SlideShare une entreprise Scribd logo
1 
Les 
biotechnologies 
végétales 
: 
créa3on 
de 
biodiversité 
dans 
les 
génomes 
végétaux 
et 
améliora3on 
des 
plantes 
Loïc 
Lepiniec 
IJPB, 
INRA-­‐AgroParisTech, 
Versailles 
et 
LabEx 
SPS 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
2 
Les 
biotechnologies 
végétales 
• Introduc3on 
– Enjeux 
sociétaux 
et 
l’amélioraKon 
des 
plantes 
– L’amélioraKon, 
de 
la 
domesKcaKon 
aux 
praKques 
actuelles 
• Les 
apports 
des 
biotechnologies 
– Biologie 
cellulaire 
et 
régénéraKon 
– Biologie 
moléculaire 
et 
génomique 
– CréaKon 
et 
uKlisaKon 
de 
la 
biodiversité 
moléculaire 
• La 
transgénèse 
– Bases 
cellulaires 
et 
moléculaires 
de 
la 
transgénèse 
– Exemples 
d’uKlisaKons 
potenKelles 
– Etat 
actuel 
des 
cultures 
• Conclusions 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
3 
12 
10 
8 
6 
4 
2 
0 
Un 
contexte 
mondial 
en 
évolu3on 
rapide 
Consommation d’d’énergie (Qbtu / yr) 
1400 
1200 
1000 
800 
600 
400 
200 
0 
Population 
mondiale 
Consommation 
d’énérgie 
2000 
2050 
2100 
Population (Milliards) 
1900 1950 
Années 
from Energy Projections IIASA / WEC, Population Projections: United 
Nations “Long-Range World, Population Projections”. Adapted from R. 
Beachy 
• Une 
demande 
croissante 
des 
produits 
de 
l’agriculture 
: 
– AugmentaKon 
de 
la 
populaKon 
(6 
à 
9 
Mds) 
– ÉvoluKon 
des 
habitudes 
alimentaires 
– Epuisement 
du 
carbone 
fossile 
– Nécessite 
d’augmenter 
de 
70% 
la 
producKon 
(Banque 
Mondiale, 
World 
Dev. 
Rep. 
2008) 
• Contraintes 
environnementales 
– Impact 
de 
l’agriculture 
sur 
l’environnement, 
– Changement 
climaKques 
– LimitaKon 
des 
ressources 
(terres 
agricoles, 
eau, 
énergie, 
ferKlisants, 
biodiversité…) 
• Conclusion, 
il 
faut 
produire 
plus 
et 
mieux… 
nécessité 
d’une 
intensifica3on 
durable 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Comment 
relever 
le 
défi 
d’une 
intensifica3on 
durable? 
4 
Améliora3on 
des 
plantes 
Bonne 
gesKon 
des 
ressources 
(eau, 
sols, 
énergie, 
biodiversité) 
PraKques 
agricoles 
Intensifica3on 
Durable 
PraKques 
industrielles 
OrganisaKon 
socio-­‐économique 
et 
poliKque 
soutenant 
le 
développement 
agricole 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Contribu3on 
possible 
de 
l’améliora3on 
géné3que? 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
5 
-­‐ Au 
cours 
des 
60 
dernières 
années, 
les 
rendements 
des 
principales 
cultures 
ont 
été 
mul3pliés 
par 
5 
-­‐ L’améliora3on 
géné3que 
a 
contribué 
pour 
+ 
de 
50% 
-­‐ Compte 
tenu 
du 
contexte 
actuel 
-­‐ augmentaKon 
des 
besoins 
en 
produits 
agricoles 
(+ 
70%) 
-­‐ Crise 
environnementale, 
limitaKon 
intrants, 
sols, 
eau 
-­‐ L’améliora3on 
géné3que 
devra 
faire 
plus 
et 
mieux… 
-­‐ Comment 
les 
biotechnologies 
ont 
déjà 
et 
peuvent 
encore 
y 
contribuer?
6 
Maïs, 
~ 7000 
ans 
Haricot, 
pomme 
de 
terre 
~ 
10,000 
ans 
L’améliora3on 
géné3que 
des 
plantes 
and by genetic, linguistic and skeletal 
human populations. The clearest such 
insight review articles 
Blé, 
orge, 
pois, 
~ 
13,000 
ans 
Fertile 
Crescent 
West Ethiopia 
Africa 
China 
Centres of origin of 
food production 
The most productive 
agricultural areas of the modern world 
hgp://arstechnica.com 
Riz 
et 
soja 
~ 
9000 
ans 
their permanent gardens, orchards and pastures, instead of migrat-ing 
to follow seasonal shifts in wild food supplies. (Some 
Eastern US 
Sahel 
Mesoamerica 
New 
Guinea 
Andes and 
Amazonia 
of 
plant and 
homelands of 
orange-shaded 
5.1 of 
productive areas 
cereals and 
yellow-shaded 
overlap 
that China 
the most 
States 
United 
The 
different 
which the wild 
domesticable 
other areas 
those 
Diamond, J. (2002) Nature 418: 700-707, Purugganan and Fuller (2009), Nature 457: 843-848) 
Riz, 
haricot 
~ 
8500 
ans 
L’amélioraKon 
des 
plantes 
débute 
avec 
la 
sédentarisaKon 
de 
l’homme, 
il 
y 
a 
10000 
ans, 
dans 
différentes 
régions 
(une 
dizaine). 
Millet 
~ 
5000 
ans 
sorgho 
~ 
4000 
ans
7 
1 
La sélection apparaît avec l’agriculture 
La domestication L’adaptation en Europe L’extension des 
Premiers 
maïs Populations 
Hybrides 
L’ancêtre 
sauvage 
Téosinte 
Apparition 
au Mexique 
Présence 
en Amérique 
Introduction 
dans le sud de l’Europe 
zones de culture 
Exemple du maïs 
Création des premiers 
hybrides en France 
-7000 ans 
1494 
1947 
Séminaire 
Biotechnologies 
-­‐ 
9 
1 
quintaux/hectare 
et 
10 
février 
2012 
90 
quintaux/hectare 
L’exemple 
du 
maïs 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
source: 
GNIS
8 
Clark 
et 
al., 
2006 
La 
domes3ca3on 
concerne 
quelques 
gènes 
majeurs 
Le 
gène 
TB1 
(TEOSINTE 
BRANCHED 
1) 
-­‐ 
code 
un 
facteur 
de 
transcripKon 
(TCP) 
-­‐ 
contrôle 
la 
structure 
branchée 
de 
la 
plante 
-­‐ 
Sa 
surexpression 
entraine 
une 
dominance 
apicale 
accrue 
et 
le 
développement 
d’une 
Kge 
unique 
et 
épaisse 
chez 
le 
maïs 
culKvé 
Doebley, et al.. (2006) Cell 127: 1309-1321, 
Le 
gène 
TGA1 
(TEOSINTE 
GLUME 
ARCHITECTURE 
1) 
-­‐ 
Code 
un 
facteur 
de 
transcripKon 
(SBP) 
-­‐ 
contrôle 
le 
développement 
des 
glumes 
-­‐ 
sa 
mutaKon 
produit 
des 
grains 
nus 
et 
fixés 
à 
l’épi 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
9 
recessive allele q (center) and wild wheat (left) with the recessive allele 
have slender, fragile spikes. 
(Fourth row) The massive fruit of cultivated tomato (right) next to the 
miniscule fruit of its progenitor (left). 
(Fifth row) A wild sunflower plant (left) has many small heads borne 
on multiple slender stalks, whereas a cultivated sunflower plant (right) 
Exemples 
similaires 
chez 
d’autres 
plantes 
Quelqhaus ea ssi 
nggèle nlaergse 
hseoadn bto 
rrnees opn oa nthiscak bstalelk.s 
de 
-­‐ 
L’égrainage 
du 
panicule 
de 
riz 
sauvage 
(qSH1 
et 
sh4) 
gathered from another location. Key to the domestica-tion 
process would be a subsequent switch from allow-ing 
-­‐ 
La 
structure 
edible wild compacte 
species et 
to naturally solide 
de 
resow l’épis 
themselves 
de 
blé 
(Q) 
in burned fields, to sowing seed gathered the previous 
season. Once this practice was established, selection 
and crop improvement could begin. 
Although cereals and other field crops were likely to 
have been domesticated in the context of large fields 
cleared by burning or by spring floods along rivers, 
other domesticates may have had their beginnings 
as weeds near seasonal campgrounds (Anderson, 
1969). Hunter-gatherers often follow seasonal migra-tory 
schedules, visiting the same specific sites at 
given times every year. The disturbance of the natural 
vegetation and middens at these sites provided fertile 
ground for the types of colonizing species that were 
the progenitors of our crops. Seeds discarded with 
the “kitchen” trash one year would sprout into a new 
crop by the time the group returned the following year. 
If they preferentially collected seeds and fruit from 
plants with the most desirable traits, then over time 
the frequency of plants with these favored phenotypes 
would increase in their garden crop. Eventually, no 
new wild seeds and fruits would be collected and a 
switch to deliberate sowing of seeds would occur. 
The early agricultural practices just described have 
Doebley 
et 
al. 
(2006), 
Cell, 
127: 
-­‐ La 
taille 
réduite 
de 
plusieurs 
plantes 
culKvées 
est 
contrôlée 
par 
des 
homologues 
du 
gène 
GAI 
impliqué 
dans 
la 
biosynthèse 
d’une 
hormone, 
chez, 
le 
blé 
(Rht), 
le 
maïs 
(Dwarf 
8), 
ou 
le 
colza 
(Bzh) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
L’améliora3on 
repose 
sur 
l’u3lisa3on 
de 
la 
biodiversité 
10 
La 
domesKcaKon 
a 
reposé 
essenKellement 
sur 
l’existence 
et 
la 
sélecKon 
de 
quelques 
gènes 
(allèles) 
à 
effets 
forts 
(qualitaKfs) 
L’amélioraKon 
actuelle 
repose 
sur 
l’existence 
de 
variabilité 
d’un 
plus 
grand 
nombre 
de 
gènes 
(d’allèles) 
à 
effets 
souvent 
plus 
fins 
et 
complexes 
(quanKtaKfs 
et 
interacKfs). 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Les 
principes 
de 
l’améliora3on 
des 
plantes 
Les biotechnologies Les Source: 
GNIS 
11 
Les principes de l’amélioration des plantes 
Exemple de la pomme de terre 
Diversité 
existante Croisement 
• Plus productives 
• Plus résistantes aux 
maladies et aux parasites 
• Mieux adaptées 
au sol et au climat 
• Mieux adaptées 
aux techniques culturales 
• Régularité des formes 
• Qualité culinaire 
• Adaptées aux transformations : 
frites, chips, pommes de terre 
surgelées, fécule… 
entre individus choisis 
pour leurs 
caractères intéressants 
Collections de plus 
de 3 500 formes 
sauvages ou cultivées 
Nouvelle 
variété 
Objectifs de sélection des variétés 
Les biotechnologies 
dans un programme de sélection 
Connaître 
le génome 
Marqueurs moléculaires 
Cartes génétiques 
Sélection assistée 
par marqueurs 
Génomique 
étapes 
de la sélection 
Recenser 
le matériel génétique 
existant 
Observer, choisir et croiser 
le matériel de départ 
Créer 
des lignées 
ou les parents de l’hybride 
Fixer 
les caractères 
Évaluer 
la valeur agronomique 
et technologique de 
la nouvelle variété 
Inscrire 
la nouvelle variété 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
12 
Les 
méthodes 
de 
sélec3on 
ont 
évolué 
1) Depuis 
la 
domes3ca3on, 
pra3quait 
essen3ellement 
la 
sélec3on 
massale 
-­‐ 
Choix 
des 
meilleures 
populaKons, 
(porte) 
graines 
sur 
leurs 
performances 
propres 
-­‐ 
Permis 
l’amélioraKon 
de 
populaKons 
de 
plantes 
autogames 
(blé, 
orge,…) 
2) 
A 
par3r 
du 
milieu 
du 
19ième 
siècle, 
mise 
en 
place 
de 
la 
sélec3on 
généalogique 
-­‐ 
basée 
sur 
la 
sélecKon 
d’individus 
et 
leurs 
performances 
en 
descendance 
(de 
Vilmorin) 
-­‐ 
l’amélioraKon 
d’espèces 
autogames 
et 
allogames 
(fécondaKon 
croisée), 
ex 
begeraves 
3) 
Au 
20 
ième 
s. 
u3lisa3on 
des 
cartes 
géné3ques 
puis 
des 
marqueurs 
moléculaires 
-­‐ Grace 
à 
l’uKlisaKon 
des 
lois 
de 
G. 
Mendel 
-­‐ Etablissement 
des 
bases 
de 
la 
sélecKon 
des 
hybrides 
de 
maïs 
par 
Shull 
(1908) 
-­‐ Culture 
des 
premières 
variétés 
de 
maïs 
hybride 
aux 
Etats-­‐Unis 
(1933) 
-­‐ Etablissement 
des 
premières 
cartes 
généKques 
du 
maïs 
par 
Emerson 
(1935) 
-­‐ Débuts 
de 
la 
sélecKon 
assistée 
par 
marqueurs, 
à 
parKr 
de 
1980 
A. 
Gallais 
(2011) 
Méthodes 
de 
créaKon 
de 
variétés 
en 
AmélioraKon 
des 
plantes, 
Ed 
Quae 
D. 
De 
Vienne 
(1998), 
Les 
marqueurs 
moléculaires 
en 
généKque 
et 
biotechnologies 
végétales, 
Ed 
INRA
13 
Exemple 
de 
résultats 
de 
l’améliora3on, 
le 
blé 
7000 
av 
JC 
Domes3ca3on 
du 
blé 
tendre 
en 
mésopotamie 
1600: 
arrive 
probablement 
à 
5 
Qx/ha 
1800 
fer3lisa3on/principe 
de 
res3tu3on, 
10 
Qx/ha 
1900 
« 
Révolu3on 
» 
agronomique, 
intrants, 
machinisme, 
géné3que 
1960 
« 
Révolu3on 
Verte 
» 
dans 
les 
pays 
en 
voie 
développement 
1980: 
65 
Qx/ha 
2000: 
80 
Qx/ha 
(France) 
plant breeder and Nobel Laureate 
Norman Borlaug 1914-2009 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
14 
Limites 
des 
techniques 
d’améliora3on 
conven3onnelles 
Les 
limites 
inhérentes 
à 
la 
reproduc3on 
sexuée 
Difficultés 
de 
réaliser 
des 
croisements 
entre 
espèces 
Risques 
d’introducKon 
de 
caractères 
indésirables 
dans 
la 
nouvelle 
variété 
Délais 
pour 
créer 
une 
nouvelle 
variété 
liés 
aux 
cycles 
de 
végétaKon 
Et 
au 
nombre 
de 
généraKons 
nécessaires 
Les 
avantages 
des 
biotechnologies 
Créer 
et 
mieux 
exploiter 
la 
diversité 
faciliter 
les 
croisements 
interspécifiques 
Connaître 
le 
génome 
et 
maîtriser 
l’apport 
de 
nouveaux 
caractères 
Diminuer 
la 
durée 
de 
créa3on 
variétale 
Adapté 
du 
GNIS 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
15 
• Introduc3on 
– Enjeux 
sociétaux 
et 
l’amélioraKon 
des 
plantes 
– L’amélioraKon, 
de 
la 
domesKcaKon 
aux 
praKques 
actuelles 
• Les 
apports 
des 
biotechnologies 
– Biologie 
cellulaire 
et 
régénéraKon 
– Biologie 
moléculaire 
et 
génomique 
– CréaKon 
et 
uKlisaKon 
de 
la 
biodiversité 
moléculaire 
• La 
transgénèse 
– Bases 
cellulaires 
et 
moléculaires 
de 
la 
transgénèse 
– Exemples 
d’uKlisaKons 
potenKelles 
– Etat 
actuel 
des 
cultures 
• Conclusions 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Les biotechnologies 
Les 
Biotechnologies 
dans 
un 
