SlideShare une entreprise Scribd logo
Qu'est-ce que l' ADN?
A cide
D ésoxyribo
N ucléique
ucléique
Qu'est-ce que l'ADN?
L'ADN est un long filament composé
d'une succession de lettres (A, T, C et G).
La succession de ces lettres dans un
ordre bien déterminé constitue la séquence
de l'ADN.
La séquence de l'ADN contient toutes
les informations nécessaires à la cellule
pour fabriquer ces protéines.
Qu'est-ce que l'ADN?
Lorsque la cellule travaille et fabrique des
protéines, son ADN doit être déroulé pour
pouvoir être lu: c'est la chromatine
Cependant, lorsque la cellule veut se
diviser, elle va devoir enrouler ce long
filament afin de pouvoir le partager plus
facilement. Ces sont les chromosomes.
CMC chapitre 6 la révolution génétique
L'ADN
Chr omatine et
chr omosomes
 Les molécules
d’ADN forment de
longues fibrilles
appelées
chromatine.
 Un chromosome est
un filament de
chromatine enroulé
plusieurs fois autour
de protéines
(histones)
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
de nos parents?

https://www.google.es/#q=gene-abc.ch
Qu'est-ce que nous allons hériter de
nos parents?
Pendant la réproduction sexuel,
un espermatozoide de notre père, avec
l'information génetique à lui, et
un ovule de notre mère, avec
l'information génetique à elle, vont
se fondre pour constituer le zigote
Qu'est-ce que nous allons hériter de
nos parents?
Le zigote va se diviser et developper
pour donner un nouveau individu, avec
des caracteres de la mère et du père
Qu'est-ce que c'est le CARYOTYPE ?

Le caryotype est une photographie
de l'ensemble des chromosomes d'une
cellule (numero et forme). Il permet de
dépister
d'éventuelles
anomalies
chromosomiques.
CMC chapitre 6 la révolution génétique
Le caryotype humain normal comporte
46 chromosomes, organisés en 23 paires.
On distingue 22 paires de chromosomes
appelés autosomes, et
1 paire de
chromosomes sexuels, présentant des
caractéristiques différentes selon le sexe :
ils sont notés XX chez la femme et
XY chez l'homme.
CMC chapitre 6 la révolution génétique
Vous remarquez qu'il y a toujours un
nombre pair de chromosomes.
En

effet,

les

chromosomes

vont

toujours par paires: un des membres de
la paire vient la mère et l'autre membre
vient du père.
La cellule est dite diploïde si elle a 2
jeux de chaque chromosome
(un paire, 1 chromosome qui vient de la
mère et 1 qui vient du père).
Si n représente le nombre de
chromosomes de chaque type, la formule
chromosomique d'un individu s'écrit
2n = 46.
Seulement les gametes (espermatozoides
et ovules) sont des cellules haploïdes (n),
car ils ont juste un chromosome de chaque
paire
n

n

Caryotype d'une cellule somatique 2n
Reconocer el cariotipo de pares de
cromosomas y el cariotipo de pares
de cromosomas en división

A

B
La str uctur e de
l’ADN
Le manuel d’instructions des processus de la vie : l’ADN
Des scientifiques découvrent la structure de l'ADN, le
fondement matériel de l'hérédité (1953)
L'équipe de Watson et
Crick propose un modèle
de l'ADN à partir des
travaux de Rosalind
Franklin
Crick

Watson
Watson et Crick élaborent un modèle de l’ADN à
partir des travaux de Franklin (1953)
1953 Rosalind FRANKLIN démontre que l'ADN possède une
structure hélicoïdale grâce à sa radiographie par diffraction de
rayons X. Elle en conclue que les squelettes désoxyribosephosphate sont à l'extérieur de la double hélice.
• Rosalind Franklin
• Morte à 38 ans d'un
cancer
• Son équipe a reçu le
prix Nobel en 1962
mais pas elle !!!

Radiographie de
l'ADN par diffraction
de rayons X
La fonction de l'ADN
ADN est l'abréviation d'acide désoxyribonucléique. C'est la
molécule de hérédité. Elle contient sous forme codée toutes les
informations relatives à la vie d'un organisme vivant, du plus
simple au plus complexe, animal, végétal, bactérien, viral.

La fonction de l'ADN est de fabriquer les
protéines dont l'organisme a besoin.
L'ADN contient donc toutes les informations
susceptibles de créer et de faire vivre un
organisme.
L’ADN est composé d’unités
appelées nucléotides
 Un nucléotide

sucre désoxyribose
Les nucléotides
Un nucléotide est une molécule formée de trois parties:
Une base azotée
Les bases azotées sont des molécules
organiques formées d'un ou deux cycles
où alternent des atomes de carbone et
d'azote.

Un sucre, le désoxyribose.
Le désoxyribose est un pentose
(sucre à 5 carbones). Il a une
formule semblable à celle du
ribose .
Un groupement phosphate
Nucléotide

Phosphate

Base

Sucre
Il y a quatre sortes de bases azotées :

Les bases azotées adénine et guanine appartiennent au groupe
des purines alors que les bases thymine et cytosine appartiennent
au groupe des pyrimidines. Les purines sont formées de deux
cycles alors qu'il n'y en a qu'un pour les pyrimidines.

Il y a donc quatre sortes de nucléotides
4 bases de l’ADN
Cytosine

Adénine

Thymine

Guanine
Les nucléotides peuvent se lier les uns aux autres par leur
sucre (désoxyribose) et leur groupement phosphate :
●

i

Donc, deux chaînes de nucléotides peuvent s'unir l'une à l'autre si
leurs bases sont complémentaires, c'est à dire si le A d'une chaîne
fait face à un T de l'autre et si le C d'une chaîne fait face au G de
l'autre:
Phosphates
Sucres
Bases
Les paires de bases

A

T

C

G

2 liaisons hydrogène

3

liaisons hydrogène
CMC chapitre 6 la révolution génétique
La séquence de nucléotides
Le code génétique

A
C
ACGTTCAC
TGCAAGTG

T
G
La séquence de nucléotides
Le code génétique

A
C
ACGTTCAC
TGCAAGTG

T
G
Quelle est la longueur totale de
l’ADN du corps humain?
 Longueur d’une molécule
d’ADN ?
 Environ 3 à 5 cm


http://hypertextbook.com/facts/1998/StevenChen.shtml
 Longueur totale de l’ADN dans
une cellule humaine ?
 Environ 2 à 3 m



http://hypertextbook.com/facts/1998/StevenChen.shtml
Longueur totale de l'ADN du corps
humain

