SlideShare une entreprise Scribd logo
1  sur  80
Télécharger pour lire hors ligne
Organisation du Génome humain 
Notions essentielles 
Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion 
« How to sequence a genome » (film): www.genome.gov/25019885 
Human Genome Project: http://www.genome.gov/HGP/ 
Analyses génomiques en pathologie humaine 
Problématiques des études moléculaires en génétique humaine 
Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion 
Human Genome Variation Society: www.hgvs.org 
Nomenclature mutationnelle: www.hgvs.org/mutnomen 
Analyse de variants faux-sens: http://genetics.bwh.harvard.edu/pph/ 
Analyse de l’effet de variants de séquence sur l’épissage: www.umd.be/HSF/ 
Bases de données: 
Bases de données « locus-spécifiques » 
 Listing disponible site HGVS 
www.hgvs.org/dblist/glsdb.html 
Bases de données « centrales/globales » 
 Human Gene Mutation Database www.hgmd.org 
 SNP database www.ncbi.nlm.nih.gov/SNP/ 
 UCSC Genome Browser genome.ucsc.edu 
 Ensembl www.ensembl.org 
Dr. Martin Krahn 
martin.krahn@ap-hm.fr 
Département de Génétique Médicale 
Hôpital Timone Enfants 
INSERM UMR 910 - Faculté de Médecine 
Université de la Méditerranée 
Marseille
Organisation du Génome humain 
Notions essentielles 
Martin Krahn 
martin.krahn@ap-hm.fr 
Département de Génétique Médicale 
Hôpital Timone Enfants 
INSERM UMR 910 - Faculté de Médecine 
Université de la Méditerranée 
Marseille
Organisation du Génome humain 
Notions essentielles 
Quelques rappels historiques 
Séquençage du Génome humain 
Organisation du Génome humain 
M. KRAHN M2 2009
Génome 
= ensemble du matériel génétique 
d'une espèce (ADN) 
≠ ensemble des gènes !!! 
! 
M. KRAHN M2 2009
Pourquoi cartographier le génome ? 
 Clonage positionnel : 
identification de gènes par exploration du génome suivant un 
balisage de marqueurs 
 Médecine: 
pour localiser les loci morbides, associés à des maladies 
héréditaires, voire pour appréhender les maladies multifactorielles 
 Depuis les premières cartes, plus de 2500 gènes 
impliqués dans des syndromes héréditaires ont été identifiés 
(OMIM, sept.2009) 
Cette phase est suivie d’exploration thérapeutique 
(voir site essais cliniques AFM) 
 Agronomie: 
pour localiser et cloner les gènes d’intérêt ou les zones du génome 
impliquées dans des traits intéressants et les transférer entre 
espèces… 
Bond des biotechnologies végétales, clonage, OGM… 
M. KRAHN M2 2009
Histoire 
• De l’Antiquité au 19e siècle : transmission de 
caractères parents-enfants selon diverses théories: 
préformisme, animalculisme, patroclinisme, ovisme, 
épigénisme… 
• 1865: G. Mendel jette les bases de la génétique 
moderne, allèles, dominance, hétérozygotie… 
• 1910: T. Morgan découvre la recombinaison méiotique 
et publie ses résultats qui sont les bases de la théorie 
chromosomique de l’hérédité 
• 1913: première carte génétique 
M. KRAHN M2 2009
Histoire 
• 1953: J. Watson, F. Crick et R. Franklin décryptent des 
clichés de diffraction et publient la structure en double 
hélice de l’ADN 
• 1965: J. Monod, F. Jacob et A. Lwoff 
« découvrent » les ARN et la régulation de l’expression 
génique 
• 1973: moratoire sur le clonage et le génie génétique 
M. KRAHN M2 2009
Histoire 
• Années 1980: découverte des marqueurs 
polymorphiques, des techniques de RFLP, des 
microsatellites, grands progrès du génie 
génétique. Cartographie intensive 
• 1983: découverte de la PCR. Les cartes 
s’enrichissent de toutes ces techniques 
• 1989: un programme mondial de séquençage du 
génome humain se met en place : HUGO 
• 1992-1996: publication des premières cartes du 
génome humain par le Généthon 
M. KRAHN M2 2009
Histoire 
• 2000: premiers résultats de thérapie génique sur l’homme 
(Fischer) 
• 2001: premier assemblage de la séquence du génome humain 
(Science 291, Nature 409) 
• 2003: finition de l’assemblage de notre séquence génomique 
CELERA 
HUGO-HGP 
M. KRAHN M2 2009
HUGO – Human Genome Project 
• Plus grand projet scientifique mondial lancé en 1988/1989 
HGP démarre en 1990 
• Ampleur de la tâche 
– 1 page = 3000 bases 
– 1 tome: 500 pages = 1 500 000 bases 
– 1 génome = 1 000 tomes !!! 
• Capacité de séquençage 
– En 1975, 1 000 nucléotides/semaine  500 ans pour 100 personnes ! 
– En 1986, 10 000 nucléotides/jour  8 ans pour 100 machines 
– En 1998, 200 000 nucléotides/jour 5 mois pour 100 machines 
• Stratégie du Human Genome Project 
vs Stratégie de CELERA Genomics 
M. KRAHN M2 2009
HUGO - HGP CELERA 
HGP / Celera 
M. KRAHN M2 2009
Séquence finale 
• CELERA: Seuls 2 ADN ont servi de matrice (dont celui de C. 
Venter). Celera a intégré les données publiques dans sa base 
au fur et à mesure de leur publication 
• HGP: profondeur de séquence: 10X (10 équivalents 
génomiques séquençés) à partir de près d'une vingtaine 
d'individus différents 
• Travail de finition poursuivi jusqu'en avril 2003 
• Précision finale: 99.99 % = 1 erreur toutes les 10 000 bases 
environ 
• Coût global: environ 2.7 milliards $ 
• Parties manquantes: hétérochromatine, télomères et 
centromères M. KRAHN M2 2009
Coûts de séquençage 
M. KRAHN M2 2009
Organisation du génome humain 
1/3 2/3 
3% code des protéines 
50% séquences répétées M. KRAHN M2 2009
Le génome humain 
• Le génome humain est composé de 
3 272 millions de nucléotides 
• Les régions riches en gènes sont également les régions riches en 
nucléotides G/C 
• Les régions pauvres en gènes sont riches en A/T 
Ces différentes régions peuvent généralement être visualisées 
comme des bandes claires ou sombres sur les chromosomes 
métaphasiques (banding) 
Bandes G: riches en AT, pauvres en gènes 
Bandes R: riches en GC, riches en gènes 
• Le chromosome 1 contient le plus grand nombre de gènes 
estimés (environ 3000) tandis que le chromosome Y en a le 
moins (231) 
• Moins de 3% de l’ADN code pour des protéines 
• Les séquences répétées composent environ 50% de la totalité du 
génome M. KRAHN M2 2009
Le génome humain 
• Le nombre total de gènes se situe entre 25 000 et 30 000 
• La taille moyenne d’un gène est de 
3000 bases, 9 exons, mais la taille varie beaucoup 
(ex : le gène de la dystrophine a une taille de 2,4 millions bp) 
• 99.9% des nucléotides sont identiques entre deux personnes. 
Il existe donc 0,1% de différences (soit environ 3,5 millions de 
différences par génome) 
• Plus de 50% des gènes ont une fonction inconnue 
M. KRAHN M2 2009
Organisation du Génome 
Vitesse de réassociation du génome 
On dénature l'ADN par chauffage 
On mesure la vitesse de réhybridation 
L'ADN d'E. coli se réhybride suivant une courbe 
sigmoïde simple 
 quand un fragment d'ADN trouve son fragment 
complémentaire, les séquences adjacentes se 
réhybrident rapidement de façon coopérative, comme 
une fermeture éclair 
M. KRAHN M2 2009
Vitesse de réassociation du génome 
% de réhybridation 
100 
75 
50 
25 
0 
E. Coli 
10-2 10-1 1 101 102 
Rapide Lente 
Vitesse de réassociation 
H. Sapiens 
1 
3 
2 
M. KRAHN M2 2009
Le génome est hétérogène 
• Zones fortement répétitives 
 10 à 15% du génome, non codées en protéines 
Centromères, Télomères, 
Mégasatellites, Minisatéllites, Microsatellites 
• Zones moyennement répétitives 
 20 à 40 % du génome, non codées en protéines 
Transposons, séquences SINE (Alu) et LINE, 
Rétrovirus endogènes 
Quelques gènes codant des rRNA, tRNA, RNA5S et 7SL 
• Séquences uniques 
 ~50% du génome, contiennent la plupart des gènes 
codant pour des protéines (ARNm) 
M. KRAHN M2 2009
Les zones répétitives 
Les minisatellites ou VNTR (Variable Numbers of Tandem Repeats): 
- séquences de 11 à 16 pb 
- répétées parfois jusqu'à 1000 fois 
- Localisations surtout télomériques (ou centromériques) 
- peu utilisés en pratique 
Les microsatellites 
- séquences de 1 à 4 pb 
- souvent (CA)n, n variant de 12 à 40. 
- répartition homogène sur tout le génome, tous les 25 à 100 kb 
- très variables donc informatifs 
- facilement amplifiés par PCR 
- utilisation pour les analyses de liaison 
- utilisation en diagnostic moléculaire (« indirect ») et pour les 
empreintes génétiques 
M. KRAHN M2 2009
Marqueurs génétiques 
• Les MARQUEURS génétiques: 
Variations polymorphes de la séquence d’ADN 
- répartis uniformément sur le génome 
- localisation connue 
- PAS d’effet direct sur le phénotype 
• Microsatellites (utilisés ++) : 
Polymorphismes de répétition 
Exple: répétitions de motif « CA » 
- séquences répétées NON codantes 
- réparties uniformément dans le génome 
- polymorphes = à un même endroit du génome, des individus 
pris au hasard (pop.gén.) présentent 
un nombre différent de répétitions sur chaque chromosome 
Exemple: chromosome 4 
…ATCGTCTCACACACACACACACATGTCGTAT… 
…ATCGTCTCACACACACACACACACACACACATGTCGTAT… 
8 répétitions CA 
12 répétitions CA 
ADN 
Marqueur 
Gène 
M. KRAHN M2 2009
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
Clonage positionnel révolu – gènes localisés 
Agronomie dopée – OGM par analyse QTL 
Catalogue des gènes: GenAtlas, OMIM, Genome Browser, bases de 
données de SNP, de miARN… 
Séquençage en masse d'autres organismes 
 Cartes de synténie inter-espèces, évolution 
Séquençage personnalisé possible 
Nouvelles technologies mêlant bioinformatique, robotique et 
nanobiologie… 
Thérapie génique, pharmacologique ou cellulaire utilisant les 
données acquises… 
M. KRAHN M2 2009
Analyses génomiques 
en pathologie humaine 
M. KRAHN M2 2009
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
? 
M. KRAHN M2 2009
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
 Délétions 
 Duplications 
 Amplifications 
 Translocations 
 Inversions 
 Insertions 
(...) 
 Mutations ponctuelles 
 Insertions/délétions 
de qques nucléotides 
 Insertions/délétions 
de qques 10aines ou 100aines de nt 
 Mutations dynamiques/amplifications 
(...) 
Maladies génétiques: anomalies génétiques causales 
Maladies polyfactorielles: prédisposition génétique 
M. KRAHN M2 2009
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
METHODES D’ANALYSE 
? 
M. KRAHN M2 2009
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
CARYOTYPE METHODES D’ANALYSE 
FISH 
CGH 
CRIBLAGE 
MUTATIONNEL 
SEQUENCAGE 
M. KRAHN M2 2009
Rappel: Mutations « classiques » 
Exon Intron 
5´ CAAT TATA ATG 
3´ 
Région 5´UTR 
Mutations en séquence non codante: 
perturbations d‘éléments régulateurs 
mutations perturbant l‘épissage 
Région 3´UTR 
TAA 
TAG 
TGA 
AATAAA 
Mutations en séquence codante: 
faux sens 
non sens 
insertions/délétions 
décalage du cadre de lecture 
mutations perturbant l‘épissage 
= perte/gain de fonction 
GT AG 
Site donneur Site accepteur 
M. KRAHN M2 2009
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interprétation de données mutationnelles 
• Perspectives de criblage mutationnel à haut débit 
M. KRAHN M2 2009
Les avancées méthodologiques qui ont 
révolutionné la génétique moléculaire 
1970: Endonucléases de restriction 