programme 
de 
sélec3on 
16 
dans un programme de sélection 
Les biotechnologies Les biotechnologies 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
Connaître 
le génome 
Marqueurs moléculaires 
Cartes génétiques 
Sélection assistée 
par marqueurs 
Génomique 
Exploiter 
la diversité 
Sauvetage d’embryons 
interspécifiques 
Fusion de protoplastes 
Transgénèse 
Diminuer 
la durée de création 
Haplodiploïdisation 
Culture d’embryons 
immatures 
Les étapes 
de la sélection 
Recenser 
le matériel génétique 
existant 
Observer, choisir et croiser 
le matériel de départ 
Créer 
des lignées 
ou les parents de l’hybride 
Fixer 
les caractères 
Évaluer 
la valeur agronomique 
et technologique de 
la nouvelle variété 
Inscrire 
la nouvelle variété 
Biologie 
moléculaire 
Biologie 
Cellulaire 
Source 
: 
GNIS 
Transgénèse 
Connaître 
le 
génome 
Exploiter 
la 
diversité 
Accélérer 
la 
créaKon
17 
Méthodes 
de 
micropropaga3on 
in 
vitro 
pousse axillaire Mul8 
Des applications de la Le sauvetage 
d’embryons 
La culture 
de méristèmes 
La multiplication 
conforme 
embryon 
méristème 
noeud 
3plica3on 
in 
vitro 
de 
3ssus 
végéta3fs 
-­‐ 
Sauvetage 
d’embryons 
; 
tomate, 
tournesol, 
courgege, 
laitue,… 
-­‐ 
Culture 
de 
méristèmes: 
pomme 
de 
terre, 
arKchaut, 
dahlia, 
vigne, 
ail, 
fraisier,… 
-­‐ 
Microbouturage 
: 
figuier, 
séquoia, 
pins, 
eucalyptus, 
peuplier, 
merisier, 
framboise, 
vigne… 
-­‐ 
ApplicaKons 
-­‐ PropagaKon 
clonale 
(végétaKve) 
-­‐ MulKplicaKon 
rapide, 
gains 
de 
temps 
importants 
-­‐ ÉliminaKon 
de 
viroses 
(méristème 
et 
thermothérapie) 
-­‐ 
Autres 
techniques 
-­‐ Embryogenèse 
somaKque 
-­‐ ObtenKon 
et 
fusion 
de 
protoplastes 
et 
régénéraKon 
-­‐ HaploïdisaKon 
Source 
: 
GNIS 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Bref 
rappel 
historique 
sur 
les 
biotechnologies 
cellulaires 
18 
-­‐ 
Culture 
« 
in 
vitro 
» 
de 
cellules, 
de 
3ssus 
et 
régénéra3on 
1902 
Découverte 
de 
la 
to3potence 
des 
cellules 
végétales, 
Haberland. 
1930 
Culture 
de 
Kssus 
végétaux 
1939 
culture 
indéfinie 
de 
cambium, 
Gautheret 
1950 
culture 
in 
vitro, 
développée 
par 
Morel 
et 
MarKn, 
sur 
la 
pomme 
de 
terre. 
1952 
assainissement 
par 
culture 
de 
méristème 
de 
dahlia, 
Morel 
et 
Mar3n 
1957 
rôle 
équilibre 
auxine/cytokinine 
dans 
le 
contrôle 
de 
la 
formaKon 
d’organes 
1958, 
obten3on 
des 
premiers 
embryons 
soma3ques 
de 
caroie 
Reinert 
et 
Stewart 
1960 
première 
mulKplicaKon 
végétaKve 
in 
vitro 
de 
l’orchidée, 
Morel 
1964 
cultures 
de 
cellules 
sexuelles 
mâles 
chez 
le 
Datura 
par 
Guha 
et 
Maheshwari. 
1965 
culture 
de 
cellules 
végétales 
1967 
plantes 
haploïdes, 
Bourgin 
1971 
protoplastes 
de 
tabac 
1978 
premières 
fusions 
de 
protoplastes, 
par 
Melchers. 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
19 
Exemples 
de 
bouturage 
et 
microbouturage 
Bouturage, 
Technique 
ancestrale 
: 
-­‐1100 
ans, 
néolithique, 
figuier 
parthenocarpique,… 
Geranium, 
Rosiers, 
Groseillers…. 
Développement 
Industriel 
pour 
des 
plantes 
variées: 
Rosiers, 
Orchidées, 
FruiKers… 
Adapté 
de 
Y. 
Chupeau 
microbouturage 
et 
culture 
de 
méristème 
apical 
: 
Guérison 
de 
Dalhia 
ageints 
d’une 
maladie 
à 
virus 
Morel 
et 
MarKn, 
1952. 
Extension 
à 
la 
pomme 
de 
terre, 
puis 
à 
de 
nombreuses 
plantes… 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Embryogénèse 
Soma3que 
et 
Sauvetage 
d’embryons 
20 
L’embryogenèse 
soma3que 
-­‐ 
Exemple, 
producKon 
de 
plants 
de 
conifères 
Lelu 
et 
Thomson 
2000 
/ 
M. 
jullien 
Sauvetage 
d'embryons 
-­‐ 
Sauvetage 
par 
culture 
in 
vitro 
d’embryons 
non 
viables. 
-­‐ 
Exemple, 
embryons 
obtenus 
par 
croisements 
entre 
tournesols 
culKvés 
et 
sauvages. 
-­‐ 
Les 
espèces 
sauvages 
de 
tournesol 
= 
réservoir 
de 
résistances 
aux 
pathogènes 
(résistant 
au 
mildiou 
et 
au 
ScleroKnia) 
x 
Adapté 
de 
F. 
Nogué 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
21 
21 
L’ o b t e n t i o n d e p ro t o p l ast es 
Cellules 
végétales 
débarrassées 
de 
leur 
paroi 
pecto-­‐cellulosiques 
(cf 
H. 
H.) 
Pa r e nch yme 
d e j e u n es f e u ill es 
Di g est i o n 
e n z yma t i q u e 
d e l a p a ro i 
E n z y mes 
d e l yse 
d e l a p a ro i 
p ect oce ll u l osi q u e 
A j o u ts 
d ’ é l éme n ts 
st a b ilisa n ts 
sucres, 
sels minéraux 
Susp e nsi o n 
d e p ro t o p l ast es 
Fusion, 
transforma3on, 
régénéra3on 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
22 
Applica3ons 
: 
Fusion 
de 
protoplastes 
et 
régénéra3on 
La 
maîtrise 
de 
la 
culture 
et 
de 
la 
fusion 
de 
protoplastes 
(A) 
et 
de 
la 
régénéra3on 
de 
colza 
(B) 
ont 
permis 
la 
régénéra3on 
de 
CYBRIDES 
(CY), 
hybrides 
cytoplasmiques. 
Cege 
approche 
a 
permis 
par 
exemple 
de 
transferer 
la 
stérilité 
mâle 
Ogura 
portée 
par 
l’ADN 
mitochondrial 
(O) 
au 
colza 
normal 
(N). 
Disposer 
d’une 
stérilité 
mâle 
chez 
le 
colza 
facilite 
la 
créaKon 
des 
hybrides 
F1. 
G. 
PelleMer, 
INRA 
Versailles 
Adapté 
de 
M. 
Jullien 
A 
B 
C 
O 
CY 
N 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Etamines 
Pollen 
23 
Haplo(diplo)ïdisa3on 
L’haploïdisaKon 
est 
l’obtenKon 
d’ 
individus 
provenant 
d’un 
seul 
parent 
(sans 
fécondaKon). 
Après 
un 
doublement 
(spontanée 
ou 
induit 
ou 
«diploïdisaKon») 
du 
nombre 
de 
chromosomes 
cela 
conduit 
à 
des 
lignées 
parfaitement 
homozygotes 
2n 
(« 
pures 
»). 
Elle 
permet 
donc 
des 
gains 
de 
temps 
et 
d’efficacité 
considérables 
pour 
la 
fixa3on 
de 
caractères 
par 
rapport 
à 
des 
cycles 
classiques 
de 
croisements. 
From 
Y. 
Chupeau 
Haploïdisa<on 
spontanée 
polyembryonie 
(ex: 
asperge), 
androgenèse 
in 
situ 
(ex: 
tabac) 
et 
gynogenèse 
in 
situ 
(ex: 
maïs, 
colza). 
Androgenèse, 
à 
par<r 
des 
gamètes 
mâles 
(plus 
de 
150 
espèces) 
• formaKon 
d’embryons 
à 
parKr 
d’étamine 
de 
Datura 
(1966, 
Guha 
et 
Maheswari) 
• ObtenKon 
de 
plantes 
haploïdes 
à 
parKr 
de 
grains 
de 
pollen 
de 
tabac 
(1967 
Nitsch 
et 
Bourgin) 
• Datura, 
Tabac, 
Riz, 
Colza, 
Orge, 
Blé, 
Pomme 
de 
terre, 
Maïs,... 
Gynogenèse 
-­‐ 
Culture 
d’ovaires/ovules 
(1976) 
: 
Orge, 
Blé, 
Tabac, 
Riz, 
Gerbera, 
Maïs, 
Begerave,… 
-­‐ 
Croisements 
interspécifiques 
(1964) 
: 
Pomme 
de 
terre, 
Orge, 
Melon, 
Blé, 
Luzerne,... 
-­‐ 
UKlisaKon 
de 
pollen 
irradié 
(1983) 
: 
Orge, 
Blé, 
Pétunia, 
Melon, 
Caroge, 
Concombre, 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Les biotechnologies 
dans un programme de sélection 
24 
La 
génomique 
dans 
l’améliora3on 
Les biotechnologies Les Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
Biologie 
Cellulaire 
Connaître 
le génome 
Marqueurs moléculaires 
Cartes génétiques 
Sélection assistée 
par marqueurs 
Génomique 
étapes 
de la sélection 
Recenser 
le matériel génétique 
existant 
Observer, choisir et croiser 
le matériel de départ 
Créer 
des lignées 
ou les parents de l’hybride 
Fixer 
les caractères 
Évaluer 
la valeur agronomique 
et technologique de 
la nouvelle variété 
Inscrire 
la nouvelle variété 
ObjecKfs 
: 
Localiser 
et 
séquencer 
les 
gènes 
Etudier 
leur 
foncKon 
Les 
uKliser 
pour 
créer 
de 
la 
variabilité 
et 
comme 
marqueurs 
pour 
la 
sélecKon 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
25 
Historique 
de 
l’étude 
des 
génomes 
et 
de 
l’ADN 
1900. 
Mise 
en 
applicaKon 
des 
lois 
de 
Mendel 
sur 
l'hérédité 
1911. 
NoKon 
de 
liaison 
généKque, 
Morgan, 
(Nobel 
1933) 
1953. 
DescripKon 
de 
la 
structure 
en 
double 
hélice 
de 
l'ADN 
Watson, 
Wilkins, 
et 
Crick 
(Nobel 
1962) 
1960. 
Découverte 
du 
code 
généKque 
Crick, 
Nirenberg, 
Mathaeri 
et 
Ochoa 
(Nobel, 
1968) 
1965. 
Découverte 
des 
enzymes 
de 
restricKon 
Aber, 
Smith 
et 
Nathans 
(Nobel 
1978) 
1973. 
ADN 
recombinant, 
Berg 
(Nobel 
1980) 
1977. 
Séquençage 
de 
l’ADN, 
Gilbert 
et 
Sanger 
(Nobel 
1980) 
1983. 
Clonage 
par 
amplificaKon 
in 
vitro 
(PCR), 
Mullis 
(Nobel, 
1993) 
1990 
Co-­‐suppression, 
silencing 
et 
miRNA, 
(Mello, 
Fire, 
Nobel 
2006) 
49 
La c a r t o g r a p h i e d e s ma rq u e u rs m Exemple de cart e géné tique de marqueurs RFLP che z la pomme Pr i nci p e d e d é t e rmi n a t i o n d e l a d ist a nc e g é n é t i q u e e n t r e d e u x l ocus A Parents homozygot es 
éloignés géné tiquement 
GP39 
PSC 
CP49 CP65(a) 
GP85(a) 
GP1(b) GP17 
Descendance F2 La distance génétique entre les deux locus exprimée en centiMorgan, 
PAL(d) 
A }est fonction du pourcentage 
- A B 
- a b 
Type parent al 
A B de recombinés 
a b 
- A b 
- aB }Type recombiné d 
Chromosome 
I 
CP100 
Chromosome 
II 
Chromosome 
III 
Chromosome 
IV 
Chromosome 
V 
Chromosome 
VI 
Chromosome 
VII 
GP93 CP65(b) GP22 CP43(d) PAT(a) CP16 
CP94(a) 
GP36(b) 
GP92 
GP36(a) GP74(GP74(c) 
GP40(a) 
CP14 
WX 
GP87(d) 
GP33(b) 
GP91(b) 
GP35(e) 
PAL(f) 
GP91(a) 
pI471 
CP20(a) 
PAL(b) 
GP97 
PAL(c) 
GP85(GP74(PAL(a) CP53 
GP87(c) 
Actin 
GP78 
GP31 
GP21 
GP35(d) 
GP28(b) 
GP35(b) 
GP87(a) 
CP72 
PAL(e) 
GP35(a) 
GP85(c) CP59 
CP47 
CP51(b) 
CP51(a) 
rbcS-1 
CP15(a) 
GP1(a) 
GP25 
GP80 
CP6 
4CL(a) 
CP32(d) 
GP1(c) 
GP74(a) 
GP74(d) 
GP23 
GP35(c) CP70(c) 
rbcS-c 
CP48(a) 
CP15(b) 
GP86 
GP33(a) 
GP98 
GP26 
rbcS-2 
PC116 
PAT(b) 
GP1(d) 
GP90 
CP64(a) 
CP64(b) 
CP11 
CP69(a) 
GP33(d) 
CP69(b) 
GP33(c) 
CP19 
GP88 
GP28(a) 
CP62 
CP13 
GS 
-­‐ 
L’ADN 
est 
le 
support 
moléculaire 
de 
l’informaKon 
généKque 
-­‐ 
C’ 
est 
une 
chaine 
(2 
brins) 
de 
quatre 
molécules 
(A,T, 
G, 
C) 
-­‐ 
Il 
a 
une 
structure 
idenKque 
chez 
tous 
les 
organismes 
vivants 
-­‐ 
Sa 
réplicaKon 
et 
sa 
transmission 
induisent 
des 
variaKons 
-­‐ Une 
évoluKon 
permanente 
des 
génomes 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
26 
Les 
génomes 
végétaux 
et 
leur 
séquençage 
> 
20 
Espèces 
végétales 
séquencées 
depuis 
2000 
Arabidopsis 
thaliana. 
-­‐ 
La 
taille 
des 
génomes 
végétaux 
varie 
de 
façon 
considérable 
Arabidopsis 
140 
Mb, 
Blé 
16 
000 
Mb 
(malgré 
un 
nombre 
de 
gènes 
équivalent 
par 
génome 
; 
~ 
30 
000 
gènes) 
-­‐ 
Une 
fracKon 
importante 
de 
certains 
génomes 
est 
consKtuée 
de 
séquences 
dites 
non 
codantes 
et/ou 
répétées 
(e.g. 
transposons). 
Cassava 
Sorghum 
Potato 
Tomato 
Maize 
Sugarcane 
Papaya 
Medicago 
Genome 
size 
of 
all 
published 
crop 
genomes 
(shown 
in 
green) 
and 
the 
five 
most 
important 
producKon 
crops 
with 
unpublished 
genome 
sequences 
(shown 
in 
blue).. 
Morell 
et 
al. 
(2012) 
Nature 
Review 
GeneKcs, 
13:85-­‐96 
Nature Reviews | Genetics 
18,000 
16,000 
14,000 
12,000 
10,000 
8,000 
6,000 
4,000 
2,000 
0 
Genome size (Mb) 
No published sequence 
Published sequence 
Average angiosperm 
Cucumber 
Peach 
Strawberry 
Foxtail millet 
Cacao 
Rice 
Grape 
Pigeonpea 
Soybean 
Sugar beet 
Barley 
Bread wheat 
Orange 
Figure 1 | Crop genome size. Genome Lepiniec 
size of L. 
all Séminaire 
published Biotechnologies 
crop genomes -­‐ 
9 
et 
10 
(shown février 
2012 
in green) and the five most 
important production crops with unpublished genome sequences (shown in blue). The average angiosperm genome
27 
• Inventaire 
Bénéfices 
directes 
du 
séquençage 
des 
génomes: 
des 
gènes 
«puta3fs» 
grâce 
aux 
ouKls 
bioinformaKques 
• Etude 
de 
leur 
polymorphisme 
(génotypage), 
caractérisaKon 
des 
allèles 
• Etude 
de 
l’expression 
de 
ces 
gènes 
(puces 
à 
ADN, 
ESTs 
etc…) 
• SimplificaKon 
du 
lien 
entre 
phénotype 
et 
gène 
impliqué 
(marqueur) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
From 
M. 
Caboche
28 
Iden3fica3on 
de 
gènes 
par 
comparaison 
des 
génomes 
51 
La cartographie comparée 
Amidon-Waxy 
Hauteur 
des plantes 
Grain rouge 
Absence 
de ligule 
Génome 
de l’espèce : 
Blé 1 
Maïs 
Date de 
Riz 
floraison Numéro 
6 
5 
du chromosome 
Zone de 
présence d’un 
caractère : 
Source : Devos et Gale, 1997 
X 
Basée 
sur 
la 
conservaKon 
de 
la 
co-­‐localisaKon 
/ 
de 
l’ordre 
des 
loci 
homologues 
le 
long 
des 
chromosomes 
(synténie) 
due 
à 
la 
parentée 
évoluKve 
des 
génomes 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
U3lisa3on 
de 
marqueurs 
moléculaires 
pour 
la 
selec3on 
29 
- Il est beaucoup PRECIS et RAPIDE de suivre un caractère avec un marqueur moléculaire 
qu’à partir du phénotype (mesure indirecte et relative du caractère) 