= 2.0 × 10 mètres
13
C’est l’équivalent de 70 voyages allerretour entre la Terre et le Soleil !
Exercice sur les nucléotides (compléter
le tableau)
Nom de la base

symbole

Adénine

A

Cytosine

C

Guanine

G

Thymine

Nucléotide
complémentaire

T

Exemple d'un segment d'ADN de votre choix:
filament codant (brin codant): TAC GAC CAC CTC TCC ACG GAC ATT
filament complémentaire:
___ ___ ___ ___ ___ ___ ___ ___
Les OGM

Organismes génétiquement
modifiés
Un organisme
génétiquement
modifié (OGM) est
un organisme vivant
dont le patrimoine
génétique a été
modifié par
l'Homme.
Élaboration des organismes
transgéniques
Les différentes étapes de la création
d'un OGM sont 
•L'identification et le clonage de la
séquence d'intérêt à introduire dans
l'organisme cible.
•La réalisation du transgène, c'est-à-dire
la molécule d'ADN à introduire dans
l'organisme cible, il peut s'agir de la
séquence d'intérêt seule, ou d'une
séquence comportant plusieurs gènes.
•L'introduction du transgène dans une
cellule de l'organisme cible, puis son
intégration au génome.
•Dans certains cas une étape de
régénération d'un organisme complet est
nécessaire.
CMC chapitre 6 la révolution génétique
CMC chapitre 6 la révolution génétique
BACILLUS THURIGIENSIS EN LAS PLANTAS DEL
ALGODON
Un
animal
transgénique est
un
animal
au
génome auquel a
été introduit par
transgénèse un ou
plusieurs gènes.
En agronomie, les plantes
génétiquement modifiées représentent
une des dernières évolutions des
méthodes d'amélioration des plantes.
Avantages
1. Des aliments
avec une plus
grande
productivité

2. Des
aliments
plus nutritifs
Désavantages
1. Des risques
pour le milieu
naturel

3. Faute
d’information et
transparence

2. Faute de sécurité pour la
santé des personnes
Les inconvénients:







-qu’ils peuvent entraîner des allergies.
-qu’ils peuvent créer de nouvelles substances toxiques ou
produire des substances déjà existantes, et donc polluer
l’environnement.
-qu’ils peuvent entraîner un non-fonctionnement des
antibiotiques dans l’organisme et donc le laisser avec des
défenses faible face aux maladies.
-qu’ils peuvent infecter les champs voisins.
http://www.agromeat.com/53295/fresas-modificadas-geneticamente-logran-durar-mas-sin-perder-sa
D'AUTRES EXEMPLES
LES PYRALES DU MAÏS
SAUMON MODIFIÉ GÉNÉTIQUEMENT
DORYPHORE DE LA POMME DE
TERRE
Comment fabrique-t-on un OGM ?
Cultures de OGM dans le
monde
Principaux producteurs
(source http://www.isaaa.org/)
Pays
Etats-Unis
Argentine
Brésil
Canada
Chine
Paraguay
Inde
Afrique du Sud
Uruguay
Australie
Mexique
Roumanie
Philippines
Espagne

Millions d’Ha
de PGM (2005)
49.8
17.1
9.4
5.8
3.3
1.8
1.3
0.5
0.3
0.3
0.1
0.1
0.1
0.1

62
Savez-vous vraiment ce que
vous mangez?
Étiquettes des aliments transgéniques

Voyez la différence...
Quels OGM a-t-on déjà produits et dans quel but?

La technique de
transgène est
récente. Seul un petit
nombre de plantes
transgéniques sont
disponibles, mais les
applications sont
nombreuses..
Les applications de la transgénèse
●