1972-1973: Ligases 
1975: Séquençage (SangerCoulon, MaxamGilbert, Hood) 
1985: PCR (Karry Mullis) 
1998: Puces à ADN (“microarrays”) 
Années 1990 à aujourd’hui: Développement +++ de nouvelles techniques 
Les applications/progrès réalisées grâce aux techniques de 
Biologie moléculaire: 
• Meilleure connaissance des mécanismes physiopathologiques des maladies: 
- Identification et études fonctionnelles de gènes impliqués dans des 
maladies humaines, création et analyse de modèles animaux, séquençage du 
génome humain,,… 
• Généralisation des applications diagnostiques en routine hospitalière 
M. KRAHN M2 2009
Principes des Études Moléculaires en 
Génétique Humaine 
Transcription Traduction 
ADN 
Génome 
ARN 
Transcriptome 
Protéines 
Protéome 
Reverse Transcription 
Réplication 
Analyses génétiques/ Biologie moléculaire Biochimie 
M. KRAHN M2 2009
Principes des Études Moléculaires en 
Génétique Humaine 
En principe identique 
pour toutes les cellules d’un individu 
ADN 
Génome 
ARN 
Transcriptome 
Spécifiques d’un tissu 
d’un type cellulaire 
d’un état 
Protéines 
Protéome 
Analyses génétiques/ Biologie moléculaire Biochimie 
M. KRAHN M2 2009
Principes des Études Moléculaires en 
ADN 
Génome 
ARN 
Transcriptome 
Protéines 
Protéome 
En principe identique 
pour toutes les cellules d’un individu 
Spécifiques d’un tissu 
d’un type cellulaire 
d’un état 
Prélèvement de « base » 
en Génétique 
= prélèvement sanguin 
périphérique 
Extraction d’ADN 
génomique à partir de 
LYMPHOCYTES du sang 
Analyses en Génétique moléculaire: 
Directes ou Indirectes 
Autres prélèvements: 
•Tissus embryonnaires/foetaux 
(villosités choriales, liquide 
amniotique,…) pour DPN 
• Autres tissus: analyses 
complémentaires dans 
certaines pathologies (surtout 
analyses d’expression du 
ARNm) 
ATTENTION: 
Toujours avec 
CONSENTEMENT 
de l’individu 
Génétique Humaine 
M. KRAHN M2 2009
Notions essentielles 
• Stratégies de Diagnostic génétique 
- Diagnostic direct vs indirect 
- Précriblage mutationnel 
• Problèmes d’interprétation de données mutationnelles 
- Bases de données mutationnelles 
- Variants « nouveaux » = recueil d’arguments de pathogénicité 
- Outils bioinformatiques ++ 
• Perspectives de criblage mutationnel à haut débit 
M. KRAHN M2 2009
Stratégie diagnostique dans les 
maladies génétiques 
CONSULTATION DIAGNOSTIQUE: 
Interrogatoire et examen clinique Histoire de la maladie 
Arbre généalogique/mode de transmission 
Examen clinique ciblé 
Examen clinique général 
EXAMENS COMPLEMENTAIRES: 
Analyses biologiques selon le contexte 
Imagerie 
Examens ciblés selon orientation 
 DIAGNOSTIC CLINIQUE 
M. KRAHN M2 2009
Stratégie diagnostique dans les 
maladies génétiques 
CONSULTATION DIAGNOSTIQUE: 
Interrogatoire et examen clinique Histoire de la maladie 
Arbre généalogique/mode de transmission 
Examen clinique ciblé 
Examen clinique général 
EXAMENS COMPLEMENTAIRES: 
Analyses biologiques selon le contexte 
Imagerie 
Examens ciblés selon orientation 
 DIAGNOSTIC CLINIQUE ⇒ DIAGNOSTIC GENETIQUE 
ANALYSES GENETIQUES: 
Génétique moléculaire: 
Diagnostic direct: Recherche de l’anomalie génétique primaire 
Diagnostic indirect: Analyses de liaison 
Cytogénétique: 
Caryotype 
constitutionnel standard 
FISH,… (Cf cours) 
M. KRAHN M2 2009
Diagnostic moléculaire 
des maladies génétiques 
 Objectif: établir un diagnostic précis par l’identification 
de l’anomalie génétique 
 Intérêt: certitude diagnostique 
prise en charge adaptée 
conseil génétique 
 2 approches: 
DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire 
 identification de Mutations constitutionnelles délétères 
DIAGNOSTIC INDIRECT: Analyses de liaison 
 Utilisation de marqueurs pour analyser la coségrégation d’un 
phénotype avec un allèle particulier dans une famille 
M. KRAHN M2 2009
Rappel: le rôle central de la PCR 
ADN du patient en faible quantité 
Région d’intérêt 
PCR Région d’intérêt 
AMPLIFIEE 
en grande quantité 
ANALYSE 
de la région d’intérêt 
Analyse de la SEQUENCE 
 Recherche de MUTATIONS 
dans la région d’intérêt 
Analyse de la TAILLE 
 Applications diverses 
 Analyse de Microsatellites 
Gène de 3 exons 
Exon 1 
Exon 2 
Exon 3 
M. KRAHN M2 2009
Séquençage complet 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
Gène de 3 exons 
PRECRIBLAGE puis Séquençage ciblé 
- Différentes technologies: SSCP, DHPLC, HRM,… 
- Intérêt: détecter les exons porteurs d’une variation de séquence 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
= réduction du temps d’analyse et des coûts 
Profil NORMAL 
Profil ANORMAL 
Profil NORMAL 
M. KRAHN M2 2009
Diagnostic direct et Diagnostic indirect 
Analyses en 
Génétique moléculaire 
DIAGNOSTIC DIRECT 
Patient atteint 
Phénotype: diagnostic clinique 
Ou suspicion diagnostique 
CAACANNNNNNNNNNNNN 
Forw. 
Identification de mutation(s) 
dans le gène impliqué 
Analyses en 
Génétique moléculaire 
DIAGNOSTIC INDIRECT 
Patient atteint 
Phénotype: diagnostic clinique 
(certitude diagnostique nécessaire) 
105 113 
105 115 
113 115 
105 115 
Coségrégation familiale phénotype/marqueur 
M. KRAHN M2 2009
Diagnostic indirect 
Utilisation de marqueurs pour analyser la 
coségrégation marqueur/maladie 
• on connaît la localisation du gène morbide 
• on connaît des marqueurs localisés à proximité 
• étude de la Coségrégation familiale phénotype/marqueur 
Analyses en 
Génétique moléculaire 
DIAGNOSTIC INDIRECT 
Marqueur 
Patient atteint 
Avec Diagnostic clinique CERTAIN 
105 113 
105 115 
113 115 
105 115 
Coségrégation familiale phénotype/marqueur 
Gène 
morbide 
Permet de suivre INDIRECTEMENT 
la transmission d’une mutation 
M. KRAHN M2 2009
Diagnostic indirect 
Utilisation de marqueurs pour analyser la 
coségrégation marqueur/maladie 
• on connaît la localisation du gène morbide 
• on connaît des marqueurs localisés à proximité 
• étude de la Coségrégation familiale phénotype/marqueur 
Marqueur 
Gène 
morbide 
Permet de suivre INDIRECTEMENT 
la transmission d’une mutation 
 Approche utilisée quand diagnostic direct non faisable, trop difficile… 
 Principaux problèmes posés: 
- nécessite de connaître le gène impliqué (ou le locus) 
pour choisir les marqueurs à utiliser 
(problème posé si hétérogénéité génétique) 
- nécessite une certitude du diagnostic clinique 
- nécessite une étude FAMILIALE 
- nécessite une famille « informative »: parfois non concluant 
- risque d’erreur par recombinaison M. KRAHN M2 2009
Diagnostic moléculaire indirect 
Principes 
105 113 
Marqueur 
105 115 
113 115 
105 115 
Étude de microsatellites. 
Exemple: étude familiale, maladie autosomique dominante 
Gène 
morbide 
M. KRAHN M2 2009
Diagnostic moléculaire indirect 
Principes 
Étude de microsatellites. 
Exemple: étude familiale, maladie autosomique dominante 
105 113 
105 115 
105 115 
Étude de la 
Coségrégation familiale phénotype/marqueur 
Marqueur 
Gène 
morbide 
Phénotype atteint 
Allèles 105 et 113 
Phénotype sain 
Allèles 105 et 115 
Phénotype sain 
Phénotype atteint Allèles 105 et 115 
Allèles 113 et 115 
113 115 
NB: Diagnostic indirect nécessite 
- Certitude du diagnostic clinique 
- Étude familiale 
L’enfant atteint a reçu l’allèle 113 de son père: 
Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel 
L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause 
M. KRAHN M2 2009
Diagnostic moléculaire indirect 
Principes 
Allèle 105 Allèle 115 
Étude de microsatellites. 
Exemple: étude familiale, maladie autosomique dominante 
105 113 
105 115 
113 115 
105 115 
Étude de la 
Coségrégation familiale phénotype/marqueur 
Gène 
morbide 
Phénotype atteint 
Allèles 105 et 113 
Phénotype sain 
Allèles 105 et 115 
Allèle 105 Allèle 113 
Mutation dans 
le gène impliqué * 
Chez le père, l’allèle 113 du marqueur 
est sur le même chromosome 
que la mutation impliquée dans la maladie 
Allèle 105 Allèle 113 
Phénotype atteint 
Allèles 113 et 115 * 
Phénotype sain 
Allèles 105 et 115 
Allèle 105 Allèle 115 
Marqueur 
Lorsque le père transmet le chromosome 
avec la mutation, il transmet AUSSI l’allèle 113 
⇒ Permet de suivre indirectement 
la transmission de la mutation 
L’enfant atteint a reçu l’allèle 113 de son père: 
Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel 
L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause 
M. KRAHN M2 2009
Diagnostic direct 
DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire 
 identification de mutations constitutionnelles délétères 
 approche utilisée de préférence, permet un diagnostic de certitude 
 principaux problèmes posés: 
- parfois lourd sur le plan technique 
- parfois non concluant 
- polymorphismes ou mutations constitutionnelles délétères? 
Analyses en 
Génétique moléculaire 
DIAGNOSTIC DIRECT 
Patient atteint 
Phénotype: diagnostic clinique 
Ou suspicion diagnostique 
CAACANNNNNNNNNNNNN 
Forw. 
Identification de mutation 
dans le gène impliqué 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Stratégie 
Patient atteint 
Phénotype: diagnostic clinique 
Ou suspicion diagnostique 
Gène impliqué de GRANDE TAILLE 
+/- Spectre mutationnel large 
Précriblage mutationnel 
Gène impliqué de PETITE TAILLE 
et/ou mutations récurrentes 
Séquençage complet 
trop lourd et trop coûteux 
Profil ANORMAL 
Séquençage ciblé 
des exons présentant des profils anormaux 
Séquençage complet de la totalité 
de la séquence codante d’intérêt 
(tous les exons codants) 
• techniques permettant d’identifier les exons 
présentant des variations de séquence 
• mais SANS préciser quelle est la variation 
de séquence 
• ORIENTATION 
 Identification de variations de séquence 
Mutation ponctuelle 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Exemple: gène de petite taille 
• Gène de la cavéoline-3 (CAV3) : 
localisé en 3p25 
séquence codante de 456 paires de bases (2 exons) 
ARNm d’ expression musculaire 
Protéine impliquée dans la réparation de la membrane musculaire (?) 
• Mutations CAV3 : 
dystrophie musculaire des ceintures autosomique dominante 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Exemple: gène de petite taille 
• Gène de la cavéoline-3 (CAV3) : 
localisé en 3p25 
séquence codante de 456 paires de bases (2 exons) 
ARNm d’ expression musculaire 
Protéine impliquée dans la réparation de la membrane musculaire (?) 
• Mutations CAV3 : 
dystrophie musculaire des ceintures autosomique dominante 
• Gène de petite taille: analyse « facile » par séquençage direct 
Contrôle Patient 
Confirmation du diagnostic 
par IDENTIFICATION 
directe de la mutation 
For. For. c.298AT hétérozygote 
p.Ile100Phe 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Exemple: gène de grande taille 
• Gène de la dysferline (DYSF) : 
localisé en 2p13.3-13.1 
séquence codante de 6243 paires de bases (55 exons) 
ARNm d’ expression musculaire (et autres tissus) 
Protéine impliquée dans la réparation de la membrane musculaire (?) 