- Exemple de l’introgression du gène Bt d’une lignée donneuse dans une lignée cultivée 
Phenotype: 
résulte 
de 
l’expression 
d’un 
caractère 
et 
de 
son 
interacKon 
avec 
l’environnement 
Photo credit LemnaTec; Anderson, L.K.et al.. (2006). 
La sélection assistée par marqueurs 
Exemple de l’introgression du gène Bt Chromosome 
I 
CG100 
CG161 
CG259 
CG363 
CG320 
Bt 
CG415 
CG263 
CG378 
CG264 
CG489 
CG324 
CG312 
CG267 
CG143 
CG246 
Back-cross 1 
Chromosome 
I 
CG100 
CG161 
CG259 
CG363 
CG320 
CG415 
CG263 
CG378 
CG264 
CG489 
CG324 
CG312 
CG267 
CG143 
CG246 
Bt Back-cross 2 
Chromosome 
I 
CG100 
CG161 
CG259 
CG363 
CG320 
CG415 
CG263 
CG378 
CG264 
CG489 
CG324 
CG312 
CG267 
CG143 
CG246 
Back-cross Lignée élite 
Source 
: 
GNIS 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
+ 
simples 
et 
faciles 
à 
caractériser, 
changement 
d’un 
nucléoKde 
30 
U3lisa3on 
de 
marqueurs 
moléculaires 
pour 
la 
caractérisa3on 
de 
loci 
d’intérêt 
Deux 
grandes 
approches 
pour 
établir 
le 
lien 
entre 
un 
phénotype 
et 
un 
génotype 
(des 
allèles) 
Le 
principe 
est 
toujours 
d’étudier 
la 
co-­‐ségréga3on 
Etude 
de 
liaison, 
en 
descendance 
de 
2 
parents 
connus 
entre 
un 
phénotype 
et 
des 
marqueurs 
ADN 
Géné3que 
d’associa3on 
En 
uKlisant 
la 
diversité 
généKque 
naturelle 
QTL 
(QuanKtaKve 
Trait 
Loci) 
LD 
(Linkage 
Desequilibrium) 
-­‐ 
Deux 
types 
d’évolu3ons 
importantes 
concernent 
-­‐ Développement 
de 
marqueurs 
(SNP), 
l’uKlisaKon 
de 
puces 
de 
génotypage 
très 
denses 
et/ou 
le 
débit 
du 
“re-­‐séquençage”. 
Voir 
Morell 
et 
al. 
(2012) 
Crop 
genomics 
: 
advances 
and 
applicaKons, 
Nature 
Review 
GeneKcs 
-­‐ la 
généra3on 
d’un 
nouveau 
type 
de 
popula3ons 
“intermédiaires” 
qui 
combinent 
celles 
présentées 
(croisements 
de 
parents 
mulKples) 
-­‐ 
Ouvrent 
la 
voie 
à 
des 
approches 
plus 
globales 
de 
sélec3on 
génomique 
(combinaisons 
d’allèles) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
31 
Les 
origines 
des 
muta3ons 
et 
leurs 
u3lisa3ons 
-­‐ 
Les 
mutaKons 
s’accumulent 
en 
permanence 
avec 
les 
généraKons 
(erreurs 
de 
réplicaKon 
et/ou 
de 
réparaKon 
de 
l’ADN) 
-­‐ Cege 
accumulaKon 
peut-­‐être 
sKmulée 
par 
la 
présence 
d’agents 
mutagènes 
-­‐ biologiques 
(inserKon 
de 
retrovirus, 
transposons), 
-­‐ physiques 
(rayonnements), 
ou 
chimiques 
et 
-­‐ Et 
l’échange 
de 
matériel 
géné3que 
avec 
d’autres 
espèces 
-­‐ 
Les 
mutaKons 
sont 
de 
nature 
diverse 
• AAATGCATAAAA 
TGCTAGGTCCGCCGATATATAACCC 
Séquence 
ancestrale 
• AAATGCATAATA 
TTCTAGGTCCGCCGATATATAACCC 
Ponctuellle 
• AAATGCATAAAA 
TGCTAGGT-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐ATATATAACCC 
DéléKon 
• AAATGCATAAAA 
TGCTAGGTCCGCCGGGCGGCCCATATATAACCC 
InserKon 
• Elles 
consKtuent 
la 
base 
de 
la 
sélecKon 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Exemple 
de 
muta3ons 
spontanées 
sources 
de 
diversité 
32 
Chou-fleur 
Romanesco 
Bruxelles 
Chou cultivé 
Chou sauvage 
Broccoli 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Acquisi3on 
de 
gènes 
par 
croisements 
interspécifiques 
: 
33 
Exemple 
de 
la 
tomate 
10 
% 
du 
génome 
(3000 
gènes) 
des 
tomates 
culKvées 
proviennent 
de 
croisements 
avec 
d’autres 
espèces 
L. esculentum 
L. pimpinellifolium* 
L. cheesmanii* 
L. parviflorum 
L. chmielewskii 
L. chilense 
L. hirsutum* 
L. pennellii* 
L. peruvianum* 
From 
www.eu-­‐sol.net 
Lycopersicon 
ancestral 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
34 
Les 
croisements 
interspécifiques 
spontanés, 
le 
blé 
Triticum urartu 
Ae. Section Sitopsis 
Triticum æstivum 
Génome 
A 
Génome 
B 
Génome 
D 
Blé dur 
Blé tendre 
Espèces 
créées 
par 
croisements 
interspécifiques 
spontanés 
: 
blé, 
hexapolyploïdes 
cotonnier, 
colza, 
moutarde 
brune, 
fraisier, 
tabac, 
peuplier, 
pêcher-­‐amandier,… 
Adapté 
de 
G. 
PelleKer 
Triticum aestivum 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Polyploïdisa3on, 
une 
source 
importante 
de 
diversité 
Figure 
1 
-­‐ 
Schema3c 
phylogene3c 
tree 
of 
flowering 
plants. 
BR1 
– 
monocots+eudicots 
duplicaKon; 
BR2 
– 
Eudicot-­‐wide 
duplicaKon; 
BR3 
– 
Core 
eudicot-­‐wide 
duplicaKon; 
BR4 
– 
Rosid-­‐wide 
duplicaKon. 
Y 
Jiao 
et 
al. 
(2012) 
A 
genome 
triplicaKon 
associated 
with 
early 
diversificaKon 
of 
the 
core 
eudicots 
35 
Genome 
Biology 
2012, 
13:R3 
C’ 
est 
une 
duplica3on 
du 
génome 
Peut 
être 
naturelle 
Caféier 
arabica 
(4X=44), 
Dactyle 
(4X=28), 
Luzerne 
(4X=32)… 
• Des 
plantes 
aujourd’hui 
considérées 
comme 
diploïdes 
sont 
d’anciens 
tétraploïdes. 
Ex 
Maïs, 
vigne, 
Peuplier, 
fraisier 
• Mise 
sen 
évidence 
d’au 
moins 
3 
duplicaKons 
successives 
chez 
les 
dicotylédones 
Peut 
être 
induite 
induite: 
1937, 
Blakeslee 
découvre 
l’acKon 
de 
la 
colchicine 
Est 
à 
l’origine 
de 
très 
nombreuses 
muta3ons 
-­‐ Remaniements 
chromosomiques 
-­‐ InserKons 
et 
déléKons 
-­‐ AcKvaKon 
de 
transposons 
-­‐ Dérive 
rapide 
/ 
néofoncKonalisaKon 
(baisse 
de 
la 
pression 
de 
sélecKon 
-­‐ RégulaKons 
épigénéKques 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
36 
Les 
transposons 
Liseron 
Sélection vers 1940, insertion d’un helitron, 
from Choi et al., Plant Journal 2007) 
Choux fleur 
Sélection vers 1975, insertion d’un 
retrotransposon (Lu et al., Plant Cell 2006) 
Photo: www.acenologia.com 
insertion d’un retrotransposon 
(Kobayashi et al., Science 2004) 
-­‐ Ce 
sont 
des 
éléments 
généKques 
mobiles 
responsables 
de 
nombreuses 
mutaKons 
sélecKonnées 
en 
amélioraKon 
Adapté 
de 
F. 
Nogué 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
37 
PA 
C HIAM 
S ER AUP 
FOR TUNA B ESAR 
15 MAR ONG UNKNOWN 
PA R OC 
B LUE 
ROSE 
B PI 
76 R EX OR O SUPR EME 
KIT C HILI 
S AMB A 
original rice genome 
S INAWPA GH 
UNKNOWN 
Mutations 
C INA LA T IS A IL TEX AS R SB R GEB 24 
PA TNA B LUE 
B ONNET 
PETA 
DGWG C P231 S LO 
17 B ENONG 
IR 86 C P 
SLO 
17 S IGA DIS 
IR 95 
Inversions 
IR 127 
IR 8 C HOW 
S UNG IR 262 
IR 1103 TADUKAN V E LLA IKA R 
IR 400 T S A I 
Y UA N 
C HUNG 
IR 1006 MUDGO 
TETEP 
IR 1163 IR 238 TN1 
IR 1416 IR 1641 
IR 1402 
IR 22 TKM6 IR 746A 
IR 1704 
O. 
nivara 
IR 1870 IR 1614 
IR 2006 IR 579 IR 747 IR 24/ 
IR 661 IR 1721 
IR 773 
A B PI 
121 GAM 
PAI 
IR 1915 
B IR 1833 GAM 
PA I 
15 IR 1561 IR 1737 
IR 1916 IR 833 IR 2040 
IR 2146 IR 
2055 
IR 2061 
IR 5236 IR 5338 Ultimate Landraces 
GAM PAI TSAI YUAN CHUNG 
IR 5657 DEE GEO WOO GEN BENONG 
CINA Unknow n 
IR 18348 LATISAIL CHOW SUNG 
TADUKAN MUDGO 
IR 64 KITCHILI SAMBA TETEP 
PA CHIAM SINAWPAGH 
SERAUPBESAR 15 UNKNOWN (JAPANESE) 
NAHNG MON S 4 O. nivara (IRGC 101508) 
VELLAIKAR MARONG PAROC 
C O 
18 
NA HNG 
MON 
S 4 
NMS 
4 
IR 64 
è 
Recombinations Translocation 
s 
Deletions 
è 
Accumula3on 
de 
ces 
muta3ons 
pour 
créer 
un riz cultivé 
Slide courtesy of Ingo Potrykus 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
38 
U3lisa3on 
de 
la 
mutagenèse 
La 
mutagenèse 
ar3ficielle 
est 
très 
u3lisée 
depuis 
le 
milieu 
du 
20ème 
et 
la 
démonstraKon 
de 
l’héritabilité 
des 
altéraKons 
(mutaKons) 
provoquées 
par 
les 
radiaKons 
(1927), 
puis 
la 
diversificaKon 
des 
agents 
mutagènes, 
physique 
(rayons, γ, 
UV, 
X), 
chimiques 
-­‐ 
En 
2000, 
+ 
de 
2200 
variétés 
recensées 
par 
la 
FAO 
sont 
issues 
de 
mutagenèses 
ar3ficielles 
1948, 
Begerave 
mutaKon 
monogerme 
(démariage 
inuKle) 
1986 
Pois 
proteagineux 
mutaKon 
« 
afila 
» 
facilitant 
la 
récolte 
1930 
Rose 
Couleur 
orangée 
ajoutée 
à 
la 
palege 
de 
couleurs 
1984 
Pamplemousse 
Aspermie, 
Couleur 
rouge 
de 
la 
pulpe 
1985 
Cerisier 
AutoferKlité 
1970 
Riz 
Qualité 
du 
grain 
1976 
Tournesol 
richesse 
en 
acide 
oléique 
1985 
Forsythia 
Port 
compact 
+ 
Orge 
à 
brasserie 
semi-­‐nanisme 
(plus 
de 
150 
variétés) 
+ 
Colza 
richesse 
en 
acide 
oléique. 
/ 
RéducKon 
acide 
linolénique, 
glucosinolates 
-­‐ Une 
nouvelle 
méthode, 
le 
TILLING 
(Targeted 
Induced 
Local 
Lesion 
IN 
Genome) 
permet 
de 
faire 
de 
la 
« 
généKque 
réverse 
», 
c’est 
à 
dire 
d’idenKfier 
des 
mutants 
affectés 
dans 
un 
gène 
donné 
(dont 
on 
connaît 
la 
foncKon) 
et 
pour 
lequel 
on 
cherche 
de 
nouveaux 
allèles 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
39 
Conclusions 
• Les 
mutaKons 
sont 
donc 
à 
la 
base 
de 
l’évoluKon, 
de 
l’adaptaKon 
des 
espèces, 
de 
la 
domesKcaKon 
ou 
de 
la 
sélecKon. 
• Les 
données 
génomiques 
montrent 
que 
le 
monde 
vivant 
consKtue 
un 
pool 
de 
gènes 
qui 
évolue 
en 
permanence 
• La 
quasi 
unicité 
du 
code 
généKque 
permet 
des 
transferts 
« 
horizontaux 
» 
nombreux 
et 
variés 
-­‐ Cas 
des 
α-­‐protobactéries 
⇒ 
Mitochondries 
…⇒Champignons, 
Animaux 
-­‐ Cas 
des 
cyanobactéries 
(photosynthéKques) 
⇒ 
Chloroplastes 
⇒ 
Plantes 
Archaea 
J.R. 
Brown 
(2003) 
Nature 
Reviews 
GeneKcs 
Euryarchaeota 
Animals 
Plants 
Slime moulds 
Korarchaeota Crenarchaeota 
Low G+C 
gram 
positives 
a 
b 
Thermotogales 
Eukaryotes 
Fungi 
Microsporidia 
Entamoeba 
Apicomplexa (such as Plasmodium) 
Euglena 
c 
'Cenancestor' 
Kinetoplasta (such as Trypanosoma) 
Parabasalia (such as Trichomonas) 
Metamonda (such as Giardia) 
Mitochondrial loss 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
R E V I E W S 
Box 1 | The universal tree of life 
High G+C 
gram 
positives 
Bacteria 
δ/ε purples 
α purples 
γ/β purples 
Spirochaetes 
Fusobacteria 
Flexibacter/Bacteriodes 
Cyanobacteria 
Thermus 
Aquifex 
Putative origins of organelles 
Chloroplasts 
Mitochondria 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
In the late 1970s,Woese,Fox and co-workers15,16 pioneered the molecular systematics of prokaryotes. DENDOGRAMSbased
40 
Le 
Génie 
Géné3que 
naturel 
d’Agrobacterium 
Elysia 
chloroMca 
0,5 
mm 
LB 
ADN-T 
simple 
brin 
VirD2 
Rumpho 
et 
al, 
2008, 
PNAS,105(46) 
17867 
Agrobacterium 
tumefaciens 
AttR L’arrimage de la bactérie à la cellule 
végétale est contrôlé par les produits 
de quelques gènes 
du chromosome bactérien 
Chv 
CelA 
VirG+PO 
4 
Gènes vir 
Plasmide Ti 
ADN-T 
RB 
Vir B 
VirD2 
VirE2 
ADN-T 
VirA 
Oses, 
acides organiques, 
phénols... 
Paroi végétale 
Cellule 
végétale 
blessée 
VirE2 
Opine 
Auxine 
Cytokinine 
Cellule végétale 
viable et activée 
Membrane 
nucléaire 
Chromosome 
végétal 
ADN-T 
double brin 
Noyau végétal 
Chloroplaste 
Y. 
Chupeau 
(2001) 
M&S 
Figure 3. Un processus naturel de transfert d’ADN. Les agrobactéries ont développé la capacité d’exciser une 
portion d’un plasmide particulier (Ti), puis de l’exporter en l’adressant efficacement aux noyaux de cellules végé-tales. 
Après l’ancrage, par les produits de gènes chromosomiques, d’une agrobactérie sur la paroi d’une cellule 
A. 
rhizogenes 
sur 
Kalanchoe, 
INRA 
A. 
tumefaciens 
sur 
Tabac, 
Y. 
Chupeau 
(2001) 
M&S 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
41 
Plan 
• Introduc3on 
– Enjeux 
sociétaux 
et 
amélioraKon 
des 
plantes 
– De 
la 
domesKcaKon 
aux 
praKques 
actuelles 
• Les 
apports 
des 
biotechnologies 
– Biologie 
cellulaire 
et 
régénéraKon 
– Biologie 
moléculaire 
et 
Génomique 
– CréaKon 
et 
uKlisaKon 
de 
la 
biodiversité 
moléculaire 
• La 
transgénèse 
– Bases 
cellulaires 
et 
moléculaires 
de 
la 
transgénèse 
– Exemples 
d’uKlisaKons 
potenKelles 
– Etat 
actuel 
des 
cultures 
• Conclusions 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
42 
Bases 
théoriques 
de 
la 
transgenèse 
• Universalité du code génétique: 
• Rend possible l’utilisation de la séquence d’un gène 
quelle que soit son origine: plante, bactérie, animal 
• Existent des vecteurs de transfert de gènes 
• Font pénétrer un fragment d’ADN dans la cellule 
et le génome végétal 
• Biologique (agrobacteries, virus) 
• Physiques (biolistique, injection, électroportation), 
• Chimiques (PEG, liposomes) 
• Totipotence cellulaire : 
• Rend possible la régénération de plantes entières 
à partir d’une cellule (pas forcément nécessaires avec 
certains vecteurs biologiques) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
adapaté 
de 
C. 
PanneKer
43 
Historique 
de 
l’ingénierie 
géné3que 
végétale 
A. 
rhizogenes 
sur 
Kalanchoe, 
INRA 
1907, 
Agrobacterium 
tumefaciens 
agent 
de 
la 
galle 
du 
collet 
1968, 
Transfère 
d’informaKon 
et 
producKon 
d’une 
opine 
(G. 
Morel) 
1975, 
Plasmide 
Ti 
porteur 
du 
principe 
tumoral 
(Schell, 
Van 
Montagu) 
1977, 