a)L'agronomie
___Pâtes à papier

●

●

b) L'industrie
c)L'alimentation

___Qualités nutritionnelles
___Résistance aux herbicides
___Maturation des fruits
___Résistance aux insectes
___Vaccins

●

d) La santé

___Produits sanguins
___Colorants
SOLUTIONS
L'AGRONOMIE:
●

●

L'INDUSTRIE

Résistance aux
herbicides

●

Pâtes à papier
Colorants

●

Résistance aux insectes
L'alimentation

La santé

Qualités nutritionnelles

●

●

Maturation des fruits

●

●

Vaccins

Produits sanguins
El PGM
CCCCTGACGACCGATTCAAAAACCACTTTCCTCTTTTACGGCGCCCTAGCGCTATGGCGGTGAAGACTGCTTGACATTAACATGCCTGTTGAGGCTAGAGAATCCATGCGAAGGCGGTTCGGAAACTGCTTCGAAGGCGTGGGGTGGTGCGGGGGGTGG
GATTTGAACCCACGCAGGCCTACGCCATCGGGTCCTAAGCCCGACCCCTTTGGCCAGGCTCGGGCACCCCCGCACCGTGTAGTCTTTAGGTTTAGCTTTCAGGGTTAAAACGGTTTAACACTCATGAGTATCACTGGGCTGGCTGTGACTGGGCTCTGC
ATTCCCGAGGCCATGCTGCCCGTGAGGAATAACGGGTCTGAGGAGCCGTTGACAGGTTGCCATTTGGCCTTGCCCCCAAAAGTGATGCTGTGGATCACGACCTCCTCGGAGGAGGGGAGCCTCAGCATACACTTTATAATGAAGGCTTTAAGGGTTTAG
CCGGATAATGTTGTTGGGGCGTGCAGCGGCAAGTGCTGCAGCTCATGGGTATGGTATGCGGCTTTGCCTGGTGATGCGGTTTGGCCCCCGTTGTCTGCGACGTCTGCGGTGTTAGGAGGGCTGTGGTGCTGCAGCGCCACACGGGAAGGCGGCTCTGCA
GGGAGTGCTTTAGGGAGGATATAGTGGGGAGGGTCAGGAGGGAGGTTGAGAGGTGGGGGATGATAGGCCCTGGGGAGACGGTCCTCCTAGGCCTGAGCGGCGGTAAGGACAGCTATGTCCTGCTGGACGCCCTCTCCGAGATAGTCGGGCCCTCGAGGC
TGGTGGCGGTGTCTATAGTGGAGGGCATACCGGGGTACAACAGGGAGGGAGATATCGAGAAGATCAGGAGGGTGGCCGCGGCTAGGGGCGTCGACGTGATAGTGACGAGCATAAGGGAGTACGTGGGGGCCAGCCTCTATGAGATATACTCCAGGGCCC
GAGGGAGGGGGGCGGGCCACGCCGCCTGCACCTACTGCGGCATAAGCAGGAGGAGGATACTTGCCCTCTACGCCCGCCTCTACGGCGCCCACAAGGTCGCTACGGCCCACAACCTCGACGACGAGGCGCAGACAGCTATAGTGAACTTCCTCAGGGGGG
ACTGGGTTGGCATGCTGAAAACACACCCCCTCTACAGGAGCGGGGGCGAGGACCTGGTTCCAAGGATAAAGCCTCTTAGGAAAGTCTACGAGTGGGAGACGGCCAGCTACGTGGTACTCCACCGCTACCCCATCCAGGAGGCTGAATGCCCCTTCATAA
ACATGAACCCAACCCTCAGGGCGAGGGTGAGGACGGCCCTGAGGGTGCTAGAGGAGAGGAGCCCGGGCACCCTGCTCAGGATGATGGAGAGGCTCGACGAGGAGCTGAGGCCGCTGGCCCAGGCCATGAAGCCCTCCTCCCTAGGCAGGTGCGAGAGAT
GCGGGGAGCCGACCAGCCCGAAGAGGAGGCTCTGCAAGCTCTGCGAGCTCCTGGAGGAGGCCGGGTTCCAGGAGCCCATCTACGCGATCGCAGGGAGAGGCAAGAGATTAAGGCTTCAGAGCCCCACCGCTAGCCCTGGGTGAACGCGCTATGGCAAAG
CCAAAGGTTAGCCTGCCGGAGGATGTGGAGCCCCCCAAGGCTATAGTCAAGAAGCCTAGGCTAGTGAAGCTAGGCCCCGTAGACCCGGGGGTCAGGAGGGGAAGGGGGTTCAGCCTAGGCGAGCTCGCGGAGGCTGGGCTAGACGCTAAAAAGGCGAGG
AAGCTTGGCCTGCACGTGGACACGAGGAGGAGGACGGTCCACCCGTGGAACGTGGAGGCCCTCAAGAAGTATATAGAGAGGCTTAGAGAGGCGGGCGTAGAGGTCTAGACCCCGGGGCTATATACTACCACTTCGCCCTCCCCATTATACTATCCACAT
CCACCCTGGCCCTCCCCACCTCCAGGACCTCAATATCCCCCTCAGCCCTGGTGTACACGCTCAAAGACGGCTCCCTGTAGGAGGCCCTGGTCACCACCCCCACGTGAATCACCCCTCCCGCGTGTACGGCGGCTATAAGCCCCCTCTCCCAGCCCTCCC
GGAGGACGCGGAGCCCGGAGCCTACTCCGACCCTACCGCCCCTCCTCGCCACAACCACTATGTCCCCGTCAACACTCTCACCATAGAGGGCGGCTGGGTGTAGGGCCTTGAGGGCCTCGTGGGCCAGAGGCTCCCCCCGGAATATCGGCGCGCCAACTA
TCTCGGCCTCGCCGGGCCTGACCCTCCTCTCCCTCCCTCCCGAGGTCCTAAGGGCTATCAGCCTCTCCCTATGAAGAGCCCTCTCCCCCCGGCTCTTGCCCGCCTCTCCAGCCAGCCTCTCCACAGACAGAGTGTCAAGCCCCCACACCCTCTCGAGCA
GCCTGGCCCGTCGGCTGGCTATGCCCACCGCGACTACAAGCCTTGCTCTAGAGGCTATGGCGAGGGCTGCCTTAGACTCGAGCCCCTCCCACAGTGATATCCAGCCATCTGTATCCACTACCACCTGGCTGGCCAGTGAGGCCAATCTAGATGCGCAGG