• Mutations DYSF : 
dystrophie musculaire des ceintures autosomique récessive 
 400 mutations différentes rapportées 
réparties sur toute la longueur du gène 
= « Spectre mutationnel large » 
• Gène de grande taille +/- spectre mutationnel large: 
Analyse par séquençage complet techniquement trop lourd 
et trop coûteux: NON faisable 
Utilisation de techniques de PREcriblage mutationnel 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Exemple: gène de grande taille 
Patient IVS 6 
c.946-1GA 
Patient Exon 17 
c.1979AG 
Profil hétéroduplex évident 
dHPLC 
dHPLC 
Profil hétéroduplex difficilement mis en évidence 
Séquençage 
Séquençage 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Comparaison à séquence de référence 
- UCSC Genome Browser genome.ucsc.edu 
- Ensembl www.ensembl.org 
 Description précise du variant : NOMENCLATURE HGVS 
www.hgvs.org/mutnomen 
Nomenclature officielle Human Genome Variation Society 
Mutations délétères 
ou 
Variations de séquence non pathogènes ? 
M. KRAHN M2 2009
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interprétation de données mutationnelles 
• Perspectives de criblage mutationnel à haut débit 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HGVS 
 Comparaison à séquence de référence: 
Mutation délétère… ou simple variation de la normale/polymorphisme? 
2 situations: 
 la variation de séquence est connue (consultation de bases de données) 
 la variation de séquence N’EST PAS connue 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HGVS 
 Comparaison à séquence de référence: 
Mutation délétère… ou simple variation de la normale/polymorphisme? 
2 situations: 
 la variation de séquence est connue (consultation de bases de données) 
- Caractère délétère confirmé au préalable chez d’autres patients 
 Mutation constitutionnelle délétère 
- Présence sans effets pathologiques dans la population générale 
 Polymorphisme 
 la variation de séquence N’EST PAS connue 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HGVS 
 Comparaison à séquence de référence: 
Mutation délétère… ou simple variation de la normale/polymorphisme? 
2 situations: 
Séance ED 
Analyses mutationnelles 
en Génétique Humaine 
 la variation de séquence est connue (consultation de bases de données) 
- Caractère délétère confirmé au préalable chez d’autres patients 
 Mutation constitutionnelle délétère 
- Présence sans effets pathologiques dans la population générale 
 Polymorphisme 
 la variation de séquence N’EST PAS connue 
M. KRAHN M2 2009
Consultation de bases de données 
Mutation rapportée au préalable ? 
Human Genome Variation Society 
www.hgvs.org 
Porte d’entrée pour les Bases de données mutationnelles 
Bases de données « locus-spécifiques » 
 Listing disponible site HGVS 
www.hgvs.org/dblist/glsdb.html 
Bases de données « centrales/globales » 
 Human Gene Mutation Database www.hgmd.org 
 SNP database www.ncbi.nlm.nih.gov/SNP/ 
 UCSC Genome Browser genome.ucsc.edu 
 Ensembl www.ensembl.org 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HGVS 
 Comparaison à séquence de référence: 
Mutation délétère… ou simple variation de la normale/polymorphisme? 
2 situations: 
 la variation de séquence est connue (consultation de bases de données) 
 la variation de séquence N’EST PAS connue 
- Évaluation de différentes données pour conclure sur 
le caractère pathogène ou non de la variation de séquence 
- Saisie des résultats dans les bases de données 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Variation de séquence non connue au préalable 
Mutation délétère ou Polymorphisme? 
? 
M. KRAHN M2 2009
Diagnostic moléculaire direct 
Variation de séquence non connue au préalable 
Mutation délétère ou Polymorphisme? 
 (Consultation de bases de données) 
 Nature de la mutation 
(non-sens, décalage cadre de lecture, épissage, faux-sens, isosémantique,…) 
 Étude de la ségrégation de la variation de séquence à l’intérieur de la famille 
 Recherche de la variation dans une population de témoins sains 
- absence = en faveur du caractère délétère 
- présence = polymorphisme probable 
 Études fonctionnelles: transcriptionnelles, protéiques,… 
Plus difficile, parfois plutôt domaine de la recherche 
 Modélisation bio-informatique: 
- de l’effet sur l’épissage/l’ARNm 
- de la conservation du nucléotide impliqué (et AA correspondant) 
au cours de l’évolution 
- de l’effet au niveau de la protéine 
M. KRAHN M2 2009
Modélisation bio-informatique 
Analyse de l’effet sur l’épissage/l’ARNm 
Epissage anormal, dégradation,.. 
Analyse de la conservation du nucléotide impliqué 
(et AA correspondant) au cours de l’évolution 
= Surtout pour variants faux-sens, isosémantiques et introniques) 
- Conservé 
= important, donc une variation est susceptible d’être délétère 
- Non conservé 
= moins important, une variation est possible sans effet majeur 
Analyse de l’effet au niveau de la protéine 
Domaines fonctionnels, protéine tronquée,… 
M. KRAHN M2 2009
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interprétation de données mutationnelles 
• Perspectives de criblage mutationnel à haut débit 
M. KRAHN M2 2009
Rappel: Mutations « classiques » 
Exon Intron 
5´ CAAT TATA ATG 
3´ 
Région 5´UTR 
Mutations en séquence non codante: 
perturbations d‘éléments régulateurs 
mutations perturbant l‘épissage 
Région 3´UTR 
TAA 
TAG 
TGA 
AATAAA 
Mutations en séquence codante: 
faux sens 
non sens 
insertions/délétions 
décalage du cadre de lecture 
mutations perturbant l‘épissage 
= perte/gain de fonction 
GT AG 
Site donneur Site accepteur 
M. KRAHN M2 2009
Séquençage complet 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
Gène de 3 exons 
PRECRIBLAGE puis Séquençage ciblé 
- Différentes technologies: SSCP, DHPLC, HRM,… 
- Intérêt: détecter les exons porteurs d’une variation de séquence 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
= réduction du temps d’analyse et des coûts 
Profil NORMAL 
Profil ANORMAL 
Profil NORMAL 
M. KRAHN M2 2009
Suspicion d’une pathologie particulière 
…sans identification de mutations 
Exemple: Maladies autosomiques récessives 
Sensibilité insuffisante des techniques utilisées en routine 
Quelles mutations ne sont pas détectées par les 
stratégies « classiques » ? 
 Mutations introniques ? 
Mutations de régions régulatrices ? 
 Mutations dans exons alternatifs ? 
 Réarrangements intragéniques de grande taille ? 
 (…) 
Hétérozygotes symptomatiques, digénisme… 
Mutations dans d’autres gènes 
Même voie physiopathologique ++ 
M. KRAHN M2 2009
Réarrangements intragéniques de grande taille 
Délétions/Amplifications exoniques 
Parfois détectées de manière fortuite 
(détection en PCR; variants de séquence pseudo-homozygotes;…) 
Non détectables de manière systématique avec les techniques 
« classiques » de criblage mutationnel de la séquence codante génique 
Exemple: délétion exonique 
Développement récent de techniques adaptées: 
- Quantitative multiplex PCR of short fluorescent fragments 
(QMPSF; Casilli et al., 2002) 
- Multiplex Ligand-dependant Probe Amplification 
(MLPA; Shouten et al., 2002) 
Analyse mono-allélique 
M. KRAHN M2 2009
Diagnostic moléculaire de routine 
Moyens actuels et Perspectives 
Techniques de criblage mutationnel « efficaces » 
Outils bio-informatiques : 
- Bases de données mutationnelles 
- Algorithmes d’analyse de variants de séquence 
… mais sensibilité insuffisante des techniques d’analyse 
 Mutations non détectées par les techniques actuelles de routine 
Développement de techniques complémentaires 
 Mutations dans d’autres gènes / gènes candidats 
 (…) 
Nouvelles technologies d’analyse mutationnelle génomique 
à haut débit 
Exemples: 
 CGH Microarrays 
 Sequence Capture Arrays et Séquençage à haut débit M. KRAHN M2 2009
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
CGH Arrays 
 ADN génomique non amplifié 
Patient et contrôle 
 Fragmentation aléatoire 
 Marquage avec « random 9mers » 
- 5’-Cy3 (ADN patient) 
- 5’-Cy5 (ADN contrôle) 
et 
 Hybridation sur lame (array) 
 Analyse 
Capture des signaux fluorescents (Scanner) 
Analyse des données (Ratio Cy3/Cy5) 
ADN 
patient 
ADN 
contrôle 
M. KRAHN M2 2009
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
CGH Arrays 
2.1M 
385K 
4-plex 12-plex 
4 x 70 K 12 x 135 K 
M. KRAHN M2 2009
DYSF CGH arrays 
Duplication hétérozygote exons 37+38 (+39) 
71684074-71693259 
Nimblegen-Roche 
Délétion homozygote exons 2 à 40 
71562000-71720000 
M. KRAHN M2 2009
DYS et SGC CGH arrays 
gSarcoglycan 
LGMD2C 
Dystrophin 
DMD 
Saillour et al, 2008 M. KRAHN M2 2009
Séquençage à haut débit 
400000 lectures 
Fragments de 250-300bp 
500Mb de séquence/run 
Couverture 15x/région 
5Mb de séquence propre/run 
Nimblegen-Roche 
ADN génomique 
Fragmentation 
Ligation d’adaptateur 
Création de microréacteurs par émulsion 
(billes et fragments ADN) 
PCR en émulsion 
Séquençage et analyse 
M. KRAHN M2 2009
Sequence Capture arrays et Séquençage à haut débit 
Séquençage à haut débit 
5Mb de séquence interprétable / run 
Nimblegen-Roche 
Régions cible 
Fragmentation 
et 
ligation d’un « linker » 
Sélection/Enrichissement 
en séquence cible 
(alternative à PCR) 
Hybridation 
Élution de la 
Région d’intérêt 
Lavages 
Amplification 
M. KRAHN M2 2009
2.1M 
4-plex 1-plex 
12-plex 
4 x 70 K 1 x 2.1 M 
12 x 135 K 
385K 
1-plex 
1 x 385 K 
Nimblegen-Roche 
Sequence Capture arrays 
M. KRAHN M2 2009
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
PERSPECTIVES 
Criblage mutationnel à haut débit en routine 
 Analyses de séquence 
- « Mutations classiques » 
Substitutions et ins/del de petite taille 
- Extension de l’analyse aux régions introniques 
et/ou régions régulatrices 
(Epissage, 5’UTR, 3’UTR, CNGS, microRNA,…) 
 Anomalies génomiques quantitatives 
- Réarrangements intragéniques de grande taille 
Délétions/Amplifications exoniques 
- Copy Number Variations 
(…) 
Analyse de gènes candidats et gènes modificateurs 
Étapes de validation par techniques complémentaires 
(Séq. direct, Q-PCR; RT-PCR et Q-RT-PCR, MLPA, Microarrays d’expression,…) 
M. KRAHN M2 2009
Diagnostic moléculaire 
PERSPECTIVES 
Procédure actuelle 
Approche « gène par gène » 
Procédure future 
Approche « haut débit » 
Orientation clinique 
anatomopathologique 
biochimique 
(…) 
Orientation clinique 
anatomopathologique 
biochimique 
(…) 
Un ou quelques gènes 
Long; 1 semaine à 1 an 
Coûteux 
Plusieurs dizaines de gènes 
Rapide; 72 heures à 1 semaine 
Réduction des coûts 
M. KRAHN M2 2009
Conclusion – Notions essentielles 
• Stratégies de Diagnostic génétique 
- Diagnostic direct vs indirect 
- Précriblage mutationnel 
• Problèmes d’interprétation de données mutationnelles 
- Bases de données mutationnelles 
- Variants « nouveaux » = recueil d’arguments de pathogénicité 
- Outils bioinformatiques ++ 
• Perspectives de criblage mutationnel à haut débit 
M. KRAHN M2 2009