Transfert 
d’ADN 
du 
plasmide 
Ti 
dans 
la 
cellule 
végétale 
(Chilton, 
Nester) 
1982, 
Plantes 
transformées 
par 
exploitaKon 
d’A. 
rhizogenes 
(Chilton, 
Tempé) 
1983, 
Tabacs 
transgéniques 
résistants 
à 
un 
anKbioKque 
(Van 
Montagu 
et 
Schell 
/ 
Bevan, 
Flavell 
and 
Chilton) 
1984, 
transfert 
direct 
de 
gènes 
dans 
des 
protoplastes 
et 
régénéraKon, 
(Paskowski, 
Caboche) 
1985, 
Premiers 
essais 
en 
champ 
de 
plantes 
transgéniques 
aux 
USA 
1986, 
Premières 
plantes 
résistantes 
à 
un 
herbicide 
1987/1993 
TransformaKon 
«in 
planta» 
d’Arabidopsis 
(Feldman, 
PelleKer) 
1994, 
1er 
PGM 
mis 
sur 
le 
marché 
(Tomate 
FlavSav) 
Calgene 
1995, 
Mise 
sur 
le 
marché 
de 
soja, 
maïs 
et 
coton 
transgénique 
aux 
USA. 
1998, 
AutorisaKon 
de 
vente 
de 
3 
variétés 
de 
maïs 
en 
France, 
qui 
devient 
le 
premier 
pays 
européen 
à 
culKver 
des 
PGMs 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
44 
Les 
étapes 
de 
la 
transgenèse 
27 
Le s é t a p e s d e l a t r a nsg é n è s e 
Id e n t i f i e r 
u n g è n e d ’ i n t é r ê t 
su r u n o r g a n isme d o n n e u r 
bact érie, 
plant e… 
Tr a nsf é r e r 
l e g è n e 
Ré g é n é r e r 
E v a l u e r 
l ’ e x p r e ssi o n 
d u g è n e 
Inco r p o r e r 
p a r d e s cro is eme n ts 
d a ns u n e v a r i é t é 
co m me rci a l e 
Tr a nsf o rma t i o n 
b i o l o g i q u e 
Tr a nsf e r t d i r e ct 
Iso l e r 
l e g è n e d ’ i n t é r ê t 
In t é g r e r 
l e g è n e d ’ i n t é r ê t d a ns u n e 
co nst r uct i o n g é n é t i q u e 
Mu l t i p l i e r 
l a co nst r uct i o n 
g é n é t i q u e 
microparticules Agrobact erium 
enrobé es 
d’ADN 
Sé l e ct i o n d e s c e l l u l e s 
t r a nsf o rmé e s 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
Source 
: 
GNIS
www.labomics.com 
Grizot 
et 
al. 
(2010) 
NAR 
45 
Limita3on 
de 
la 
transgénèse 
Le 
site 
d’inserKon 
dans 
le 
génome 
reste 
aléatoire 
(effet 
de 
posiKon 
sur 
l’expression 
du 
transgène 
ou 
créaKon 
de 
mutaKons). 
Les 
évènements 
de 
transformaKon 
sont 
donc 
parfois 
similaires 
à 
des 
mutaKons 
«classiques». 
Il 
serait 
uKle 
de 
pouvoir 
cibler 
les 
modificaKons 
Des 
technologies 
d’ingénierie 
moléculaires 
sont 
en 
cours 
de 
développement 
Les 
Nucléases 
à 
domaine 
en 
doigt 
de 
Zn 
(ZFNs) 
Les 
Méganucléases 
Les 
protéines 
TALEs 
(TranscripKon 
AcKvator-­‐Like 
Effectors) 
M. 
Mahfouz 
and 
L. 
Li 
(2012) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
Figure 1. Representation of TALEs structural features and the possible functional domains to generate
Les domaines d’application de la transgénèse 
L’agronomie 
• La résistance à des insectes 
• La résistance à des maladies 
• La résistance à des herbicides 
L’alimentation 
• Les qualités nutritionnelles 
• La maturation des fruits 
• La transformation 
agro-alimentaire 
L’industrie 
Les applications 
de la transgénèse 
• Les pâtes à papier 
• Les huiles industrielles 
• Les colorants 
La santé 
• Les produits sanguins 
• Les vaccins 
• Les protéines humaines 
Cf 
Ho‡e 
H. 
36 Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
46
47 
ApplicaKons 
agronomiques 
: 
Les 
maladies 
et 
les 
ravageurs 
=> 
+25% 
pertes 
des 
récoltes 
Wheat infected with wheat stem 
rust Puccinia graminis 
And 
from 
G. 
PelleKer 
Fusarium 
sur 
blé 
Oomycetes 
Bacteria 
Insects 
Wheat infected with root Fungi 
knot nematode 
Epi 
de 
maïs 
Infecté 
Larve 
de 
Pyrale 
par 
Fusarium 
Tige 
de 
maïs 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
48 
Jaunisse 
nanisante 
(orge) 
PLRV, 
P 
de 
terre 
Les 
stratégies 
an3virales 
sont 
parmi 
les 
premiers 
exemples 
de 
plantes 
transgéniques 
(1986) 
Une 
stratégie 
générale 
consiste 
à 
acKver 
les 
mécanismes 
de 
contrôle 
des 
virus 
en 
faisant 
produire 
à 
la 
plante 
transgénique 
des 
porKons 
du 
génome 
du 
virus, 
comme 
le 
gène 
codant 
l’enveloppe 
de 
ce 
virus 
Premier 
essai 
en 
champs, 
1987, résistance à un virus de la Tomate 
From 
G. 
PelleKer 
Coat 
Protein 
Mediated 
Resistance 
1986, 
From 
R. 
Beachy 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Autre 
exemple, 
les 
résistances 
aux 
insectes 
Très 
peu 
de 
solu3on 
conven3onnelle 
(ex. 
Résistance 
aux 
pucerons 
chez 
le 
melon. 
Limité 
à 
49 
cege 
espèce) 
Solu3ons 
transgéniques 
existent 
-­‐ 
ProducKon 
par 
la 
plante 
d’une 
protéine 
de 
B. 
thuringiensis 
toxique 
pour 
les 
larves 
de 
lépidoptères. 
From 
G. 
PelleKer 
and 
R. 
Beachy 
Pyrale 
du 
maïs 
Rem 
ProtecKon 
simultanée 
contre 
les 
mycotoxines 
de 
fusarium 
(surinfecKon) 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
50 
Résistance 
/ 
tolérance 
aux 
stress 
abio3ques 
-­‐ 
Tolérance 
aux 
métaux 
toxiques 
-­‐ 
Stress 
hydrique, 
de 
nombreux 
gènes 
candidats 
testés 
Tomates 
résistantes 
au 
sel 
(200 
mM 
NaCl) 
Surexpression 
d’un 
anKport 
Na+ 
Concentre 
le 
Na+ 
dans 
la 
vacuole 
Zhang& 
Blumwald 
-­‐ 
Nature 
Biotech, 
2001 
transgéniques 
WT 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
51 
Améliorera3on 
de 
la 
qualité 
La 
qualité 
industrielle 
ou 
nutri3onnelle 
-­‐ 
AugmentaKon 
de 
la 
teneur 
en 
huile 
de 
la 
graine 
(+40%) 
de 
colza, 
par 
sur-­‐expression 
d’une 
glycérol 
3P 
deshydrogénase 
de 
levure, 
Vigeolas 
et 
al. 
2007, 
Plant 
Biotech 
J.) 
-­‐ 
Doublement 
de 
la 
teneur 
en 
sucre 
de 
la 
canne 
à 
sucre 
par 
expression 
d’une 
isomérase 
bactérienne 
qui 
transforme 
le 
saccharose 
en 
iso-­‐ 
maltulose 
qui 
se 
trouve 
séquestré, 
Shiromani 
et 
al., 
2011, 
Plant 
Biotech 
J.) 
-­‐ 
L’adaptaKon 
de 
la 
biomasse 
lignocellulosique 
à 
ses 
usages 
(cf. 
H. 
H.) 
-­‐ 
La 
modificaKon 
de 
la 
structure 
de 
l’amidon 
(cf. 
S. 
B.) 
-­‐ Autres 
-­‐ 
ModificaKon 
de 
la 
nature 
et 
de 
quanKté 
d’acides 
gras… 
-­‐ 
producKon 
de 
flavonoïdes 
chez 
le 
riz 
-­‐ 
inhibiKon 
des 
allergènes 
de 
tomate 
-­‐ 
riz 
riche 
en 
provitamine 
A 
(riz 
doré) 
-­‐ 
Maïs 
enrichi 
en 
lysine 
et 
tryptophane 
(par 
sélecKon 
ou 
transgénèse) 
… 
Wild-type (top) and 
antioxidant-enriched 
tomatoes 
β-carotene makes 
the rice look 
golden 
Iron-enriched rice 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Figure 2 Carotenoid enhancement endosperm by transformation and crtI. (a) Schematic used to generate transgenic T-DNA comprised the rice (Glu) and the first intron gene from castor bean functionally fused to the chloroplast transit peptide phytoene synthase from species (psy), with a nos selectable marker cassette maize polyubiquitin (Ubi1) Lepiniec 
hygromycin resistance 52 
(b) Photograph of polished Enrichissement 
du 
riz 
en 
provitamine 
A 
: 
le 
riz 
doré 
Expression 
de 
2 
gènes, 
Psy 
de 
maïs 
et 
crt1 
d’Erwinia 
(Paine 
et 
al. 
2005) 
-­‐ 
Introgression 
en 
cours 
dans 
des 
variétés 
culKvées 
et 
première 
dérégulaKon 
agendue 
aux 
Philippines 
en 
2012/2013. 
LB SSUcrtI nos Glu Psy nos nos 
I Ubi1 hpt 
Adapté 
de 
E. 
Guiderdoni 
Wild Type Np Psy/crtI Zm Psy/crtI 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
Research in Cologne. 
In Amflora, the gene encoding the key enzyme for the synthesis of amylose, the granule 
bound starch synthase (GBSS), was switched off using the so-called antisense method 
through which a mirrored copy of the GBSS gene was reinserted into the genome of the 
potato. 
Starch Potato 
20% > 98% 
Amylose 
2010-03-30 page 5 of Apart from the intended change in the composition of its starch, Amflora maintains all the 
53 
Autre 
exemple 
d’applica3on 
industrielle 
Pomme 
de 
Terre 
produisant 
Uniquement 
de 
l’amylopecKne 
(AmfloraTM, 
BASF, 
InacKvaKon 
de 
la 
Granule 
Bound 
Starch 
Synthase) 
Ø Iitérêts 
industrielles 
: 
Ø Epaississant 
(amidon 
de 
haut 
poids 
moléculaire, 
de 
faibles 
teneurs 
en 
lipide 
et 
protéines), 
transparent,, 
bonne 
solubilité, 
characteristics of its mother variety, the starch potato variety Prevalent. 
Ø Papier, 
adhésifs, 
texKles, 
construcKon, 
cosméKques 
Amflora 
Starch 
potato 
Potato 
starch 
Content 
100% 
Amylopec3n 
80% 
Amylopectin 
Amylopectin 
Switched 
off gene for 
key enzyme 
of amylose 
synthesis 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
54 
Le 
développement 
du 
“molecular 
farming” 
Nombre 
de 
producKon 
de 
protéines 
pour 
la 
santé 
et 
l’industrie 
Lo 
̈ıc 
Faye 
and 
Veronique 
Gomord 
(2010) 
Plant 
Biotechnology 
Journal 
Volume 
8, 
Issue 
5, 
pages 
525-­‐528, 
Publishing activity in molecular farming classified per product (original papers). *From January to August 2009. 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
55 
Bilan: 
les 
OGM 
dans 
le 
monde 
(2011) 
-­‐ 
160 
millions 
d’hectares 
d’OGM 
culKvées 
(+ 
10% 
surfaces 
culKvées 
mondiales, 
+ 
8% 
/2010), 
-­‐ 29 
Pays 
au 
total, 
50% 
dans 
les 
PED 
. 
USA 
(69 
millions 
ha), 
Brésil 
(30), 
ArgenKne 
(24), 
Inde 
(11), 
Canada 
(10), 
Chine 
(4), 
Paraguay 
(3), 
Pakistan 
(3) 
Afrique 
du 
Sud 
(2 
millions) 
-­‐ 
La 
Chine 
invesKt 
2,4 
milliards 
d’euros 
sur 
12 
ans 
dans 
un 
programme 
massif 
«OGM» 
C. 
James 
ISAAA 
2012 
Source 
ISAAA 
2011 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
56 
11 
plantes 
cul3vées 
en 
2011, 
-­‐ 
4 
principales 
soja 
(75% 
en 
PGM), 
coton 
(82 
%), 
maize 
(32%), 
colza 
(26%), 
-­‐ 
mais 
aussi 
la 
begerave 
sucrière, 
luzerne, 
Papaye, 
courge, 
peuplier, 
poivron 
doux, 
tomate, 
pomme 
de 
terre, 
+ 
riz 
en 
cours 
et 
26 
espèces 
avec 
des 
évènements 
approuvés 
Global Area of Biotech Crops, 1996 to 2011: 
Crop (Million Hectares, Million Acres) 
Global Area of Biotech Crops, 1996 to 2011: 
By Crop (Million Hectares, Million Acres) 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
Surfaces 
culKvées 
en 
Millions 
hectares 
I S A A A 
80 
70 
198 
173 
60 
148 
50 
124 
40 
99 
30 
74 
20 
49 
10 
25 
0 
Soybean 
Maize 
Cotton 
Canola 
I S A A A 
80 
70 
60 
50 
40 
30 
20 
10 
2009 2010 2011 
Soybean 
Maize 
Cotton 
Canola 
1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 
Acres 
Source: Clive James, 2012 
I S A A A 
0 
1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 
M Acres 
0 
Source: Clive James, 2012
57 
Conclusions 
-­‐ 
Les 
espèces 
évoluent 
conKnuellement 
et 
les 
hommes 
ont 
mis 
à 
profit 
cege 
variabilité 
pour 
adapter 
les 
végétaux 
culKvés 
à 
leurs 
besoins. 
Il 
sera 
toujours 
nécessaire 
d’améliorer 
les 
plantes 
pour 
répondre 
à 
l’évoluKon 
des 
contraintes 
bioKques 
par 
exemple 
(maladies, 
prédateurs) 
et 
assurer 
des 
rendements 
minimum. 
De 
nouveaux 
objec3fs 
de 
qualité 
et 
de 
durabilité 
s’y 
ajoutent. 
-­‐ 
Les 
méthodes 
classiques 
de 
sélec3on 
restent 
nécessaires, 
en 
parKculier 
pour 
les 
caractères 
quanKtaKfs 
et 
mulKgéniques. 
Le 
développement 
de 
la 
génomique 
facilite 
et 
augmente 
la 
puissance 
de 
ces 
approches 
et 
ouvre 
de 
nouvelles 
perspec3ves 
de 
sélec3on 
« 
génomique 
». 
-­‐ 
Les 
biotechnologies 
permegent 
d’élargir 
la 
base 
géné3que 
u3lisable 
(ex 
gènes 
bactériens 
ou 
de 
levures) 
et, 
en 
faisant 
progresser 
les 
connaissances, 
d’envisager 
une 
véritable 
ingénierie 
géné3que. 
Elles 
permegent 
également 
de 
réduire 
considérablement 
le 
temps 
d’introgression 
des 
caractères 
d’intérêt 
dans 
de 
nombreuses 
variétés 
localement 
adaptées 
. 
-­‐ 
Les 
biotechnologies 
ne 
modifient 
pas 
les 
contraintes 
classiques 
qui 
s’imposent 
à 
l’amélioraKon 
des 
plantes 
et 
à 
l’agriculture 
(mainKen 
de 
la 
biodiversité, 
appariKons 
de 
résistances 
aux 
herbicides, 
maladies, 
prédateurs 
ou 
d’effets 
non 
agendus). 
Mais 
elles 
offrent 
des 
ouKls 
supplémentaires 
pour 
y 
répondre. 
-­‐ Que 
cela 
soit 
pour 
l’amélioraKon 
convenKonnelle 
ou 
reposant 
sur 
les 
biotechnologies, 
la 
disponibilité/diffusion 
des 
ressources 
géné3ques 
reste 
un 
facteur 
clef 
et 
stratégique. 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012
58 
Remerciements 
• P. Colonna 
• M. Caboche 
• Y. Chupeau 
• M. Jullien 
• G. Pelletier 
• A. Bendahmane 
• B. Chaloub 
• B. Dubreucq 
• E. Guiderdoni 
• F. Nogué 
• C. Pannetier 
• M. Tepfer 
• collègues du laboratoire 
• INRA 
• J. Tempé 
• M.D. Chilton 
• M. Van Montagu 
• J. Schell 
• R. Beachy 
• GNIS (J. Greffier) 
• The Plant Cell 
• www.wikimedia.org 
Lepiniec 
L. 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012