CGAGGTAGCGGGACTCCGACCCCCGGGGGGTGAAGCCGCCGACGAAACACGGCTCGACACTCGAGAACGAGTCGTCTAGGCCCGGGACGGCCACGCCCTGTGGAGACGCCAGCGCCATAAACCCCGGGGCGAAGACCTCGTTCTGGCCTATATCCGCCG
ACAGCAGTCTATACCCACCACCGCCCCTGTTAACTATCCAAGCCGCTAGTGTGCTCTTACCGGAGTCGCTCGGCCCCACAATAGCCACCCTGCCCCGCTGAGAGGCCTCCCTGGCTATGGAGTCGAACCTGTTGTAAGCCTCCTCCACGCCCCCTGTGG
AGACTACACCGGACACAATAGCCCTCCCCTCAACCCTGGCGAGCACCGACCTGCCTGCAGGGACCACTAGAGTAGAGCCCTCCCCCAGCCTTCCACCCAAAACCTCTGCAGCACCCTCTACAACCTCTATCCTCCCCGGGCCGCGGACTAGCGCCGAGC
CCCATGCAATCTCCACAGGCAAAGCTTTAAACCCCCAGTGGTAAGATATGTGAACCGGGCCGCGGTAGTATAGCCTGGACTAGTATGCGGGCCTGTCAAGGGCCCCGCCTCCGCCCCACCCTCATTCTACTACACGCTTATCAGGATAAACAGCCGGGC
AAACGTTTTTAACCCCGCCGAAATTCATACTCTTCCCGGGGCGGAGGCGGGCCTGCGGAGAGCCCGTGACCCGGGTTCAAATCCCGGCCGCGGCGCCAATAATCCTCGCGGCCCGCCTTCAAGACTCACTAAACCCCGGTTGAGCACCCGCAGCATCGA
TGCTAAGGCTCGAGCCATGCATAGTGCCCGCGGGGGGTGGGGGGATTTGGCGAGGCCTGTTGAGGCGGTAAAGAGGCTGCTGGAGAGGTGGCTGGAGGGTAGGAGGAGGGGTTATGTCCTTACGCTTGTAGCTCTTAGAAGGCTTGAGGAGAGGGGGGA
GGAGGCTACTGTAGAGAGGGTTAGGGAGGAGGGCCTGAGGATTCTGGAGAGGACGGAGGGGAGGATAGACTGGGGTGTTACTAGGGATGAGTACACTGTCAACATGGTCTCCAGCGTTCTTCGCGAGCTGGCCGAGAGCGGCCTTGTCGAGATGGTGGA
CGGCGGGAGGAGTATCGTCAGGTACAGGATAGCGAGGGATGCTGAGGAGGAGTTCCTCTCCAGCTTCGGCCACCTCCTGCAGCTTGTGAGGATGCCGAAGTAGCGTTAAAGCCCTAGGTGCCAGAGGCCGCCGGAGGCTAAGAGGCCGATGAAGGCCTT
GAGAGGCTCTGCCGCCAAGCTATCCCTATCCCTGCTGCTCTTTTGGGCTAGCTACTCGATCTACTACACTATAACGAGGCGTGCTGTAGAGGAGGGCCTAGGAGAGGGATCCTACCTCCTGGGCGTCTTGATGTCGGGGGCTGAGGAGGCGCCGCTCGC
GGCGTCAATAGTCCTTGGCTACCTGGCGGACAGGCTAGGCTACCGCTTACCCCTGGCCCTGGGCCTGTTTGAGGCTGGGCTGGTCGCTGCAATGGCCTTCACCCCCCTAGAGACCTACCCCATACTGGCTGGGGCTGCGTCGCTAGTCTACGCCCTCTC
ATACTCCGCCCTAATGGGCCTCGTCCTGGGTGAGAGCGGGGGGAGCGGCTTCAGGTACAGTGTTATAGCAGCCTTCGGCAGCCTTGGCTGGGCTCTCGGCGGGTTGGCGGGGGGAGCGGCTTACTCCCGCCTGGGGTCACTGGGGCTCCTAGTGGCCGC
AGCCCTCATGGCCGCCTCATACCTAGTCGCCCTCTCAGCCTCGCCCCCCCGCGGCGGCGCGGCGCCCAGTGTGGGGGAGACGATAACCGCTCTGAAGGGGGTTCTGCCCCTATTTGCAAGCCTCTCAACCAGCTGGGCGGCCTTGGGCTTCTTCTTCGG
GGCTGCCAGCATAAGGCTTAGCGAGGCGCTCGAGAGCCCTATCGCCTACGGGCTAGTGCTGACCACCGTCCCCGCACTCCTAGGCTTCCTGGCGAGGCCTGCGGCGGGCAGGCTGGTCGACAAGGCCGGGGCTGTGGCAGTGCTTGCGTTGTCCAACGC
GGCATACTCCCTTCTCGCCCTAGTTTTCGGCCTGCCCACCAGTCCGGCCCTGCTGGCCCTTGCATGGAGCCTGCCCCTATACCCCTTTAGGGATGCCGCCGCGGCCATCGCAGTTAGCAGCAGGCTTGAGAGGAGGCTGCAGGCGACGGCCGCGGGGCT
GCTCTCAGCGAGCGAGAGCGTCGGCGGCGCTGCAACCCTTGCCCTGGCACTGCTCCTGGATGGGGGGTTTAGGGAGATGATGACGGCTTCAATAGCCCTTATGCTCCTCTCCACCCTACTCCTGGCCGCAGACCACTCTACGGCTCCACGCCGAGAGCC
CTGTCCCCGGCGTCGCCAAGGCCCGGCACTATGAAGTAGTTCTCGTCCAGCTCGGGGTCTAGGGCTAGCGTGTATATGGGGGTGTCGCCGTAGAGGGATGATATGTACTCGACGCCCTGCCTGGACGCTATTATAGAGCCTATAACGACCTTGCTGGCC
CCCCTGTCTCTGGCCAGCCTCACGGCCTCCGCCACAGTCTTGCCCGTGGCCAGCATCGGGTCTAGAACGACGGCGGGGCCGTCGAACATGCGGGGTAGCCTGGAGTAGTAGACCTCTATCTTGAGCCTGCCCGGCTCCTCGACCCTCCTGGCTGCTACG
AGGGCTATCCTCGCCTCCGGCATCATCGAGGCGAAACCCTCTACCATGGGGAGGCTAGCCCCGAGTATCCCTACGAGGTAGACGGGCCCCGCTGGCGCCAGCTCCTTGGCCTTAGCCCCCAGGGGGGTCTCCACCTCCTCCTCCACCCACCCGAGCTCG
CCCGCAATGTACACCGCCAGTATGGAGCCCGCTATCCTGACGTACCTCCTAAACTCCGGGAACCCGGTTGTCCGGTCCCTGAGAACCTTGAGGACGTAGCGCGCTAGGGGTGTTTCGCCCCCAATAACCCTAACTGCCGCCACCATGGGAACCTCTAGG
TAGTGGTTGAGGCTCCGGAGCTTAAGAGGGTTAAACTCCAGGATGGCCACCTGGGTGCCGCCGGGGATTGGACAGTAGGGTTCTAGAGTCCGCGTTGAGAGCCCTATCCCGCTACCCCCTCTGCGACCGCTGCCTCGGCAGGCTCTTCGCTAGGCTTGG