Contenu connexe

Tendances

Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinante
tutankanson
 
Production des anticorps monoclonaux
Production des anticorps monoclonauxProduction des anticorps monoclonaux
Production des anticorps monoclonaux
Asmae LGUENSAT
 

Tendances (20)

Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinante
 
Medical Biotechnology (Recent Development)
Medical Biotechnology (Recent Development)Medical Biotechnology (Recent Development)
Medical Biotechnology (Recent Development)
 
La différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la ChromatideLa différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la Chromatide
 
Lectut btn-202-ppt-l34. applications of site-directed mutagenesis
Lectut btn-202-ppt-l34. applications of site-directed mutagenesisLectut btn-202-ppt-l34. applications of site-directed mutagenesis
Lectut btn-202-ppt-l34. applications of site-directed mutagenesis
 
anticorps monoclonaux
anticorps monoclonauxanticorps monoclonaux
anticorps monoclonaux
 
Antibody phage display technology
Antibody phage display technologyAntibody phage display technology
Antibody phage display technology
 
Cours complement medecine 2016
Cours complement medecine 2016Cours complement medecine 2016
Cours complement medecine 2016
 
PRESENTATION GENETIQUE.pptx
PRESENTATION GENETIQUE.pptxPRESENTATION GENETIQUE.pptx
PRESENTATION GENETIQUE.pptx
 
Le clonage
Le clonageLe clonage
Le clonage
 
Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au s...
Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au s...Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au s...
Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au s...
 