Contenu connexe

Tendances

Les Plantes Génétiquement Modifiées
Les Plantes Génétiquement ModifiéesLes Plantes Génétiquement Modifiées
Les Plantes Génétiquement Modifiées
GreenFacts
 
Cours Biotech Master.pdf
Cours Biotech Master.pdfCours Biotech Master.pdf
Cours Biotech Master.pdf
MOHAMED SLIM
 
Les hemocultures en pratique
Les hemocultures en pratique Les hemocultures en pratique
Les hemocultures en pratique
Dr Taoufik Djerboua
 
these tres iooooopmm.pdf
these tres iooooopmm.pdfthese tres iooooopmm.pdf
these tres iooooopmm.pdf
MOHAMED SLIM
 
Electrophorèse de l’hémoglobine sur acétate de cellulose
Electrophorèse de l’hémoglobine sur acétate de cellulose Electrophorèse de l’hémoglobine sur acétate de cellulose
Electrophorèse de l’hémoglobine sur acétate de cellulose
S/Abdessemed
 
exposé de l'apprenant Abdellatif Lotfi "Le clonage"
exposé de l'apprenant Abdellatif Lotfi "Le clonage"exposé de l'apprenant Abdellatif Lotfi "Le clonage"
exposé de l'apprenant Abdellatif Lotfi "Le clonage"
Ahmedd Slaoui
 
Guide des examens biologiques
Guide des examens  biologiquesGuide des examens  biologiques
Guide des examens biologiques
S/Abdessemed
 
Les examens bactériologiques
Les examens bactériologiquesLes examens bactériologiques
Les examens bactériologiques
Meriamme Oue
 
Livre des cours+tp microbiologie
Livre des cours+tp microbiologieLivre des cours+tp microbiologie
Livre des cours+tp microbiologie
arezki sadoudi
 
Tout sur la bactériologie
Tout sur la bactériologieTout sur la bactériologie
Tout sur la bactériologie
S/Abdessemed
 
7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux
zakaria2008
 
La partique au laboratoire de microbiologie
La partique au laboratoire de microbiologieLa partique au laboratoire de microbiologie
La partique au laboratoire de microbiologie
Dr Taoufik Djerboua
 
Les streptocoques / Streptococcus / Enterococcus
Les streptocoques / Streptococcus / EnterococcusLes streptocoques / Streptococcus / Enterococcus
Les streptocoques / Streptococcus / Enterococcus
Dr Taoufik Djerboua
 