GAGAGGCTGGAGCAATAGGGAGCGGGGAGAGGCTGTCAAGAGGGTTCTGGTGATGGAGCTTCACAGGAGGGTCCTCGAGGGGGATGAGGCGGCGTTGAAAACCCTGGTCTCTGCAGCTCCGAACATAGGGGAGGTGGCAAGGGATGTCGTGGAGCACCT
CTCCCCAGGTTCCTACAGGGAGGGCGGCCCATGCGCTGTCTGCGGCGGGCGGCTGGAGAGTGTTATAGCCTCAGCGGTGGAGGAGGGGTACAGGCTGCTAAGGGCTTACGATATCGAGAGGTTCGTAGTCGGGGTCCGGCTAGAGAGAGGTGTTGCCAT
GGCTGAGGAGGAGGTAAAGCTGGCCGCCGGCGCCGGGTACGGCGAGTCCATTAAGGCTGAGATCAGGAGGGAGGTGGGCAAGCTCCTGGTGAGCCGGGGTGGAGTGACCGTGGACTTCGACAGCCCTGAAGCGACCCTAATGGTGGAGTTCCCCGGGGG
CGGGGTTGACATACAGGTCAACAGCCTGCTCTACAAGGCTAGGTACTGGAAGCTTGCCAGGAACATAAGCCAGGCATACTGGCCCACGCCAGAGGGGCCGAGGTACTTCAGCGTGGAGCAGGCTCTATGGCCGGTTCTAAAGCTCACTGGGGGGGAGAG
GCTGGTTGTACACGCTGCTGGCAGGGAGGATGTAGACGCCAGGATGCTGGGCAGCGGGAGGCCCATGATAGTCGAGGTCAAGTCGCCTAGGCGCAGGAGGATCCCGCTTGAGGAGCTGGAGGCGGCCGCCAACGCCGGCGGGAAGGGGCTGGTTAGGTT
CAGGTTCGAGACGGCTGCCAAGCGTGCCGAGGTCGCGCTTTACAAGGAGGAGACTGCGAGGGTTAGGAAGGTGTACCGCGCCCTGGTAGCGGTGGAGGGTGGTGTTAGTGAGGTGGATGTTGAAGGGTTGAGGAGGGCTCTCGAGGGCGCGGTTATAAT
GCAGAGGACGCCCTCCAGGGTCCTCCATAGGAGGCCGGATATACTGAGGAGGCGGAGGCTCTACAGCCTAGACTGCAGCCCCCTGGAGGGGGCGCCTCTGATGGAGTGCATATTGGAGGCGGAAGGGGGTCTCTACATCAAGGAGCTGGTCAGCGGTGA
TGGCGGGAGAACCAGGCCAAGCTTCGCTGAGGTCCTCGGCAGGGAGGCTGTGTGTATAGAGCTCGACGTGGTGTGGGTGGAGCATGAAGCTCCAGCCGCACCCGGCTAAAGCTAAATTAAGCTGGGCTGAGCAAAATACCGGGGGGAGCGTAGGTTGGT
CAAGGCACCTAGAGGCTATAGGAACAGGACTAGGAGGCTGTTGAGGAAGCCTGTGAGGGAGAAGGGCAGCATACCCAGGCTCAGCACCTACCTTAGGGAGTACAGGGTGGGCGATAAGGTGGCTATAATCATAAACCCCTCCTTCCCAGACTGGGGCAT
GCCCCACAGGAGGTTCCACGGGCTGACGGGAACCGTGGTGGGGAAGAGGGGCGAGGCCTACGAGGTAGAGGTCTATCTGGGTAGGAAGAGGAAGACCCTCTTCGTCCCCCCCGTGCACCTCAAACCCCTCAGCACAGCCGCCGAGAGGCGGGGCAGCTA
GAGCTGTCCCCACGGTTCCACGCTGGAGTAGGGGGTGCTAGTGTTGGAGAGGAGGATCCTAGAGTATAAGGCGGTGCCCTACCAGGTAGCCAAGAAGTATATGTACGAGAGGGTTAGGGAGGGCGACATAATATCGATACAGGAGTCGACTTGGGAGTA
CTTCAGGAAGGTAGTGTTCTGGGACGACCCGGAGGCTGCCTCCGAGCTTGTTGAGGAGATTGTGAAGGAGGGTGTCAGCCGTGAGGCGCGGCGAACATCGCGAGCATATGCCCCAAGACCGAGGGCGAGCTCAGGAGCATTCTCGAGATGGACAGGAGC
ATAACCTCCGTACACGAGATGGCTAGCAAACTGTACCCCATAGTTTCCAAATACTGCAAGGACTAGACCCCGCCCCCCTTCAGCCCGGGGATTAACAGTTTAATCTCCGCGTCCCAACCATATTTATGTTGATAGCGGCTGTACGGAGAGTGTTGAGAA
GTGTCTAGACAGCCCCGCCCCCGCGACAGGAAGCCCCCCCACCAGGGGAGGCCGCAGCCCCACATCGCCGCCCTTGAGGTGGAGGCTATAGTTCTGGACTACATACCCGAGGGCTACCCGAGAGACCCCCACAGGGAGCACCGCAGTAAGCCCGTCGTT
CAGGGTCTCGGGGTTAGGAGGCTGCACCTAGTCGACGGTGTCCCCCTCCATGAGGTCGATATACTGGAGCGGGTCACCCTGGCTAGGGAGGTTGTGTATAGCGTCCCCATAGTGGCCCGGCTCCCCGGGGGGGTCGAGAGGAGGGTGAAAAGTGTTACC
GTCGCGGTAACATGCCTCCCCGGCCAGGCGCGGGAGGGCGGGGTCAGGGAGATATACTGCTACCCCCTCTCCTACGCCGACCAGGCGACCCTGGAGGCGCTGCAGCAGCTCCTGGGTGAGGGGGACGAGAGGCACAGGTATATACTTGTGGACTCCCCC
GACAAGCTCTCCGAGGTGGCCAGAGGTCACGGCCTCTCGGGGAAGATAGTGAGCACGCCCAGAGACCCTATATCCTACCAGGACCTCACCGACGTCGCCAGGGCTACGCTGCCGGACGCTGTGAGGAAGCTGGTCAGGGAGAGGGAGGACTTCTTCGTG
GAGTTCTTCAACGTGGCCGAGCCGATAAACATAAGGATACACGCGCTGGAGGCCCTAAAGGGTGTGGGTAAGAAGATGGCTAGGCACCTCCTCCTCGAGAGGGAGAGGCGTAGGTTCACGAGTTTCGAGGAGGTGAAGAAGATTCTGAAGATAGACCCC
GCAGAGGCCCTGGCCGAGAAGATAATGGAGGAGATAGAGTGTAGGGACACTGTGAAATACTACTTCTTCGTCGAGCCCTGCGACCCCTCCAAGCCCTACCTAGGCTACACGGAGAGGATGTGGAAGGCCTATGCC