Genetic privacy
Genetic privacyGenetic privacy
Genetic privacy
 
Monoclonal Antibodies Hybridoma Technique
Monoclonal Antibodies Hybridoma Technique  Monoclonal Antibodies Hybridoma Technique
Monoclonal Antibodies Hybridoma Technique
 
Les puces à adn
Les puces à adnLes puces à adn
Les puces à adn
 
Synthetic Genome
Synthetic Genome Synthetic Genome
Synthetic Genome
 
Antibody engineering
Antibody engineeringAntibody engineering
Antibody engineering
 
Antibiorésistance et panne de l’innovation en antibiothérapie : la phagothe...
Antibiorésistance et panne de l’innovation en antibiothérapie : la phagothe...Antibiorésistance et panne de l’innovation en antibiothérapie : la phagothe...
Antibiorésistance et panne de l’innovation en antibiothérapie : la phagothe...
 
tous sur les anticorps monoclonaux
tous sur les anticorps monoclonauxtous sur les anticorps monoclonaux
tous sur les anticorps monoclonaux
 
Production des anticorps monoclonaux
Production des anticorps monoclonauxProduction des anticorps monoclonaux
Production des anticorps monoclonaux
 
Exposée clonage
Exposée clonageExposée clonage
Exposée clonage
 
Atibody engineering
Atibody engineeringAtibody engineering
Atibody engineering
 

En vedette

Génomique généralités jd
Génomique généralités jdGénomique généralités jd
Génomique généralités jd
judec12
 
Basics of bioinformatics
Basics of bioinformaticsBasics of bioinformatics
Basics of bioinformatics
Abhishek Vatsa
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Miraj Microbio
 

En vedette (7)

Nouvelle indexation genomique: Les 10 principales questions des éleveurs
Nouvelle indexation genomique: Les 10 principales questions des éleveursNouvelle indexation genomique: Les 10 principales questions des éleveurs
Nouvelle indexation genomique: Les 10 principales questions des éleveurs
 
Génomique généralités jd
Génomique généralités jdGénomique généralités jd
Génomique généralités jd
 
Basics of bioinformatics
Basics of bioinformaticsBasics of bioinformatics
Basics of bioinformatics
 
Cours 7 lymphocyte b et immunoglobulines
Cours 7 lymphocyte b et immunoglobulinesCours 7 lymphocyte b et immunoglobulines
Cours 7 lymphocyte b et immunoglobulines
 
Cours 6 organes lymphoïdes et lymphocytes T
Cours 6 organes lymphoïdes et lymphocytes TCours 6 organes lymphoïdes et lymphocytes T
Cours 6 organes lymphoïdes et lymphocytes T
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 

Similaire à M krahn organisation_genome_et_analyses_genomiques_2009

ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuret
vguili
 
Diagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème versionDiagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème version
esf3
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
kristinacraft1
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
balamane
 
genetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptxgenetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptx
dangerinflammable
 

Similaire à M krahn organisation_genome_et_analyses_genomiques_2009 (20)

Introduction la science Genomique, slides
Introduction la science Genomique, slidesIntroduction la science Genomique, slides
Introduction la science Genomique, slides
 
4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI
 
4ºeso Chapitre 2 L'héritage
4ºeso Chapitre 2 L'héritage4ºeso Chapitre 2 L'héritage
4ºeso Chapitre 2 L'héritage
 
4ºeso chapitre 2
4ºeso chapitre 24ºeso chapitre 2
4ºeso chapitre 2
 
ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuret
 
Cours 8
Cours 8 Cours 8
Cours 8
 
eBIS Actu - 20220616 - 2 pangenome
eBIS Actu - 20220616 - 2 pangenomeeBIS Actu - 20220616 - 2 pangenome
eBIS Actu - 20220616 - 2 pangenome
 
eBIS Actu - 20220616 - 1 pôle genome
eBIS Actu - 20220616 - 1 pôle genomeeBIS Actu - 20220616 - 1 pôle genome
eBIS Actu - 20220616 - 1 pôle genome
 
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
 
Diagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème versionDiagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème version
 
COURS 2 PCR.ppt
COURS 2 PCR.pptCOURS 2 PCR.ppt
COURS 2 PCR.ppt
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
 
Polycopie_Aouf.pdf
Polycopie_Aouf.pdfPolycopie_Aouf.pdf
Polycopie_Aouf.pdf
 
genetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptxgenetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptx
 
Bases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesBases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditaires
 
ADN et génotypage
ADN et génotypageADN et génotypage
ADN et génotypage
 
Nc univers vivant chap 3
Nc univers vivant chap 3Nc univers vivant chap 3
Nc univers vivant chap 3
 
3. Détecter l'émergence d'anomalies génétiques: exemple en bovins
3. Détecter l'émergence d'anomalies génétiques: exemple en bovins3. Détecter l'émergence d'anomalies génétiques: exemple en bovins
3. Détecter l'émergence d'anomalies génétiques: exemple en bovins
 
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du CamerounBiodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
 

Plus de Elsa von Licy

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Elsa von Licy
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages   184 ko)L agressivite en psychanalyse (21 pages   184 ko)
L agressivite en psychanalyse (21 pages 184 ko)
Elsa von Licy
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01
Elsa von Licy
 
Spr ue3.1 poly cours et exercices
Spr ue3.1   poly cours et exercicesSpr ue3.1   poly cours et exercices
Spr ue3.1 poly cours et exercices
Elsa von Licy
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 p
Elsa von Licy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Elsa von Licy
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicales
Elsa von Licy
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiants
Elsa von Licy
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_intro
Elsa von Licy
 

Plus de Elsa von Licy (20)

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
 
Strategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiStrategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfi
 
Rainville pierre
Rainville pierreRainville pierre
Rainville pierre
 
Neuropsychophysiologie
NeuropsychophysiologieNeuropsychophysiologie
Neuropsychophysiologie
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages   184 ko)L agressivite en psychanalyse (21 pages   184 ko)
L agressivite en psychanalyse (21 pages 184 ko)
 
C1 clef pour_la_neuro
C1 clef pour_la_neuroC1 clef pour_la_neuro
C1 clef pour_la_neuro
 
Hemostase polycop
Hemostase polycopHemostase polycop
Hemostase polycop
 
Antiphilos
AntiphilosAntiphilos
Antiphilos
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01
 
Spr ue3.1 poly cours et exercices
Spr ue3.1   poly cours et exercicesSpr ue3.1   poly cours et exercices
Spr ue3.1 poly cours et exercices
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 p
 
M2 bmc2007 cours01
M2 bmc2007 cours01M2 bmc2007 cours01
M2 bmc2007 cours01
 
Feuilletage
FeuilletageFeuilletage
Feuilletage
 
Chapitre 1
Chapitre 1Chapitre 1
Chapitre 1
 
Biophy
BiophyBiophy
Biophy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicales
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiants
 
Atelier.etude.efficace
Atelier.etude.efficaceAtelier.etude.efficace
Atelier.etude.efficace
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_intro
 

