCGAGAGGAGGGTGAAAAGTGTTACC GTCGCGGTAACATGCCTCCCCGGCCAGGCGCGGGAGGGCGGGGTCAGGGAGATATACTGCTACCCCCTCTCCTACGCCGACCAGGCGACCCTGGAGGCGCTGCAGCAGCTCCTGGGTGAGGGGGACGAGAGGCACAGGTATATACTTGTGGACTCCCCC GACAAGCTCTCCGAGGTGGCCAGAGGTCACGGCCTCTCGGGGAAGATAGTGAGCACGCCCAGAGACCCTATATCCTACCAGGACCTCACCGACGTCGCCAGGGCTACGCTGCCGGACGCTGTGAGGAAGCTGGTCAGGGAGAGGGAGGACTTCTTCGTG GAGTTCTTCAACGTGGCCGAGCCGATAAACATAAGGATACACGCGCTGGAGGCCCTAAAGGGTGTGGGTAAGAAGATGGCTAGGCACCTCCTCCTCGAGAGGGAGAGGCGTAGGTTCACGAGTTTCGAGGAGGTGAAGAAGATTCTGAAGATAGACCCC GCAGAGGCCCTGGCCGAGAAGATAATGGAGGAGATAGAGTGTAGGGACACTGTGAAATACTACTTCTTCGTCGAGCCCTGCGACCCCTCCAAGCCCTACCTAGGCTACACGGAGAGGATGTGGAAGGCCTATGCC Le génome humain est 380,000 fois plus long que la séquence qui est représentée sur cette image.
  59. 59. LA BIOTECHNOLOGIE ET LES MALADIES GÉNÉTIQUES
  60. 60. Nous sommes tous atteints de maladies génétiques Actuellement sur 18,000 gènes humains «connus», 1,600 sont associés à des maladies génétiques Il s’agit dans la plupart des cas de maladies «simples» (par opposition avec des maladies multifactorielles); Il est possible que plus de la moitié de nos gènes puissent être les «vecteurs» de maladies génétiques et ceci malgré la grande redondance de notre génome; Nous sommes sûrement tous porteurs de «défauts» plus ou moins graves.
  61. 61. Génome et médecine • Il est évident que beaucoup de choses seront petit à petit possibles. Par exemple: – Diagnostique précoce et guérison des cancers; – Thérapie génique pour corriger les «défauts» associés aux maladies génétiques; – Individualisation de la pharmacopée: déterminer le médicament adéquat et la dose optimale qui correspond au métabolisme personnel du malade; – Réparation des lésions de certains tissus. Examples: réparation du muscle cardiaque, guérison de la paraplégie/tétraplégie; – Développement d’antibiotiques et d’antiviraux très ciblés. ...
  62. 62. Merci de votre attention… Somos lo que comemos Que el alimento sea vuestra

×