Le génome humain est 380,000 fois plus long que la
séquence qui est représentée sur cette image.
LA BIOTECHNOLOGIE ET LES
MALADIES GÉNÉTIQUES
Nous sommes tous atteints de
maladies génétiques
Actuellement sur
18,000 gènes humains
«connus», 1,600 sont
associés à des
maladies génétiques

Il s’agit dans la plupart des cas de maladies «simples» (par opposition avec des
maladies multifactorielles);
Il est possible que plus de la moitié de nos gènes puissent être les «vecteurs»
de maladies génétiques et ceci malgré la grande redondance de notre génome;
Nous sommes sûrement tous porteurs de «défauts» plus ou moins graves.
Génome et médecine
• Il est évident que beaucoup de choses seront
petit à petit possibles. Par exemple:
– Diagnostique précoce et guérison des cancers;
– Thérapie génique pour corriger les «défauts» associés
aux maladies génétiques;
– Individualisation de la pharmacopée: déterminer le
médicament adéquat et la dose optimale qui
correspond au métabolisme personnel du malade;
– Réparation des lésions de certains tissus. Examples:
réparation du muscle cardiaque, guérison de la
paraplégie/tétraplégie;
– Développement d’antibiotiques et d’antiviraux très
ciblés.
...
Merci de votre
attention…
Somos lo que comemos
Que el alimento sea vuestra

Contenu connexe

Tendances

De l’ADN à l’individu
De l’ADN à l’individuDe l’ADN à l’individu
De l’ADN à l’individu
Achelouji Jawad
 
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
NDOOLENGASHANIDieume
 
P t1 tp1correction1
P t1 tp1correction1P t1 tp1correction1
P t1 tp1correction1
Florence BOLOGNESI
 
La différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la ChromatideLa différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la Chromatide
Abdorraza3
 
Struct Chromosome
Struct ChromosomeStruct Chromosome
Struct Chromosome
guestd0be2
 
Qcm | génétiques de la synthèse des protéines
Qcm | génétiques de la synthèse des protéinesQcm | génétiques de la synthèse des protéines
Qcm | génétiques de la synthèse des protéines
Dr. Abdellah Benrahou
 

Tendances (7)

De l’ADN à l’individu
De l’ADN à l’individuDe l’ADN à l’individu
De l’ADN à l’individu
 
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
Tp unigom groupe_nâ°14_(le_noyau)unigom[1]
 
P t1 tp1correction1
P t1 tp1correction1P t1 tp1correction1
P t1 tp1correction1
 
La différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la ChromatideLa différence entre le chromosome et la Chromatine et la Chromatide
La différence entre le chromosome et la Chromatine et la Chromatide
 
Communiqué_mTurquoise2
Communiqué_mTurquoise2Communiqué_mTurquoise2
Communiqué_mTurquoise2
 
Struct Chromosome
Struct ChromosomeStruct Chromosome
Struct Chromosome
 
Qcm | génétiques de la synthèse des protéines
Qcm | génétiques de la synthèse des protéinesQcm | génétiques de la synthèse des protéines
Qcm | génétiques de la synthèse des protéines
 

En vedette

3º ESO Chapitre 1
3º ESO Chapitre 13º ESO Chapitre 1
3ºeso chapitre10
3ºeso chapitre103ºeso chapitre10
3º ESO Chapitre 11. IBI
3º ESO Chapitre 11. IBI3º ESO Chapitre 11. IBI
3º ESO Chapitre 11. IBI
Inmaculada Martin-castaño carrasco
 
4ºeso tema5 l'évolution des êtres vivants
4ºeso tema5 l'évolution des êtres vivants4ºeso tema5 l'évolution des êtres vivants
4ºeso tema5 l'évolution des êtres vivants
Inmaculada Martin-castaño carrasco
 
4ºeso Chapitre 9 Le Rélief
4ºeso Chapitre 9 Le Rélief4ºeso Chapitre 9 Le Rélief
4ºeso Chapitre 9 Le Rélief
Inmaculada Martin-castaño carrasco
 
CMC chapitre 5 réduit
CMC chapitre 5 réduitCMC chapitre 5 réduit
CMC chapitre 5 réduit
Inmaculada Martin-castaño carrasco
 
De l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorpsDe l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorps
Institut Pasteur de Madagascar
 
Lab 2
Lab 2 Lab 2
Extraction of Nucleic Acid From FFPE Tissue Samples
Extraction of Nucleic Acid From FFPE Tissue SamplesExtraction of Nucleic Acid From FFPE Tissue Samples
Extraction of Nucleic Acid From FFPE Tissue Samples
Thermo Fisher Scientific
 
Tp1 industriel :criblage des souches productrices des substances antibectérie...
Tp1 industriel :criblage des souches productrices des substances antibectérie...Tp1 industriel :criblage des souches productrices des substances antibectérie...
Tp1 industriel :criblage des souches productrices des substances antibectérie...
sara saidi
 
Primants Adn
Primants AdnPrimants Adn
Primants Adn
Mª José
 
Nucleic Acid Quantification Methods - DNA / RNA Quantification
Nucleic Acid Quantification Methods - DNA / RNA QuantificationNucleic Acid Quantification Methods - DNA / RNA Quantification
Nucleic Acid Quantification Methods - DNA / RNA Quantification
ajithnandanam
 
Genie genetique/الهندسة الوراثية
Genie genetique/الهندسة الوراثيةGenie genetique/الهندسة الوراثية
Genie genetique/الهندسة الوراثية
ILYAS YOUSSEF
 
Nucleic Acid Purification
Nucleic Acid Purification Nucleic Acid Purification
Nucleic Acid Purification
Sai Ram
 
Propiétés biologique des sols
Propiétés biologique des solsPropiétés biologique des sols
Propiétés biologique des sols
SELLANI Halima
 
Le Relief De La Terre
Le Relief De La TerreLe Relief De La Terre
Le Relief De La Terre
rafa5979
 
L'organisation morphologique du sol
L'organisation morphologique du solL'organisation morphologique du sol
L'organisation morphologique du sol
SELLANI Halima
 

En vedette (20)

CMC Chapitre 5 Des greffes aux cellules souches
CMC Chapitre 5 Des greffes aux cellules souchesCMC Chapitre 5 Des greffes aux cellules souches
CMC Chapitre 5 Des greffes aux cellules souches
 
3º ESO Chapitre 1
3º ESO Chapitre 13º ESO Chapitre 1
3º ESO Chapitre 1
 
3ºeso chapitre10
3ºeso chapitre103ºeso chapitre10
3ºeso chapitre10
 
3º ESO Chapitre 11. IBI
3º ESO Chapitre 11. IBI3º ESO Chapitre 11. IBI
3º ESO Chapitre 11. IBI
 
4ºeso tema5 l'évolution des êtres vivants
4ºeso tema5 l'évolution des êtres vivants4ºeso tema5 l'évolution des êtres vivants
4ºeso tema5 l'évolution des êtres vivants
 
CMC Chapitre 2 L'évolution
CMC Chapitre 2 L'évolutionCMC Chapitre 2 L'évolution
CMC Chapitre 2 L'évolution
 