Clonage
ClonageClonage
Les OGM
Les OGMLes OGM
Les OGM
Ahmed Dellaa
 
Copie de Cours de biosécurité II1.pptx
Copie de Cours de biosécurité II1.pptxCopie de Cours de biosécurité II1.pptx
Copie de Cours de biosécurité II1.pptx
MedMohamed35
 
Rapport du tp ; tqpa groupe 2 2
Rapport du tp ; tqpa groupe 2 2Rapport du tp ; tqpa groupe 2 2
Rapport du tp ; tqpa groupe 2 2
souhaila ennakhli
 
la Culture cellulaire
 la Culture cellulaire la Culture cellulaire
la Culture cellulaire
abir
 

Tendances (20)

Les Plantes Génétiquement Modifiées
Les Plantes Génétiquement ModifiéesLes Plantes Génétiquement Modifiées
Les Plantes Génétiquement Modifiées
 
Cours Biotech Master.pdf
Cours Biotech Master.pdfCours Biotech Master.pdf
Cours Biotech Master.pdf
 
Les hemocultures en pratique
Les hemocultures en pratique Les hemocultures en pratique
Les hemocultures en pratique
 
these tres iooooopmm.pdf
these tres iooooopmm.pdfthese tres iooooopmm.pdf
these tres iooooopmm.pdf
 
Electrophorèse de l’hémoglobine sur acétate de cellulose
Electrophorèse de l’hémoglobine sur acétate de cellulose Electrophorèse de l’hémoglobine sur acétate de cellulose
Electrophorèse de l’hémoglobine sur acétate de cellulose
 
exposé de l'apprenant Abdellatif Lotfi "Le clonage"
exposé de l'apprenant Abdellatif Lotfi "Le clonage"exposé de l'apprenant Abdellatif Lotfi "Le clonage"
exposé de l'apprenant Abdellatif Lotfi "Le clonage"
 
La culture cellulaire
La culture cellulaireLa culture cellulaire
La culture cellulaire
 
Guide des examens biologiques
Guide des examens  biologiquesGuide des examens  biologiques
Guide des examens biologiques
 
La callogenèse
La callogenèseLa callogenèse
La callogenèse
 
Les examens bactériologiques
Les examens bactériologiquesLes examens bactériologiques
Les examens bactériologiques
 
Livre des cours+tp microbiologie
Livre des cours+tp microbiologieLivre des cours+tp microbiologie
Livre des cours+tp microbiologie
 
Tout sur la bactériologie
Tout sur la bactériologieTout sur la bactériologie
Tout sur la bactériologie
 
7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux
 
La partique au laboratoire de microbiologie
La partique au laboratoire de microbiologieLa partique au laboratoire de microbiologie
La partique au laboratoire de microbiologie
 
Les streptocoques / Streptococcus / Enterococcus
Les streptocoques / Streptococcus / EnterococcusLes streptocoques / Streptococcus / Enterococcus
Les streptocoques / Streptococcus / Enterococcus
 
Clonage
ClonageClonage
Clonage
 
Les OGM
Les OGMLes OGM
Les OGM
 
Copie de Cours de biosécurité II1.pptx
Copie de Cours de biosécurité II1.pptxCopie de Cours de biosécurité II1.pptx
Copie de Cours de biosécurité II1.pptx
 
Rapport du tp ; tqpa groupe 2 2
Rapport du tp ; tqpa groupe 2 2Rapport du tp ; tqpa groupe 2 2
Rapport du tp ; tqpa groupe 2 2
 
la Culture cellulaire
 la Culture cellulaire la Culture cellulaire
la Culture cellulaire
 

En vedette

Greffage du Chataignier
Greffage du ChataignierGreffage du Chataignier
Greffage du Chataignier
Jacques Laurent
 
r57_9_brochure_bts_bio
r57_9_brochure_bts_bior57_9_brochure_bts_bio
r57_9_brochure_bts_bioEmilie Bierque
 
Conference OGM Mounier
Conference OGM MounierConference OGM Mounier
Conference OGM Mouniervguili
 
2014 à Chemin cueillant
2014 à Chemin cueillant2014 à Chemin cueillant
2014 à Chemin cueillant
CheminCueillant
 
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
severinlavoyer
 
Dynamiques collectives pour des cultures pérennes durables en Minervois
Dynamiques collectives pour des cultures pérennes durables en MinervoisDynamiques collectives pour des cultures pérennes durables en Minervois
Dynamiques collectives pour des cultures pérennes durables en Minervois
CheminCueillant
 
Conf biodiversité michalet
Conf biodiversité michaletConf biodiversité michalet
Conf biodiversité michalet
vguili
 
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
Pôle Qualiméditerranée
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinantetutankanson
 
Autres activités des he
Autres activités des heAutres activités des he
Autres activités des hemisstambouille
 
Mecanisme de gestion de la Secheresse en Tunisie
Mecanisme de gestion de la Secheresse en TunisieMecanisme de gestion de la Secheresse en Tunisie
Mecanisme de gestion de la Secheresse en Tunisie
NENAwaterscarcity
 
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
mynizhyn
 
Valoriser les fonctions du du végétal pour développer son marché
Valoriser les fonctions du du végétal pour développer son marchéValoriser les fonctions du du végétal pour développer son marché
Valoriser les fonctions du du végétal pour développer son marché
Hortea
 
Chlorophylle et pigments chlorophylliens
Chlorophylle et pigments chlorophylliensChlorophylle et pigments chlorophylliens
Chlorophylle et pigments chlorophyllienssection-scientifique
 
5. ascam talibi-marrakech
5. ascam talibi-marrakech5. ascam talibi-marrakech
5. ascam talibi-marrakech
zrouali
 
3.solution arzak pour les traitements post récolte des agrumes - sporekill
3.solution arzak pour les traitements post récolte des agrumes - sporekill3.solution arzak pour les traitements post récolte des agrumes - sporekill
3.solution arzak pour les traitements post récolte des agrumes - sporekill
zrouali
 
Recepteur Master23 10 09
Recepteur Master23 10 09Recepteur Master23 10 09
Recepteur Master23 10 09bio svi
 
Animal biotech
Animal biotechAnimal biotech
Animal biotech
Bruno Mmassy
 
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESSIMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
Department of Animal Production
 

En vedette (20)

Greffage du Chataignier
Greffage du ChataignierGreffage du Chataignier
Greffage du Chataignier
 
r57_9_brochure_bts_bio
r57_9_brochure_bts_bior57_9_brochure_bts_bio
r57_9_brochure_bts_bio
 
Conference OGM Mounier
Conference OGM MounierConference OGM Mounier
Conference OGM Mounier
 
2014 à Chemin cueillant
2014 à Chemin cueillant2014 à Chemin cueillant
2014 à Chemin cueillant
 
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
Projet Agr'eau - Résultats intermédiaires des fermes investies dans le projet...
 
Dynamiques collectives pour des cultures pérennes durables en Minervois
Dynamiques collectives pour des cultures pérennes durables en MinervoisDynamiques collectives pour des cultures pérennes durables en Minervois
Dynamiques collectives pour des cultures pérennes durables en Minervois
 
Conf biodiversité michalet
Conf biodiversité michaletConf biodiversité michalet
Conf biodiversité michalet
 
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
Bilan de l’affaire viande de cheval : quels verrous technologiques pour garan...
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinante
 
Autres activités des he
Autres activités des heAutres activités des he
Autres activités des he
 
Mecanisme de gestion de la Secheresse en Tunisie
Mecanisme de gestion de la Secheresse en TunisieMecanisme de gestion de la Secheresse en Tunisie
Mecanisme de gestion de la Secheresse en Tunisie
 
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
Перелік стоянок та місць відстою транспортних засобів при тимчасовому обмежен...
 
Valoriser les fonctions du du végétal pour développer son marché
Valoriser les fonctions du du végétal pour développer son marchéValoriser les fonctions du du végétal pour développer son marché
Valoriser les fonctions du du végétal pour développer son marché
 
Chlorophylle et pigments chlorophylliens
Chlorophylle et pigments chlorophylliensChlorophylle et pigments chlorophylliens
Chlorophylle et pigments chlorophylliens
 
5. ascam talibi-marrakech
5. ascam talibi-marrakech5. ascam talibi-marrakech
5. ascam talibi-marrakech
 
Presentation
PresentationPresentation
Presentation
 
3.solution arzak pour les traitements post récolte des agrumes - sporekill
3.solution arzak pour les traitements post récolte des agrumes - sporekill3.solution arzak pour les traitements post récolte des agrumes - sporekill
3.solution arzak pour les traitements post récolte des agrumes - sporekill
 
Recepteur Master23 10 09
Recepteur Master23 10 09Recepteur Master23 10 09
Recepteur Master23 10 09
 
Animal biotech
Animal biotechAnimal biotech
Animal biotech
 
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESSIMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
IMPACT OF BIOTECHNOLOGY ON ANIMAL BREEDING AND GENETIC PROGRESS
 

Similaire à Biotechnologies végétales

Le développement des plantes
Le développement des plantesLe développement des plantes
Le développement des plantes
SELLANI Halima
 
AIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
AIGx - J-P Destain & B. Bodson - Agriculture de l'AvenirAIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
AIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
Damien Vincke
 
this his about me what do yoi need moere
this his about me what do yoi need moerethis his about me what do yoi need moere
this his about me what do yoi need moere
Levi586607
 
L'agroécologie pour tous - N° 3 - Oct. 2014
L'agroécologie pour tous - N° 3 - Oct. 2014L'agroécologie pour tous - N° 3 - Oct. 2014
L'agroécologie pour tous - N° 3 - Oct. 2014
INRA Agroécologie Dijon
 
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
FAO
 
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogmFondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
Fondation Louis Bonduelle
 
Technique culture in vitro vegetale. Et biotechnologie végétale.pdf
Technique culture in vitro vegetale. Et biotechnologie végétale.pdfTechnique culture in vitro vegetale. Et biotechnologie végétale.pdf
Technique culture in vitro vegetale. Et biotechnologie végétale.pdf
nouairiissam
 
Belfertil - Presentation
Belfertil - PresentationBelfertil - Presentation
Belfertil - PresentationBelfertil
 
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
Agropolis International
 
cultureinvitro-130225021317-phpapp02.pptx
cultureinvitro-130225021317-phpapp02.pptxcultureinvitro-130225021317-phpapp02.pptx
cultureinvitro-130225021317-phpapp02.pptx
MounirSaggai1
 
cultureinvitro-130225021317-phpapp02.pdf
cultureinvitro-130225021317-phpapp02.pdfcultureinvitro-130225021317-phpapp02.pdf
cultureinvitro-130225021317-phpapp02.pdf
HICHAM215202
 
42 [pdf library]
42 [pdf library]42 [pdf library]
42 [pdf library]
nourd
 
Impact des pesticides sur les abeilles et les autres pollinisateurs
Impact des pesticides sur les abeilles et les autres pollinisateursImpact des pesticides sur les abeilles et les autres pollinisateurs
Impact des pesticides sur les abeilles et les autres pollinisateursSaid Fagouri
 
SAPHO_des_plantes_pour_les_abeilles_web.pptx
SAPHO_des_plantes_pour_les_abeilles_web.pptxSAPHO_des_plantes_pour_les_abeilles_web.pptx
SAPHO_des_plantes_pour_les_abeilles_web.pptx
Sapho Edition
 
La biodiversité agricole.pptx
La biodiversité agricole.pptxLa biodiversité agricole.pptx
La biodiversité agricole.pptx
RamanandraibeIorenan
 
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
Bioversity International
 
Restauration du mondoro douentza- mali
Restauration du mondoro  douentza- maliRestauration du mondoro  douentza- mali
Restauration du mondoro douentza- maliMaikeita
 
Restauration de Scorzonera humilis au Luxembourg
Restauration de Scorzonera humilis au LuxembourgRestauration de Scorzonera humilis au Luxembourg
Restauration de Scorzonera humilis au Luxembourg
Célia Stutz
 
La permaculture ou le jardin d'eden - Stephane Groleau
La permaculture ou le jardin d'eden - Stephane GroleauLa permaculture ou le jardin d'eden - Stephane Groleau
La permaculture ou le jardin d'eden - Stephane GroleauShabba Inf
 

Similaire à Biotechnologies végétales (20)

Le développement des plantes
Le développement des plantesLe développement des plantes
Le développement des plantes
 
AIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
AIGx - J-P Destain & B. Bodson - Agriculture de l'AvenirAIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
AIGx - J-P Destain & B. Bodson - Agriculture de l'Avenir
 
this his about me what do yoi need moere
this his about me what do yoi need moerethis his about me what do yoi need moere
this his about me what do yoi need moere
 
L'agroécologie pour tous - N° 3 - Oct. 2014
L'agroécologie pour tous - N° 3 - Oct. 2014L'agroécologie pour tous - N° 3 - Oct. 2014
L'agroécologie pour tous - N° 3 - Oct. 2014
 
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
Les champs écoles de producteurs pour une diffusion des pratiques agroécologi...
 
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogmFondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
Fondation louis bonduelle_communiqué_presse_monographie_biologie_vegetale_ogm
 
Technique culture in vitro vegetale. Et biotechnologie végétale.pdf
Technique culture in vitro vegetale. Et biotechnologie végétale.pdfTechnique culture in vitro vegetale. Et biotechnologie végétale.pdf
Technique culture in vitro vegetale. Et biotechnologie végétale.pdf
 
Belfertil - Presentation
Belfertil - PresentationBelfertil - Presentation
Belfertil - Presentation
 
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
Dossier Agropolis International : Agronomie -plantes, cultivées et systèmes d...
 
cultureinvitro-130225021317-phpapp02.pptx
cultureinvitro-130225021317-phpapp02.pptxcultureinvitro-130225021317-phpapp02.pptx
cultureinvitro-130225021317-phpapp02.pptx
 
cultureinvitro-130225021317-phpapp02.pdf
cultureinvitro-130225021317-phpapp02.pdfcultureinvitro-130225021317-phpapp02.pdf
cultureinvitro-130225021317-phpapp02.pdf
 
42 [pdf library]
42 [pdf library]42 [pdf library]
42 [pdf library]
 
Impact des pesticides sur les abeilles et les autres pollinisateurs
Impact des pesticides sur les abeilles et les autres pollinisateursImpact des pesticides sur les abeilles et les autres pollinisateurs
Impact des pesticides sur les abeilles et les autres pollinisateurs
 
SAPHO_des_plantes_pour_les_abeilles_web.pptx
SAPHO_des_plantes_pour_les_abeilles_web.pptxSAPHO_des_plantes_pour_les_abeilles_web.pptx
SAPHO_des_plantes_pour_les_abeilles_web.pptx
 
La biodiversité agricole.pptx
La biodiversité agricole.pptxLa biodiversité agricole.pptx
La biodiversité agricole.pptx
 
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
Without safeguarding trees, one can't safeguard the forest - Soutenir les Arb...
 