M krahn organisation_genome_et_analyses_genomiques_2009

  • 1. Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion « How to sequence a genome » (film): www.genome.gov/25019885 Human Genome Project: http://www.genome.gov/HGP/ Analyses génomiques en pathologie humaine Problématiques des études moléculaires en génétique humaine Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion Human Genome Variation Society: www.hgvs.org Nomenclature mutationnelle: www.hgvs.org/mutnomen Analyse de variants faux-sens: http://genetics.bwh.harvard.edu/pph/ Analyse de l’effet de variants de séquence sur l’épissage: www.umd.be/HSF/ Bases de données: Bases de données « locus-spécifiques » Listing disponible site HGVS www.hgvs.org/dblist/glsdb.html Bases de données « centrales/globales » Human Gene Mutation Database www.hgmd.org SNP database www.ncbi.nlm.nih.gov/SNP/ UCSC Genome Browser genome.ucsc.edu Ensembl www.ensembl.org Dr. Martin Krahn martin.krahn@ap-hm.fr Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR 910 - Faculté de Médecine Université de la Méditerranée Marseille
  • 2. Organisation du Génome humain Notions essentielles Martin Krahn martin.krahn@ap-hm.fr Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR 910 - Faculté de Médecine Université de la Méditerranée Marseille
  • 3. Organisation du Génome humain Notions essentielles Quelques rappels historiques Séquençage du Génome humain Organisation du Génome humain M. KRAHN M2 2009
  • 4. Génome = ensemble du matériel génétique d'une espèce (ADN) ≠ ensemble des gènes !!! ! M. KRAHN M2 2009
  • 5. Pourquoi cartographier le génome ? Clonage positionnel : identification de gènes par exploration du génome suivant un balisage de marqueurs Médecine: pour localiser les loci morbides, associés à des maladies héréditaires, voire pour appréhender les maladies multifactorielles Depuis les premières cartes, plus de 2500 gènes impliqués dans des syndromes héréditaires ont été identifiés (OMIM, sept.2009) Cette phase est suivie d’exploration thérapeutique (voir site essais cliniques AFM) Agronomie: pour localiser et cloner les gènes d’intérêt ou les zones du génome impliquées dans des traits intéressants et les transférer entre espèces… Bond des biotechnologies végétales, clonage, OGM… M. KRAHN M2 2009
  • 6. Histoire • De l’Antiquité au 19e siècle : transmission de caractères parents-enfants selon diverses théories: préformisme, animalculisme, patroclinisme, ovisme, épigénisme… • 1865: G. Mendel jette les bases de la génétique moderne, allèles, dominance, hétérozygotie… • 1910: T. Morgan découvre la recombinaison méiotique et publie ses résultats qui sont les bases de la théorie chromosomique de l’hérédité • 1913: première carte génétique M. KRAHN M2 2009
  • 7. Histoire • 1953: J. Watson, F. Crick et R. Franklin décryptent des clichés de diffraction et publient la structure en double hélice de l’ADN • 1965: J. Monod, F. Jacob et A. Lwoff « découvrent » les ARN et la régulation de l’expression génique • 1973: moratoire sur le clonage et le génie génétique M. KRAHN M2 2009
  • 8. Histoire • Années 1980: découverte des marqueurs polymorphiques, des techniques de RFLP, des microsatellites, grands progrès du génie génétique. Cartographie intensive • 1983: découverte de la PCR. Les cartes s’enrichissent de toutes ces techniques • 1989: un programme mondial de séquençage du génome humain se met en place : HUGO • 1992-1996: publication des premières cartes du génome humain par le Généthon M. KRAHN M2 2009
  • 9. Histoire • 2000: premiers résultats de thérapie génique sur l’homme (Fischer) • 2001: premier assemblage de la séquence du génome humain (Science 291, Nature 409) • 2003: finition de l’assemblage de notre séquence génomique CELERA HUGO-HGP M. KRAHN M2 2009
  • 10. HUGO – Human Genome Project • Plus grand projet scientifique mondial lancé en 1988/1989 HGP démarre en 1990 • Ampleur de la tâche – 1 page = 3000 bases – 1 tome: 500 pages = 1 500 000 bases – 1 génome = 1 000 tomes !!! • Capacité de séquençage – En 1975, 1 000 nucléotides/semaine 500 ans pour 100 personnes ! – En 1986, 10 000 nucléotides/jour 8 ans pour 100 machines – En 1998, 200 000 nucléotides/jour 5 mois pour 100 machines • Stratégie du Human Genome Project vs Stratégie de CELERA Genomics M. KRAHN M2 2009
  • 11. HUGO - HGP CELERA HGP / Celera M. KRAHN M2 2009
  • 12. Séquence finale • CELERA: Seuls 2 ADN ont servi de matrice (dont celui de C. Venter). Celera a intégré les données publiques dans sa base au fur et à mesure de leur publication • HGP: profondeur de séquence: 10X (10 équivalents génomiques séquençés) à partir de près d'une vingtaine d'individus différents • Travail de finition poursuivi jusqu'en avril 2003 • Précision finale: 99.99 % = 1 erreur toutes les 10 000 bases environ • Coût global: environ 2.7 milliards $ • Parties manquantes: hétérochromatine, télomères et centromères M. KRAHN M2 2009
  • 13. Coûts de séquençage M. KRAHN M2 2009
  • 14. Organisation du génome humain 1/3 2/3 3% code des protéines 50% séquences répétées M. KRAHN M2 2009
  • 15. Le génome humain • Le génome humain est composé de 3 272 millions de nucléotides • Les régions riches en gènes sont également les régions riches en nucléotides G/C • Les régions pauvres en gènes sont riches en A/T Ces différentes régions peuvent généralement être visualisées comme des bandes claires ou sombres sur les chromosomes métaphasiques (banding) Bandes G: riches en AT, pauvres en gènes Bandes R: riches en GC, riches en gènes • Le chromosome 1 contient le plus grand nombre de gènes estimés (environ 3000) tandis que le chromosome Y en a le moins (231) • Moins de 3% de l’ADN code pour des protéines • Les séquences répétées composent environ 50% de la totalité du génome M. KRAHN M2 2009
  • 16. Le génome humain • Le nombre total de gènes se situe entre 25 000 et 30 000 • La taille moyenne d’un gène est de 3000 bases, 9 exons, mais la taille varie beaucoup (ex : le gène de la dystrophine a une taille de 2,4 millions bp) • 99.9% des nucléotides sont identiques entre deux personnes. Il existe donc 0,1% de différences (soit environ 3,5 millions de différences par génome) • Plus de 50% des gènes ont une fonction inconnue M. KRAHN M2 2009
  • 17. Organisation du Génome Vitesse de réassociation du génome On dénature l'ADN par chauffage On mesure la vitesse de réhybridation L'ADN d'E. coli se réhybride suivant une courbe sigmoïde simple quand un fragment d'ADN trouve son fragment complémentaire, les séquences adjacentes se réhybrident rapidement de façon coopérative, comme une fermeture éclair M. KRAHN M2 2009
  • 18. Vitesse de réassociation du génome % de réhybridation 100 75 50 25 0 E. Coli 10-2 10-1 1 101 102 Rapide Lente Vitesse de réassociation H. Sapiens 1 3 2 M. KRAHN M2 2009
  • 19. Le génome est hétérogène • Zones fortement répétitives 10 à 15% du génome, non codées en protéines Centromères, Télomères, Mégasatellites, Minisatéllites, Microsatellites • Zones moyennement répétitives 20 à 40 % du génome, non codées en protéines Transposons, séquences SINE (Alu) et LINE, Rétrovirus endogènes Quelques gènes codant des rRNA, tRNA, RNA5S et 7SL • Séquences uniques ~50% du génome, contiennent la plupart des gènes codant pour des protéines (ARNm) M. KRAHN M2 2009
  • 20. Les zones répétitives Les minisatellites ou VNTR (Variable Numbers of Tandem Repeats): - séquences de 11 à 16 pb - répétées parfois jusqu'à 1000 fois - Localisations surtout télomériques (ou centromériques) - peu utilisés en pratique Les microsatellites - séquences de 1 à 4 pb - souvent (CA)n, n variant de 12 à 40. - répartition homogène sur tout le génome, tous les 25 à 100 kb - très variables donc informatifs - facilement amplifiés par PCR - utilisation pour les analyses de liaison - utilisation en diagnostic moléculaire (« indirect ») et pour les empreintes génétiques M. KRAHN M2 2009
  • 21. Marqueurs génétiques • Les MARQUEURS génétiques: Variations polymorphes de la séquence d’ADN - répartis uniformément sur le génome - localisation connue - PAS d’effet direct sur le phénotype • Microsatellites (utilisés ++) : Polymorphismes de répétition Exple: répétitions de motif « CA » - séquences répétées NON codantes - réparties uniformément dans le génome - polymorphes = à un même endroit du génome, des individus pris au hasard (pop.gén.) présentent un nombre différent de répétitions sur chaque chromosome Exemple: chromosome 4 …ATCGTCTCACACACACACACACATGTCGTAT… …ATCGTCTCACACACACACACACACACACACATGTCGTAT… 8 répétitions CA 12 répétitions CA ADN Marqueur Gène M. KRAHN M2 2009
  • 22. Et maintenant ? M. KRAHN M2 2009
  • 23. Et maintenant ? M. KRAHN M2 2009
  • 24. Et maintenant ? M. KRAHN M2 2009
  • 25. Et maintenant ? Clonage positionnel révolu – gènes localisés Agronomie dopée – OGM par analyse QTL Catalogue des gènes: GenAtlas, OMIM, Genome Browser, bases de données de SNP, de miARN… Séquençage en masse d'autres organismes Cartes de synténie inter-espèces, évolution Séquençage personnalisé possible Nouvelles technologies mêlant bioinformatique, robotique et nanobiologie… Thérapie génique, pharmacologique ou cellulaire utilisant les données acquises… M. KRAHN M2 2009
  • 26. Analyses génomiques en pathologie humaine M. KRAHN M2 2009
  • 27. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène ? M. KRAHN M2 2009
  • 28. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène Délétions Duplications Amplifications Translocations Inversions Insertions (...) Mutations ponctuelles Insertions/délétions de qques nucléotides Insertions/délétions de qques 10aines ou 100aines de nt Mutations dynamiques/amplifications (...) Maladies génétiques: anomalies génétiques causales Maladies polyfactorielles: prédisposition génétique M. KRAHN M2 2009