4ºeso Chapitre 9 Le Rélief
4ºeso Chapitre 9 Le Rélief4ºeso Chapitre 9 Le Rélief
4ºeso Chapitre 9 Le Rélief
 
CMC chapitre 5 réduit
CMC chapitre 5 réduitCMC chapitre 5 réduit
CMC chapitre 5 réduit
 
3º eso Chapitre 13 réduit
3º eso Chapitre 13 réduit3º eso Chapitre 13 réduit
3º eso Chapitre 13 réduit
 
De l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorpsDe l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorps
 
Lab 2
Lab 2 Lab 2
Lab 2
 
Extraction of Nucleic Acid From FFPE Tissue Samples
Extraction of Nucleic Acid From FFPE Tissue SamplesExtraction of Nucleic Acid From FFPE Tissue Samples
Extraction of Nucleic Acid From FFPE Tissue Samples
 
Tp1 industriel :criblage des souches productrices des substances antibectérie...
Tp1 industriel :criblage des souches productrices des substances antibectérie...Tp1 industriel :criblage des souches productrices des substances antibectérie...
Tp1 industriel :criblage des souches productrices des substances antibectérie...
 
Primants Adn
Primants AdnPrimants Adn
Primants Adn
 
Nucleic Acid Quantification Methods - DNA / RNA Quantification
Nucleic Acid Quantification Methods - DNA / RNA QuantificationNucleic Acid Quantification Methods - DNA / RNA Quantification
Nucleic Acid Quantification Methods - DNA / RNA Quantification
 
Genie genetique/الهندسة الوراثية
Genie genetique/الهندسة الوراثيةGenie genetique/الهندسة الوراثية
Genie genetique/الهندسة الوراثية
 
Nucleic Acid Purification
Nucleic Acid Purification Nucleic Acid Purification
Nucleic Acid Purification
 
Propiétés biologique des sols
Propiétés biologique des solsPropiétés biologique des sols
Propiétés biologique des sols
 
Le Relief De La Terre
Le Relief De La TerreLe Relief De La Terre
Le Relief De La Terre
 
L'organisation morphologique du sol
L'organisation morphologique du solL'organisation morphologique du sol
L'organisation morphologique du sol
 

Similaire à CMC chapitre 6 la révolution génétique

1er cours génétique.pdf
1er cours génétique.pdf1er cours génétique.pdf
1er cours génétique.pdf
SidahmedZerroukisba
 
4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI
Inmaculada Martin-castaño carrasco
 
4ºeso chapitre 2
4ºeso chapitre 24ºeso chapitre 2
4ºeso chapitre 2
imarcascar
 
Hérédité
HéréditéHérédité
Hérédité
corpin0172
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
kristinacraft1
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
balamane
 
Biochimie structurale La structure_des_acides_nucliques.ppt
Biochimie structurale  La structure_des_acides_nucliques.pptBiochimie structurale  La structure_des_acides_nucliques.ppt
Biochimie structurale La structure_des_acides_nucliques.ppt
kowiouABOUDOU1
 
genetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptxgenetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptx
dangerinflammable
 
M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009
Elsa von Licy
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Miraj Microbio
 
les plasmide.pptx
les plasmide.pptxles plasmide.pptx
les plasmide.pptx
ImeneFl
 
Genetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suiteGenetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suite
sciencesalannoy
 
Ps t1 acquis
Ps t1 acquisPs t1 acquis
Ps t1 acquis
Florence BOLOGNESI
 
Ps t1 acquis
Ps t1 acquisPs t1 acquis
Ps t1 acquis
Florence BOLOGNESI
 
genetique2an-replication_adn2020hanachi.pptx
genetique2an-replication_adn2020hanachi.pptxgenetique2an-replication_adn2020hanachi.pptx
genetique2an-replication_adn2020hanachi.pptx
dangerinflammable
 
Le chapitre 6: Reproduction Sexuée
Le chapitre 6: Reproduction SexuéeLe chapitre 6: Reproduction Sexuée
Le chapitre 6: Reproduction Sexuée
mllemarin38
 
chromosome et chromatine
chromosome et chromatine chromosome et chromatine
chromosome et chromatine
ARICHI Bouchra
 

Similaire à CMC chapitre 6 la révolution génétique (20)

1er cours génétique.pdf
1er cours génétique.pdf1er cours génétique.pdf
1er cours génétique.pdf
 
4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI4ºeso chapitre 2 Reproduction et héredité. IBI
4ºeso chapitre 2 Reproduction et héredité. IBI
 
4ºeso Chapitre 2 L'héritage
4ºeso Chapitre 2 L'héritage4ºeso Chapitre 2 L'héritage
4ºeso Chapitre 2 L'héritage
 
4ºeso chapitre 2
4ºeso chapitre 24ºeso chapitre 2
4ºeso chapitre 2
 
Hérédité
HéréditéHérédité
Hérédité
 
Hérédité
HéréditéHérédité
Hérédité
 
COURS 2 PCR.ppt
COURS 2 PCR.pptCOURS 2 PCR.ppt
COURS 2 PCR.ppt
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
 
COURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .pptCOURS PCR polymerase chain reaction .ppt
COURS PCR polymerase chain reaction .ppt
 
Biochimie structurale La structure_des_acides_nucliques.ppt
Biochimie structurale  La structure_des_acides_nucliques.pptBiochimie structurale  La structure_des_acides_nucliques.ppt
Biochimie structurale La structure_des_acides_nucliques.ppt
 
genetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptxgenetique2an-organisation_genome2020sifi.pptx
genetique2an-organisation_genome2020sifi.pptx
 
M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
 
les plasmide.pptx
les plasmide.pptxles plasmide.pptx
les plasmide.pptx
 
Genetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suiteGenetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suite
 
Ps t1 acquis
Ps t1 acquisPs t1 acquis
Ps t1 acquis
 
Ps t1 acquis
Ps t1 acquisPs t1 acquis
Ps t1 acquis
 
genetique2an-replication_adn2020hanachi.pptx
genetique2an-replication_adn2020hanachi.pptxgenetique2an-replication_adn2020hanachi.pptx
genetique2an-replication_adn2020hanachi.pptx
 
Le chapitre 6: Reproduction Sexuée
Le chapitre 6: Reproduction SexuéeLe chapitre 6: Reproduction Sexuée
Le chapitre 6: Reproduction Sexuée
 
chromosome et chromatine
chromosome et chromatine chromosome et chromatine
chromosome et chromatine
 