Un sol vivant3
Un sol vivant3Un sol vivant3
Un sol vivant3
 
Restauration du mondoro douentza- mali
Restauration du mondoro  douentza- maliRestauration du mondoro  douentza- mali
Restauration du mondoro douentza- mali
 
Restauration de Scorzonera humilis au Luxembourg
Restauration de Scorzonera humilis au LuxembourgRestauration de Scorzonera humilis au Luxembourg
Restauration de Scorzonera humilis au Luxembourg
 
La permaculture ou le jardin d'eden - Stephane Groleau
La permaculture ou le jardin d'eden - Stephane GroleauLa permaculture ou le jardin d'eden - Stephane Groleau
La permaculture ou le jardin d'eden - Stephane Groleau
 

Biotechnologies végétales

  • 1. 1 Les biotechnologies végétales : créa3on de biodiversité dans les génomes végétaux et améliora3on des plantes Loïc Lepiniec IJPB, INRA-­‐AgroParisTech, Versailles et LabEx SPS Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 2. 2 Les biotechnologies végétales • Introduc3on – Enjeux sociétaux et l’amélioraKon des plantes – L’amélioraKon, de la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 3. 3 12 10 8 6 4 2 0 Un contexte mondial en évolu3on rapide Consommation d’d’énergie (Qbtu / yr) 1400 1200 1000 800 600 400 200 0 Population mondiale Consommation d’énérgie 2000 2050 2100 Population (Milliards) 1900 1950 Années from Energy Projections IIASA / WEC, Population Projections: United Nations “Long-Range World, Population Projections”. Adapted from R. Beachy • Une demande croissante des produits de l’agriculture : – AugmentaKon de la populaKon (6 à 9 Mds) – ÉvoluKon des habitudes alimentaires – Epuisement du carbone fossile – Nécessite d’augmenter de 70% la producKon (Banque Mondiale, World Dev. Rep. 2008) • Contraintes environnementales – Impact de l’agriculture sur l’environnement, – Changement climaKques – LimitaKon des ressources (terres agricoles, eau, énergie, ferKlisants, biodiversité…) • Conclusion, il faut produire plus et mieux… nécessité d’une intensifica3on durable Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 4. Comment relever le défi d’une intensifica3on durable? 4 Améliora3on des plantes Bonne gesKon des ressources (eau, sols, énergie, biodiversité) PraKques agricoles Intensifica3on Durable PraKques industrielles OrganisaKon socio-­‐économique et poliKque soutenant le développement agricole Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 5. Contribu3on possible de l’améliora3on géné3que? Séminaire Biotechnologies -­‐ 9 et 10 février 2012 5 -­‐ Au cours des 60 dernières années, les rendements des principales cultures ont été mul3pliés par 5 -­‐ L’améliora3on géné3que a contribué pour + de 50% -­‐ Compte tenu du contexte actuel -­‐ augmentaKon des besoins en produits agricoles (+ 70%) -­‐ Crise environnementale, limitaKon intrants, sols, eau -­‐ L’améliora3on géné3que devra faire plus et mieux… -­‐ Comment les biotechnologies ont déjà et peuvent encore y contribuer?
  • 6. 6 Maïs, ~ 7000 ans Haricot, pomme de terre ~ 10,000 ans L’améliora3on géné3que des plantes and by genetic, linguistic and skeletal human populations. The clearest such insight review articles Blé, orge, pois, ~ 13,000 ans Fertile Crescent West Ethiopia Africa China Centres of origin of food production The most productive agricultural areas of the modern world hgp://arstechnica.com Riz et soja ~ 9000 ans their permanent gardens, orchards and pastures, instead of migrat-ing to follow seasonal shifts in wild food supplies. (Some Eastern US Sahel Mesoamerica New Guinea Andes and Amazonia of plant and homelands of orange-shaded 5.1 of productive areas cereals and yellow-shaded overlap that China the most States United The different which the wild domesticable other areas those Diamond, J. (2002) Nature 418: 700-707, Purugganan and Fuller (2009), Nature 457: 843-848) Riz, haricot ~ 8500 ans L’amélioraKon des plantes débute avec la sédentarisaKon de l’homme, il y a 10000 ans, dans différentes régions (une dizaine). Millet ~ 5000 ans sorgho ~ 4000 ans
  • 7. 7 1 La sélection apparaît avec l’agriculture La domestication L’adaptation en Europe L’extension des Premiers maïs Populations Hybrides L’ancêtre sauvage Téosinte Apparition au Mexique Présence en Amérique Introduction dans le sud de l’Europe zones de culture Exemple du maïs Création des premiers hybrides en France -7000 ans 1494 1947 Séminaire Biotechnologies -­‐ 9 1 quintaux/hectare et 10 février 2012 90 quintaux/hectare L’exemple du maïs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 source: GNIS
  • 8. 8 Clark et al., 2006 La domes3ca3on concerne quelques gènes majeurs Le gène TB1 (TEOSINTE BRANCHED 1) -­‐ code un facteur de transcripKon (TCP) -­‐ contrôle la structure branchée de la plante -­‐ Sa surexpression entraine une dominance apicale accrue et le développement d’une Kge unique et épaisse chez le maïs culKvé Doebley, et al.. (2006) Cell 127: 1309-1321, Le gène TGA1 (TEOSINTE GLUME ARCHITECTURE 1) -­‐ Code un facteur de transcripKon (SBP) -­‐ contrôle le développement des glumes -­‐ sa mutaKon produit des grains nus et fixés à l’épi Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 9. 9 recessive allele q (center) and wild wheat (left) with the recessive allele have slender, fragile spikes. (Fourth row) The massive fruit of cultivated tomato (right) next to the miniscule fruit of its progenitor (left). (Fifth row) A wild sunflower plant (left) has many small heads borne on multiple slender stalks, whereas a cultivated sunflower plant (right) Exemples similaires chez d’autres plantes Quelqhaus ea ssi nggèle nlaergse hseoadn bto rrnees opn oa nthiscak bstalelk.s de -­‐ L’égrainage du panicule de riz sauvage (qSH1 et sh4) gathered from another location. Key to the domestica-tion process would be a subsequent switch from allow-ing -­‐ La structure edible wild compacte species et to naturally solide de resow l’épis themselves de blé (Q) in burned fields, to sowing seed gathered the previous season. Once this practice was established, selection and crop improvement could begin. Although cereals and other field crops were likely to have been domesticated in the context of large fields cleared by burning or by spring floods along rivers, other domesticates may have had their beginnings as weeds near seasonal campgrounds (Anderson, 1969). Hunter-gatherers often follow seasonal migra-tory schedules, visiting the same specific sites at given times every year. The disturbance of the natural vegetation and middens at these sites provided fertile ground for the types of colonizing species that were the progenitors of our crops. Seeds discarded with the “kitchen” trash one year would sprout into a new crop by the time the group returned the following year. If they preferentially collected seeds and fruit from plants with the most desirable traits, then over time the frequency of plants with these favored phenotypes would increase in their garden crop. Eventually, no new wild seeds and fruits would be collected and a switch to deliberate sowing of seeds would occur. The early agricultural practices just described have Doebley et al. (2006), Cell, 127: -­‐ La taille réduite de plusieurs plantes culKvées est contrôlée par des homologues du gène GAI impliqué dans la biosynthèse d’une hormone, chez, le blé (Rht), le maïs (Dwarf 8), ou le colza (Bzh) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 10. L’améliora3on repose sur l’u3lisa3on de la biodiversité 10 La domesKcaKon a reposé essenKellement sur l’existence et la sélecKon de quelques gènes (allèles) à effets forts (qualitaKfs) L’amélioraKon actuelle repose sur l’existence de variabilité d’un plus grand nombre de gènes (d’allèles) à effets souvent plus fins et complexes (quanKtaKfs et interacKfs). Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 11. Les principes de l’améliora3on des plantes Les biotechnologies Les Source: GNIS 11 Les principes de l’amélioration des plantes Exemple de la pomme de terre Diversité existante Croisement • Plus productives • Plus résistantes aux maladies et aux parasites • Mieux adaptées au sol et au climat • Mieux adaptées aux techniques culturales • Régularité des formes • Qualité culinaire • Adaptées aux transformations : frites, chips, pommes de terre surgelées, fécule… entre individus choisis pour leurs caractères intéressants Collections de plus de 3 500 formes sauvages ou cultivées Nouvelle variété Objectifs de sélection des variétés Les biotechnologies dans un programme de sélection Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 12. 12 Les méthodes de sélec3on ont évolué 1) Depuis la domes3ca3on, pra3quait essen3ellement la sélec3on massale -­‐ Choix des meilleures populaKons, (porte) graines sur leurs performances propres -­‐ Permis l’amélioraKon de populaKons de plantes autogames (blé, orge,…) 2) A par3r du milieu du 19ième siècle, mise en place de la sélec3on généalogique -­‐ basée sur la sélecKon d’individus et leurs performances en descendance (de Vilmorin) -­‐ l’amélioraKon d’espèces autogames et allogames (fécondaKon croisée), ex begeraves 3) Au 20 ième s. u3lisa3on des cartes géné3ques puis des marqueurs moléculaires -­‐ Grace à l’uKlisaKon des lois de G. Mendel -­‐ Etablissement des bases de la sélecKon des hybrides de maïs par Shull (1908) -­‐ Culture des premières variétés de maïs hybride aux Etats-­‐Unis (1933) -­‐ Etablissement des premières cartes généKques du maïs par Emerson (1935) -­‐ Débuts de la sélecKon assistée par marqueurs, à parKr de 1980 A. Gallais (2011) Méthodes de créaKon de variétés en AmélioraKon des plantes, Ed Quae D. De Vienne (1998), Les marqueurs moléculaires en généKque et biotechnologies végétales, Ed INRA
  • 13. 13 Exemple de résultats de l’améliora3on, le blé 7000 av JC Domes3ca3on du blé tendre en mésopotamie 1600: arrive probablement à 5 Qx/ha 1800 fer3lisa3on/principe de res3tu3on, 10 Qx/ha 1900 « Révolu3on » agronomique, intrants, machinisme, géné3que 1960 « Révolu3on Verte » dans les pays en voie développement 1980: 65 Qx/ha 2000: 80 Qx/ha (France) plant breeder and Nobel Laureate Norman Borlaug 1914-2009 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 14. 14 Limites des techniques d’améliora3on conven3onnelles Les limites inhérentes à la reproduc3on sexuée Difficultés de réaliser des croisements entre espèces Risques d’introducKon de caractères indésirables dans la nouvelle variété Délais pour créer une nouvelle variété liés aux cycles de végétaKon Et au nombre de généraKons nécessaires Les avantages des biotechnologies Créer et mieux exploiter la diversité faciliter les croisements interspécifiques Connaître le génome et maîtriser l’apport de nouveaux caractères Diminuer la durée de créa3on variétale Adapté du GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 15. 15 • Introduc3on – Enjeux sociétaux et l’amélioraKon des plantes – L’amélioraKon, de la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 16. Les biotechnologies Les Biotechnologies dans un programme de sélec3on 16 dans un programme de sélection Les biotechnologies Les biotechnologies Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique Exploiter la diversité Sauvetage d’embryons interspécifiques Fusion de protoplastes Transgénèse Diminuer la durée de création Haplodiploïdisation Culture d’embryons immatures Les étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété Biologie moléculaire Biologie Cellulaire Source : GNIS Transgénèse Connaître le génome Exploiter la diversité Accélérer la créaKon