  • 29. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène METHODES D’ANALYSE ? M. KRAHN M2 2009
  • 30. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène CARYOTYPE METHODES D’ANALYSE FISH CGH CRIBLAGE MUTATIONNEL SEQUENCAGE M. KRAHN M2 2009
  • 31. Rappel: Mutations « classiques » Exon Intron 5´ CAAT TATA ATG 3´ Région 5´UTR Mutations en séquence non codante: perturbations d‘éléments régulateurs mutations perturbant l‘épissage Région 3´UTR TAA TAG TGA AATAAA Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l‘épissage = perte/gain de fonction GT AG Site donneur Site accepteur M. KRAHN M2 2009
  • 32. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  • 33. Les avancées méthodologiques qui ont révolutionné la génétique moléculaire 1970: Endonucléases de restriction 1972-1973: Ligases 1975: Séquençage (SangerCoulon, MaxamGilbert, Hood) 1985: PCR (Karry Mullis) 1998: Puces à ADN (“microarrays”) Années 1990 à aujourd’hui: Développement +++ de nouvelles techniques Les applications/progrès réalisées grâce aux techniques de Biologie moléculaire: • Meilleure connaissance des mécanismes physiopathologiques des maladies: - Identification et études fonctionnelles de gènes impliqués dans des maladies humaines, création et analyse de modèles animaux, séquençage du génome humain,,… • Généralisation des applications diagnostiques en routine hospitalière M. KRAHN M2 2009
  • 34. Principes des Études Moléculaires en Génétique Humaine Transcription Traduction ADN Génome ARN Transcriptome Protéines Protéome Reverse Transcription Réplication Analyses génétiques/ Biologie moléculaire Biochimie M. KRAHN M2 2009
  • 35. Principes des Études Moléculaires en Génétique Humaine En principe identique pour toutes les cellules d’un individu ADN Génome ARN Transcriptome Spécifiques d’un tissu d’un type cellulaire d’un état Protéines Protéome Analyses génétiques/ Biologie moléculaire Biochimie M. KRAHN M2 2009
  • 36. Principes des Études Moléculaires en ADN Génome ARN Transcriptome Protéines Protéome En principe identique pour toutes les cellules d’un individu Spécifiques d’un tissu d’un type cellulaire d’un état Prélèvement de « base » en Génétique = prélèvement sanguin périphérique Extraction d’ADN génomique à partir de LYMPHOCYTES du sang Analyses en Génétique moléculaire: Directes ou Indirectes Autres prélèvements: •Tissus embryonnaires/foetaux (villosités choriales, liquide amniotique,…) pour DPN • Autres tissus: analyses complémentaires dans certaines pathologies (surtout analyses d’expression du ARNm) ATTENTION: Toujours avec CONSENTEMENT de l’individu Génétique Humaine M. KRAHN M2 2009
  • 37. Notions essentielles • Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel • Problèmes d’interprétation de données mutationnelles - Bases de données mutationnelles - Variants « nouveaux » = recueil d’arguments de pathogénicité - Outils bioinformatiques ++ • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  • 38. Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE M. KRAHN M2 2009
  • 39. Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE ⇒ DIAGNOSTIC GENETIQUE ANALYSES GENETIQUES: Génétique moléculaire: Diagnostic direct: Recherche de l’anomalie génétique primaire Diagnostic indirect: Analyses de liaison Cytogénétique: Caryotype constitutionnel standard FISH,… (Cf cours) M. KRAHN M2 2009
  • 40. Diagnostic moléculaire des maladies génétiques Objectif: établir un diagnostic précis par l’identification de l’anomalie génétique Intérêt: certitude diagnostique prise en charge adaptée conseil génétique 2 approches: DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire identification de Mutations constitutionnelles délétères DIAGNOSTIC INDIRECT: Analyses de liaison Utilisation de marqueurs pour analyser la coségrégation d’un phénotype avec un allèle particulier dans une famille M. KRAHN M2 2009
  • 41. Rappel: le rôle central de la PCR ADN du patient en faible quantité Région d’intérêt PCR Région d’intérêt AMPLIFIEE en grande quantité ANALYSE de la région d’intérêt Analyse de la SEQUENCE Recherche de MUTATIONS dans la région d’intérêt Analyse de la TAILLE Applications diverses Analyse de Microsatellites Gène de 3 exons Exon 1 Exon 2 Exon 3 M. KRAHN M2 2009
  • 42. Séquençage complet Mutation ponctuelle Exon 1 Exon 2 Exon 3 Gène de 3 exons PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM,… - Intérêt: détecter les exons porteurs d’une variation de séquence Mutation ponctuelle Exon 1 Exon 2 Exon 3 = réduction du temps d’analyse et des coûts Profil NORMAL Profil ANORMAL Profil NORMAL M. KRAHN M2 2009
  • 43. Diagnostic direct et Diagnostic indirect Analyses en Génétique moléculaire DIAGNOSTIC DIRECT Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique CAACANNNNNNNNNNNNN Forw. Identification de mutation(s) dans le gène impliqué Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Patient atteint Phénotype: diagnostic clinique (certitude diagnostique nécessaire) 105 113 105 115 113 115 105 115 Coségrégation familiale phénotype/marqueur M. KRAHN M2 2009
  • 44. Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie • on connaît la localisation du gène morbide • on connaît des marqueurs localisés à proximité • étude de la Coségrégation familiale phénotype/marqueur Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Marqueur Patient atteint Avec Diagnostic clinique CERTAIN 105 113 105 115 113 115 105 115 Coségrégation familiale phénotype/marqueur Gène morbide Permet de suivre INDIRECTEMENT la transmission d’une mutation M. KRAHN M2 2009
  • 45. Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie • on connaît la localisation du gène morbide • on connaît des marqueurs localisés à proximité • étude de la Coségrégation familiale phénotype/marqueur Marqueur Gène morbide Permet de suivre INDIRECTEMENT la transmission d’une mutation Approche utilisée quand diagnostic direct non faisable, trop difficile… Principaux problèmes posés: - nécessite de connaître le gène impliqué (ou le locus) pour choisir les marqueurs à utiliser (problème posé si hétérogénéité génétique) - nécessite une certitude du diagnostic clinique - nécessite une étude FAMILIALE - nécessite une famille « informative »: parfois non concluant - risque d’erreur par recombinaison M. KRAHN M2 2009
  • 46. Diagnostic moléculaire indirect Principes 105 113 Marqueur 105 115 113 115 105 115 Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante Gène morbide M. KRAHN M2 2009
  • 47. Diagnostic moléculaire indirect Principes Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante 105 113 105 115 105 115 Étude de la Coségrégation familiale phénotype/marqueur Marqueur Gène morbide Phénotype atteint Allèles 105 et 113 Phénotype sain Allèles 105 et 115 Phénotype sain Phénotype atteint Allèles 105 et 115 Allèles 113 et 115 113 115 NB: Diagnostic indirect nécessite - Certitude du diagnostic clinique - Étude familiale L’enfant atteint a reçu l’allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause M. KRAHN M2 2009
  • 48. Diagnostic moléculaire indirect Principes Allèle 105 Allèle 115 Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante 105 113 105 115 113 115 105 115 Étude de la Coségrégation familiale phénotype/marqueur Gène morbide Phénotype atteint Allèles 105 et 113 Phénotype sain Allèles 105 et 115 Allèle 105 Allèle 113 Mutation dans le gène impliqué * Chez le père, l’allèle 113 du marqueur est sur le même chromosome que la mutation impliquée dans la maladie Allèle 105 Allèle 113 Phénotype atteint Allèles 113 et 115 * Phénotype sain Allèles 105 et 115 Allèle 105 Allèle 115 Marqueur Lorsque le père transmet le chromosome avec la mutation, il transmet AUSSI l’allèle 113 ⇒ Permet de suivre indirectement la transmission de la mutation L’enfant atteint a reçu l’allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause M. KRAHN M2 2009
  • 49. Diagnostic direct DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire identification de mutations constitutionnelles délétères approche utilisée de préférence, permet un diagnostic de certitude principaux problèmes posés: - parfois lourd sur le plan technique - parfois non concluant - polymorphismes ou mutations constitutionnelles délétères? Analyses en Génétique moléculaire DIAGNOSTIC DIRECT Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique CAACANNNNNNNNNNNNN Forw. Identification de mutation dans le gène impliqué M. KRAHN M2 2009
  • 50. Diagnostic moléculaire direct Stratégie Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique Gène impliqué de GRANDE TAILLE +/- Spectre mutationnel large Précriblage mutationnel Gène impliqué de PETITE TAILLE et/ou mutations récurrentes Séquençage complet trop lourd et trop coûteux Profil ANORMAL Séquençage ciblé des exons présentant des profils anormaux Séquençage complet de la totalité de la séquence codante d’intérêt (tous les exons codants) • techniques permettant d’identifier les exons présentant des variations de séquence • mais SANS préciser quelle est la variation de séquence • ORIENTATION Identification de variations de séquence Mutation ponctuelle M. KRAHN M2 2009
  • 51. Diagnostic moléculaire direct Exemple: gène de petite taille • Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d’ expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante M. KRAHN M2 2009
  • 52. Diagnostic moléculaire direct Exemple: gène de petite taille • Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d’ expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante • Gène de petite taille: analyse « facile » par séquençage direct Contrôle Patient Confirmation du diagnostic par IDENTIFICATION directe de la mutation For. For. c.298AT hétérozygote p.Ile100Phe M. KRAHN M2 2009