Plus de Inmaculada Martin-castaño carrasco

3º eso Chapitre 13 Composition et transformation des roches
3º eso Chapitre 13 Composition et transformation des roches3º eso Chapitre 13 Composition et transformation des roches
3º eso Chapitre 13 Composition et transformation des roches
Inmaculada Martin-castaño carrasco
 
CMC Chapitre 4 Vivre plus, vivre mieux
CMC Chapitre 4 Vivre plus, vivre mieuxCMC Chapitre 4 Vivre plus, vivre mieux
CMC Chapitre 4 Vivre plus, vivre mieux
Inmaculada Martin-castaño carrasco
 
3º ESO Chapitre 13 Géologie
3º ESO Chapitre 13 Géologie3º ESO Chapitre 13 Géologie
3º ESO Chapitre 13 Géologie
Inmaculada Martin-castaño carrasco
 
CMC Chapitre 3 pwpoint
CMC Chapitre 3 pwpointCMC Chapitre 3 pwpoint
CMC Chapitre 3 pwpoint
Inmaculada Martin-castaño carrasco
 
4ºeso chap3 mendel
4ºeso chap3 mendel4ºeso chap3 mendel
3ºeso chapitre12 Geologie Les Roches Sédimentaires
3ºeso chapitre12 Geologie Les Roches Sédimentaires3ºeso chapitre12 Geologie Les Roches Sédimentaires
3ºeso chapitre12 Geologie Les Roches Sédimentaires
Inmaculada Martin-castaño carrasco
 

Plus de Inmaculada Martin-castaño carrasco (12)

3º eso Chapitre 13 Composition et transformation des roches
3º eso Chapitre 13 Composition et transformation des roches3º eso Chapitre 13 Composition et transformation des roches
3º eso Chapitre 13 Composition et transformation des roches
 
4ºeso Chapitre 1 La Cellule
4ºeso Chapitre 1 La Cellule4ºeso Chapitre 1 La Cellule
4ºeso Chapitre 1 La Cellule
 
4ºeso Chapitre 3 Les lois de Mendel réduit
4ºeso Chapitre 3 Les lois de Mendel réduit4ºeso Chapitre 3 Les lois de Mendel réduit
4ºeso Chapitre 3 Les lois de Mendel réduit
 
4ºeso chapitre 3 Les lois de Mendel
4ºeso chapitre 3 Les lois de Mendel 4ºeso chapitre 3 Les lois de Mendel
4ºeso chapitre 3 Les lois de Mendel
 
CMC Chapitre 1 Nous dans l'univers
CMC Chapitre 1 Nous dans l'universCMC Chapitre 1 Nous dans l'univers
CMC Chapitre 1 Nous dans l'univers
 
CMC ch.3 les pandémies du XXI
CMC ch.3 les pandémies du XXICMC ch.3 les pandémies du XXI
CMC ch.3 les pandémies du XXI
 
CMC Chapitre 4 Vivre plus, vivre mieux
CMC Chapitre 4 Vivre plus, vivre mieuxCMC Chapitre 4 Vivre plus, vivre mieux
CMC Chapitre 4 Vivre plus, vivre mieux
 
CMC Chapitre 5 des greffes aux cellules souches
CMC Chapitre 5 des greffes aux cellules souchesCMC Chapitre 5 des greffes aux cellules souches
CMC Chapitre 5 des greffes aux cellules souches
 
3º ESO Chapitre 13 Géologie
3º ESO Chapitre 13 Géologie3º ESO Chapitre 13 Géologie
3º ESO Chapitre 13 Géologie
 
CMC Chapitre 3 pwpoint
CMC Chapitre 3 pwpointCMC Chapitre 3 pwpoint
CMC Chapitre 3 pwpoint
 
4ºeso chap3 mendel
4ºeso chap3 mendel4ºeso chap3 mendel
4ºeso chap3 mendel
 
3ºeso chapitre12 Geologie Les Roches Sédimentaires
3ºeso chapitre12 Geologie Les Roches Sédimentaires3ºeso chapitre12 Geologie Les Roches Sédimentaires
3ºeso chapitre12 Geologie Les Roches Sédimentaires
 

Dernier

Auguste Herbin.pptx Peintre français
Auguste   Herbin.pptx Peintre   françaisAuguste   Herbin.pptx Peintre   français
Auguste Herbin.pptx Peintre français
Txaruka
 
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGESGUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
DjibrilToure5
 
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
Editions La Dondaine
 
Zineb Mekouar.pptx Écrivaine marocaine
Zineb Mekouar.pptx   Écrivaine  marocaineZineb Mekouar.pptx   Écrivaine  marocaine
Zineb Mekouar.pptx Écrivaine marocaine
Txaruka
 
Burkina Faso libraries newsletter for June 2024
Burkina Faso libraries newsletter for June 2024Burkina Faso libraries newsletter for June 2024
Burkina Faso libraries newsletter for June 2024
Friends of African Village Libraries
 
1e Espaces productifs 2024.Espaces productif
1e Espaces productifs 2024.Espaces productif1e Espaces productifs 2024.Espaces productif
1e Espaces productifs 2024.Espaces productif
NadineHG
 

Dernier (6)

Auguste Herbin.pptx Peintre français
Auguste   Herbin.pptx Peintre   françaisAuguste   Herbin.pptx Peintre   français
Auguste Herbin.pptx Peintre français
 
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGESGUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
GUIDE POUR L’EVRAS BALISES ET APPRENTISSAGES
 
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
La Révolution Bénédictine Casadéenne du Livradois-Forez: De Charlemagne à Fra...
 
Zineb Mekouar.pptx Écrivaine marocaine
Zineb Mekouar.pptx   Écrivaine  marocaineZineb Mekouar.pptx   Écrivaine  marocaine
Zineb Mekouar.pptx Écrivaine marocaine
 
Burkina Faso libraries newsletter for June 2024
Burkina Faso libraries newsletter for June 2024Burkina Faso libraries newsletter for June 2024
Burkina Faso libraries newsletter for June 2024
 
1e Espaces productifs 2024.Espaces productif
1e Espaces productifs 2024.Espaces productif1e Espaces productifs 2024.Espaces productif
1e Espaces productifs 2024.Espaces productif
 

CMC chapitre 6 la révolution génétique