  • 53. Diagnostic moléculaire direct Exemple: gène de grande taille • Gène de la dysferline (DYSF) : localisé en 2p13.3-13.1 séquence codante de 6243 paires de bases (55 exons) ARNm d’ expression musculaire (et autres tissus) Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations DYSF : dystrophie musculaire des ceintures autosomique récessive 400 mutations différentes rapportées réparties sur toute la longueur du gène = « Spectre mutationnel large » • Gène de grande taille +/- spectre mutationnel large: Analyse par séquençage complet techniquement trop lourd et trop coûteux: NON faisable Utilisation de techniques de PREcriblage mutationnel M. KRAHN M2 2009
  • 54. Diagnostic moléculaire direct Exemple: gène de grande taille Patient IVS 6 c.946-1GA Patient Exon 17 c.1979AG Profil hétéroduplex évident dHPLC dHPLC Profil hétéroduplex difficilement mis en évidence Séquençage Séquençage M. KRAHN M2 2009
  • 55. Diagnostic moléculaire direct Identification de variations de séquence Comparaison à séquence de référence - UCSC Genome Browser genome.ucsc.edu - Ensembl www.ensembl.org Description précise du variant : NOMENCLATURE HGVS www.hgvs.org/mutnomen Nomenclature officielle Human Genome Variation Society Mutations délétères ou Variations de séquence non pathogènes ? M. KRAHN M2 2009
  • 56. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  • 57. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  • 58. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d’autres patients Mutation constitutionnelle délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  • 59. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: Séance ED Analyses mutationnelles en Génétique Humaine la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d’autres patients Mutation constitutionnelle délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  • 60. Consultation de bases de données Mutation rapportée au préalable ? Human Genome Variation Society www.hgvs.org Porte d’entrée pour les Bases de données mutationnelles Bases de données « locus-spécifiques » Listing disponible site HGVS www.hgvs.org/dblist/glsdb.html Bases de données « centrales/globales » Human Gene Mutation Database www.hgmd.org SNP database www.ncbi.nlm.nih.gov/SNP/ UCSC Genome Browser genome.ucsc.edu Ensembl www.ensembl.org M. KRAHN M2 2009
  • 61. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N’EST PAS connue - Évaluation de différentes données pour conclure sur le caractère pathogène ou non de la variation de séquence - Saisie des résultats dans les bases de données M. KRAHN M2 2009
  • 62. Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme? ? M. KRAHN M2 2009
  • 63. Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme? (Consultation de bases de données) Nature de la mutation (non-sens, décalage cadre de lecture, épissage, faux-sens, isosémantique,…) Étude de la ségrégation de la variation de séquence à l’intérieur de la famille Recherche de la variation dans une population de témoins sains - absence = en faveur du caractère délétère - présence = polymorphisme probable Études fonctionnelles: transcriptionnelles, protéiques,… Plus difficile, parfois plutôt domaine de la recherche Modélisation bio-informatique: - de l’effet sur l’épissage/l’ARNm - de la conservation du nucléotide impliqué (et AA correspondant) au cours de l’évolution - de l’effet au niveau de la protéine M. KRAHN M2 2009
  • 64. Modélisation bio-informatique Analyse de l’effet sur l’épissage/l’ARNm Epissage anormal, dégradation,.. Analyse de la conservation du nucléotide impliqué (et AA correspondant) au cours de l’évolution = Surtout pour variants faux-sens, isosémantiques et introniques) - Conservé = important, donc une variation est susceptible d’être délétère - Non conservé = moins important, une variation est possible sans effet majeur Analyse de l’effet au niveau de la protéine Domaines fonctionnels, protéine tronquée,… M. KRAHN M2 2009
  • 65. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  • 66. Rappel: Mutations « classiques » Exon Intron 5´ CAAT TATA ATG 3´ Région 5´UTR Mutations en séquence non codante: perturbations d‘éléments régulateurs mutations perturbant l‘épissage Région 3´UTR TAA TAG TGA AATAAA Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l‘épissage = perte/gain de fonction GT AG Site donneur Site accepteur M. KRAHN M2 2009
  • 67. Séquençage complet Mutation ponctuelle Exon 1 Exon 2 Exon 3 Gène de 3 exons PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM,… - Intérêt: détecter les exons porteurs d’une variation de séquence Mutation ponctuelle Exon 1 Exon 2 Exon 3 = réduction du temps d’analyse et des coûts Profil NORMAL Profil ANORMAL Profil NORMAL M. KRAHN M2 2009
  • 68. Suspicion d’une pathologie particulière …sans identification de mutations Exemple: Maladies autosomiques récessives Sensibilité insuffisante des techniques utilisées en routine Quelles mutations ne sont pas détectées par les stratégies « classiques » ? Mutations introniques ? Mutations de régions régulatrices ? Mutations dans exons alternatifs ? Réarrangements intragéniques de grande taille ? (…) Hétérozygotes symptomatiques, digénisme… Mutations dans d’autres gènes Même voie physiopathologique ++ M. KRAHN M2 2009
  • 69. Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques Parfois détectées de manière fortuite (détection en PCR; variants de séquence pseudo-homozygotes;…) Non détectables de manière systématique avec les techniques « classiques » de criblage mutationnel de la séquence codante génique Exemple: délétion exonique Développement récent de techniques adaptées: - Quantitative multiplex PCR of short fluorescent fragments (QMPSF; Casilli et al., 2002) - Multiplex Ligand-dependant Probe Amplification (MLPA; Shouten et al., 2002) Analyse mono-allélique M. KRAHN M2 2009
  • 70. Diagnostic moléculaire de routine Moyens actuels et Perspectives Techniques de criblage mutationnel « efficaces » Outils bio-informatiques : - Bases de données mutationnelles - Algorithmes d’analyse de variants de séquence … mais sensibilité insuffisante des techniques d’analyse Mutations non détectées par les techniques actuelles de routine Développement de techniques complémentaires Mutations dans d’autres gènes / gènes candidats (…) Nouvelles technologies d’analyse mutationnelle génomique à haut débit Exemples: CGH Microarrays Sequence Capture Arrays et Séquençage à haut débit M. KRAHN M2 2009
  • 71. Nouvelles technologies d’analyse mutationnelle génomique à haut débit CGH Arrays ADN génomique non amplifié Patient et contrôle Fragmentation aléatoire Marquage avec « random 9mers » - 5’-Cy3 (ADN patient) - 5’-Cy5 (ADN contrôle) et Hybridation sur lame (array) Analyse Capture des signaux fluorescents (Scanner) Analyse des données (Ratio Cy3/Cy5) ADN patient ADN contrôle M. KRAHN M2 2009
  • 72. Nouvelles technologies d’analyse mutationnelle génomique à haut débit CGH Arrays 2.1M 385K 4-plex 12-plex 4 x 70 K 12 x 135 K M. KRAHN M2 2009
  • 73. DYSF CGH arrays Duplication hétérozygote exons 37+38 (+39) 71684074-71693259 Nimblegen-Roche Délétion homozygote exons 2 à 40 71562000-71720000 M. KRAHN M2 2009
  • 74. DYS et SGC CGH arrays gSarcoglycan LGMD2C Dystrophin DMD Saillour et al, 2008 M. KRAHN M2 2009
  • 75. Séquençage à haut débit 400000 lectures Fragments de 250-300bp 500Mb de séquence/run Couverture 15x/région 5Mb de séquence propre/run Nimblegen-Roche ADN génomique Fragmentation Ligation d’adaptateur Création de microréacteurs par émulsion (billes et fragments ADN) PCR en émulsion Séquençage et analyse M. KRAHN M2 2009
  • 76. Sequence Capture arrays et Séquençage à haut débit Séquençage à haut débit 5Mb de séquence interprétable / run Nimblegen-Roche Régions cible Fragmentation et ligation d’un « linker » Sélection/Enrichissement en séquence cible (alternative à PCR) Hybridation Élution de la Région d’intérêt Lavages Amplification M. KRAHN M2 2009
  • 77. 2.1M 4-plex 1-plex 12-plex 4 x 70 K 1 x 2.1 M 12 x 135 K 385K 1-plex 1 x 385 K Nimblegen-Roche Sequence Capture arrays M. KRAHN M2 2009
  • 78. Nouvelles technologies d’analyse mutationnelle génomique à haut débit PERSPECTIVES Criblage mutationnel à haut débit en routine Analyses de séquence - « Mutations classiques » Substitutions et ins/del de petite taille - Extension de l’analyse aux régions introniques et/ou régions régulatrices (Epissage, 5’UTR, 3’UTR, CNGS, microRNA,…) Anomalies génomiques quantitatives - Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques - Copy Number Variations (…) Analyse de gènes candidats et gènes modificateurs Étapes de validation par techniques complémentaires (Séq. direct, Q-PCR; RT-PCR et Q-RT-PCR, MLPA, Microarrays d’expression,…) M. KRAHN M2 2009
  • 79. Diagnostic moléculaire PERSPECTIVES Procédure actuelle Approche « gène par gène » Procédure future Approche « haut débit » Orientation clinique anatomopathologique biochimique (…) Orientation clinique anatomopathologique biochimique (…) Un ou quelques gènes Long; 1 semaine à 1 an Coûteux Plusieurs dizaines de gènes Rapide; 72 heures à 1 semaine Réduction des coûts M. KRAHN M2 2009
  • 80. Conclusion – Notions essentielles • Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel • Problèmes d’interprétation de données mutationnelles - Bases de données mutationnelles - Variants « nouveaux » = recueil d’arguments de pathogénicité - Outils bioinformatiques ++ • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009