  • 17. 17 Méthodes de micropropaga3on in vitro pousse axillaire Mul8 Des applications de la Le sauvetage d’embryons La culture de méristèmes La multiplication conforme embryon méristème noeud 3plica3on in vitro de 3ssus végéta3fs -­‐ Sauvetage d’embryons ; tomate, tournesol, courgege, laitue,… -­‐ Culture de méristèmes: pomme de terre, arKchaut, dahlia, vigne, ail, fraisier,… -­‐ Microbouturage : figuier, séquoia, pins, eucalyptus, peuplier, merisier, framboise, vigne… -­‐ ApplicaKons -­‐ PropagaKon clonale (végétaKve) -­‐ MulKplicaKon rapide, gains de temps importants -­‐ ÉliminaKon de viroses (méristème et thermothérapie) -­‐ Autres techniques -­‐ Embryogenèse somaKque -­‐ ObtenKon et fusion de protoplastes et régénéraKon -­‐ HaploïdisaKon Source : GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 18. Bref rappel historique sur les biotechnologies cellulaires 18 -­‐ Culture « in vitro » de cellules, de 3ssus et régénéra3on 1902 Découverte de la to3potence des cellules végétales, Haberland. 1930 Culture de Kssus végétaux 1939 culture indéfinie de cambium, Gautheret 1950 culture in vitro, développée par Morel et MarKn, sur la pomme de terre. 1952 assainissement par culture de méristème de dahlia, Morel et Mar3n 1957 rôle équilibre auxine/cytokinine dans le contrôle de la formaKon d’organes 1958, obten3on des premiers embryons soma3ques de caroie Reinert et Stewart 1960 première mulKplicaKon végétaKve in vitro de l’orchidée, Morel 1964 cultures de cellules sexuelles mâles chez le Datura par Guha et Maheshwari. 1965 culture de cellules végétales 1967 plantes haploïdes, Bourgin 1971 protoplastes de tabac 1978 premières fusions de protoplastes, par Melchers. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 19. 19 Exemples de bouturage et microbouturage Bouturage, Technique ancestrale : -­‐1100 ans, néolithique, figuier parthenocarpique,… Geranium, Rosiers, Groseillers…. Développement Industriel pour des plantes variées: Rosiers, Orchidées, FruiKers… Adapté de Y. Chupeau microbouturage et culture de méristème apical : Guérison de Dalhia ageints d’une maladie à virus Morel et MarKn, 1952. Extension à la pomme de terre, puis à de nombreuses plantes… Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 20. Embryogénèse Soma3que et Sauvetage d’embryons 20 L’embryogenèse soma3que -­‐ Exemple, producKon de plants de conifères Lelu et Thomson 2000 / M. jullien Sauvetage d'embryons -­‐ Sauvetage par culture in vitro d’embryons non viables. -­‐ Exemple, embryons obtenus par croisements entre tournesols culKvés et sauvages. -­‐ Les espèces sauvages de tournesol = réservoir de résistances aux pathogènes (résistant au mildiou et au ScleroKnia) x Adapté de F. Nogué Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 21. 21 21 L’ o b t e n t i o n d e p ro t o p l ast es Cellules végétales débarrassées de leur paroi pecto-­‐cellulosiques (cf H. H.) Pa r e nch yme d e j e u n es f e u ill es Di g est i o n e n z yma t i q u e d e l a p a ro i E n z y mes d e l yse d e l a p a ro i p ect oce ll u l osi q u e A j o u ts d ’ é l éme n ts st a b ilisa n ts sucres, sels minéraux Susp e nsi o n d e p ro t o p l ast es Fusion, transforma3on, régénéra3on Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 22. 22 Applica3ons : Fusion de protoplastes et régénéra3on La maîtrise de la culture et de la fusion de protoplastes (A) et de la régénéra3on de colza (B) ont permis la régénéra3on de CYBRIDES (CY), hybrides cytoplasmiques. Cege approche a permis par exemple de transferer la stérilité mâle Ogura portée par l’ADN mitochondrial (O) au colza normal (N). Disposer d’une stérilité mâle chez le colza facilite la créaKon des hybrides F1. G. PelleMer, INRA Versailles Adapté de M. Jullien A B C O CY N Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 23. Etamines Pollen 23 Haplo(diplo)ïdisa3on L’haploïdisaKon est l’obtenKon d’ individus provenant d’un seul parent (sans fécondaKon). Après un doublement (spontanée ou induit ou «diploïdisaKon») du nombre de chromosomes cela conduit à des lignées parfaitement homozygotes 2n (« pures »). Elle permet donc des gains de temps et d’efficacité considérables pour la fixa3on de caractères par rapport à des cycles classiques de croisements. From Y. Chupeau Haploïdisa<on spontanée polyembryonie (ex: asperge), androgenèse in situ (ex: tabac) et gynogenèse in situ (ex: maïs, colza). Androgenèse, à par<r des gamètes mâles (plus de 150 espèces) • formaKon d’embryons à parKr d’étamine de Datura (1966, Guha et Maheswari) • ObtenKon de plantes haploïdes à parKr de grains de pollen de tabac (1967 Nitsch et Bourgin) • Datura, Tabac, Riz, Colza, Orge, Blé, Pomme de terre, Maïs,... Gynogenèse -­‐ Culture d’ovaires/ovules (1976) : Orge, Blé, Tabac, Riz, Gerbera, Maïs, Begerave,… -­‐ Croisements interspécifiques (1964) : Pomme de terre, Orge, Melon, Blé, Luzerne,... -­‐ UKlisaKon de pollen irradié (1983) : Orge, Blé, Pétunia, Melon, Caroge, Concombre, Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 24. Les biotechnologies dans un programme de sélection 24 La génomique dans l’améliora3on Les biotechnologies Les Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Biologie Cellulaire Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété ObjecKfs : Localiser et séquencer les gènes Etudier leur foncKon Les uKliser pour créer de la variabilité et comme marqueurs pour la sélecKon Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 25. 25 Historique de l’étude des génomes et de l’ADN 1900. Mise en applicaKon des lois de Mendel sur l'hérédité 1911. NoKon de liaison généKque, Morgan, (Nobel 1933) 1953. DescripKon de la structure en double hélice de l'ADN Watson, Wilkins, et Crick (Nobel 1962) 1960. Découverte du code généKque Crick, Nirenberg, Mathaeri et Ochoa (Nobel, 1968) 1965. Découverte des enzymes de restricKon Aber, Smith et Nathans (Nobel 1978) 1973. ADN recombinant, Berg (Nobel 1980) 1977. Séquençage de l’ADN, Gilbert et Sanger (Nobel 1980) 1983. Clonage par amplificaKon in vitro (PCR), Mullis (Nobel, 1993) 1990 Co-­‐suppression, silencing et miRNA, (Mello, Fire, Nobel 2006) 49 La c a r t o g r a p h i e d e s ma rq u e u rs m Exemple de cart e géné tique de marqueurs RFLP che z la pomme Pr i nci p e d e d é t e rmi n a t i o n d e l a d ist a nc e g é n é t i q u e e n t r e d e u x l ocus A Parents homozygot es éloignés géné tiquement GP39 PSC CP49 CP65(a) GP85(a) GP1(b) GP17 Descendance F2 La distance génétique entre les deux locus exprimée en centiMorgan, PAL(d) A }est fonction du pourcentage - A B - a b Type parent al A B de recombinés a b - A b - aB }Type recombiné d Chromosome I CP100 Chromosome II Chromosome III Chromosome IV Chromosome V Chromosome VI Chromosome VII GP93 CP65(b) GP22 CP43(d) PAT(a) CP16 CP94(a) GP36(b) GP92 GP36(a) GP74(GP74(c) GP40(a) CP14 WX GP87(d) GP33(b) GP91(b) GP35(e) PAL(f) GP91(a) pI471 CP20(a) PAL(b) GP97 PAL(c) GP85(GP74(PAL(a) CP53 GP87(c) Actin GP78 GP31 GP21 GP35(d) GP28(b) GP35(b) GP87(a) CP72 PAL(e) GP35(a) GP85(c) CP59 CP47 CP51(b) CP51(a) rbcS-1 CP15(a) GP1(a) GP25 GP80 CP6 4CL(a) CP32(d) GP1(c) GP74(a) GP74(d) GP23 GP35(c) CP70(c) rbcS-c CP48(a) CP15(b) GP86 GP33(a) GP98 GP26 rbcS-2 PC116 PAT(b) GP1(d) GP90 CP64(a) CP64(b) CP11 CP69(a) GP33(d) CP69(b) GP33(c) CP19 GP88 GP28(a) CP62 CP13 GS -­‐ L’ADN est le support moléculaire de l’informaKon généKque -­‐ C’ est une chaine (2 brins) de quatre molécules (A,T, G, C) -­‐ Il a une structure idenKque chez tous les organismes vivants -­‐ Sa réplicaKon et sa transmission induisent des variaKons -­‐ Une évoluKon permanente des génomes Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 26. 26 Les génomes végétaux et leur séquençage > 20 Espèces végétales séquencées depuis 2000 Arabidopsis thaliana. -­‐ La taille des génomes végétaux varie de façon considérable Arabidopsis 140 Mb, Blé 16 000 Mb (malgré un nombre de gènes équivalent par génome ; ~ 30 000 gènes) -­‐ Une fracKon importante de certains génomes est consKtuée de séquences dites non codantes et/ou répétées (e.g. transposons). Cassava Sorghum Potato Tomato Maize Sugarcane Papaya Medicago Genome size of all published crop genomes (shown in green) and the five most important producKon crops with unpublished genome sequences (shown in blue).. Morell et al. (2012) Nature Review GeneKcs, 13:85-­‐96 Nature Reviews | Genetics 18,000 16,000 14,000 12,000 10,000 8,000 6,000 4,000 2,000 0 Genome size (Mb) No published sequence Published sequence Average angiosperm Cucumber Peach Strawberry Foxtail millet Cacao Rice Grape Pigeonpea Soybean Sugar beet Barley Bread wheat Orange Figure 1 | Crop genome size. Genome Lepiniec size of L. all Séminaire published Biotechnologies crop genomes -­‐ 9 et 10 (shown février 2012 in green) and the five most important production crops with unpublished genome sequences (shown in blue). The average angiosperm genome
  • 27. 27 • Inventaire Bénéfices directes du séquençage des génomes: des gènes «puta3fs» grâce aux ouKls bioinformaKques • Etude de leur polymorphisme (génotypage), caractérisaKon des allèles • Etude de l’expression de ces gènes (puces à ADN, ESTs etc…) • SimplificaKon du lien entre phénotype et gène impliqué (marqueur) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 From M. Caboche
  • 28. 28 Iden3fica3on de gènes par comparaison des génomes 51 La cartographie comparée Amidon-Waxy Hauteur des plantes Grain rouge Absence de ligule Génome de l’espèce : Blé 1 Maïs Date de Riz floraison Numéro 6 5 du chromosome Zone de présence d’un caractère : Source : Devos et Gale, 1997 X Basée sur la conservaKon de la co-­‐localisaKon / de l’ordre des loci homologues le long des chromosomes (synténie) due à la parentée évoluKve des génomes Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 29. U3lisa3on de marqueurs moléculaires pour la selec3on 29 - Il est beaucoup PRECIS et RAPIDE de suivre un caractère avec un marqueur moléculaire qu’à partir du phénotype (mesure indirecte et relative du caractère) - Exemple de l’introgression du gène Bt d’une lignée donneuse dans une lignée cultivée Phenotype: résulte de l’expression d’un caractère et de son interacKon avec l’environnement Photo credit LemnaTec; Anderson, L.K.et al.. (2006). La sélection assistée par marqueurs Exemple de l’introgression du gène Bt Chromosome I CG100 CG161 CG259 CG363 CG320 Bt CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Back-cross 1 Chromosome I CG100 CG161 CG259 CG363 CG320 CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Bt Back-cross 2 Chromosome I CG100 CG161 CG259 CG363 CG320 CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Back-cross Lignée élite Source : GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 30. + simples et faciles à caractériser, changement d’un nucléoKde 30 U3lisa3on de marqueurs moléculaires pour la caractérisa3on de loci d’intérêt Deux grandes approches pour établir le lien entre un phénotype et un génotype (des allèles) Le principe est toujours d’étudier la co-­‐ségréga3on Etude de liaison, en descendance de 2 parents connus entre un phénotype et des marqueurs ADN Géné3que d’associa3on En uKlisant la diversité généKque naturelle QTL (QuanKtaKve Trait Loci) LD (Linkage Desequilibrium) -­‐ Deux types d’évolu3ons importantes concernent -­‐ Développement de marqueurs (SNP), l’uKlisaKon de puces de génotypage très denses et/ou le débit du “re-­‐séquençage”. Voir Morell et al. (2012) Crop genomics : advances and applicaKons, Nature Review GeneKcs -­‐ la généra3on d’un nouveau type de popula3ons “intermédiaires” qui combinent celles présentées (croisements de parents mulKples) -­‐ Ouvrent la voie à des approches plus globales de sélec3on génomique (combinaisons d’allèles) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 31. 31 Les origines des muta3ons et leurs u3lisa3ons -­‐ Les mutaKons s’accumulent en permanence avec les généraKons (erreurs de réplicaKon et/ou de réparaKon de l’ADN) -­‐ Cege accumulaKon peut-­‐être sKmulée par la présence d’agents mutagènes -­‐ biologiques (inserKon de retrovirus, transposons), -­‐ physiques (rayonnements), ou chimiques et -­‐ Et l’échange de matériel géné3que avec d’autres espèces -­‐ Les mutaKons sont de nature diverse • AAATGCATAAAA TGCTAGGTCCGCCGATATATAACCC Séquence ancestrale • AAATGCATAATA TTCTAGGTCCGCCGATATATAACCC Ponctuellle • AAATGCATAAAA TGCTAGGT-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐ATATATAACCC DéléKon • AAATGCATAAAA TGCTAGGTCCGCCGGGCGGCCCATATATAACCC InserKon • Elles consKtuent la base de la sélecKon Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 32. Exemple de muta3ons spontanées sources de diversité 32 Chou-fleur Romanesco Bruxelles Chou cultivé Chou sauvage Broccoli Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 33. Acquisi3on de gènes par croisements interspécifiques : 33 Exemple de la tomate 10 % du génome (3000 gènes) des tomates culKvées proviennent de croisements avec d’autres espèces L. esculentum L. pimpinellifolium* L. cheesmanii* L. parviflorum L. chmielewskii L. chilense L. hirsutum* L. pennellii* L. peruvianum* From www.eu-­‐sol.net Lycopersicon ancestral Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 34. 34 Les croisements interspécifiques spontanés, le blé Triticum urartu Ae. Section Sitopsis Triticum æstivum Génome A Génome B Génome D Blé dur Blé tendre Espèces créées par croisements interspécifiques spontanés : blé, hexapolyploïdes cotonnier, colza, moutarde brune, fraisier, tabac, peuplier, pêcher-­‐amandier,… Adapté de G. PelleKer Triticum aestivum Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 35. Polyploïdisa3on, une source importante de diversité Figure 1 -­‐ Schema3c phylogene3c tree of flowering plants. BR1 – monocots+eudicots duplicaKon; BR2 – Eudicot-­‐wide duplicaKon; BR3 – Core eudicot-­‐wide duplicaKon; BR4 – Rosid-­‐wide duplicaKon. Y Jiao et al. (2012) A genome triplicaKon associated with early diversificaKon of the core eudicots 35 Genome Biology 2012, 13:R3 C’ est une duplica3on du génome Peut être naturelle Caféier arabica (4X=44), Dactyle (4X=28), Luzerne (4X=32)… • Des plantes aujourd’hui considérées comme diploïdes sont d’anciens tétraploïdes. Ex Maïs, vigne, Peuplier, fraisier • Mise sen évidence d’au moins 3 duplicaKons successives chez les dicotylédones Peut être induite induite: 1937, Blakeslee découvre l’acKon de la colchicine Est à l’origine de très nombreuses muta3ons -­‐ Remaniements chromosomiques -­‐ InserKons et déléKons -­‐ AcKvaKon de transposons -­‐ Dérive rapide / néofoncKonalisaKon (baisse de la pression de sélecKon -­‐ RégulaKons épigénéKques Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 36. 36 Les transposons Liseron Sélection vers 1940, insertion d’un helitron, from Choi et al., Plant Journal 2007) Choux fleur Sélection vers 1975, insertion d’un retrotransposon (Lu et al., Plant Cell 2006) Photo: www.acenologia.com insertion d’un retrotransposon (Kobayashi et al., Science 2004) -­‐ Ce sont des éléments généKques mobiles responsables de nombreuses mutaKons sélecKonnées en amélioraKon Adapté de F. Nogué Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 37. 37 PA C HIAM S ER AUP FOR TUNA B ESAR 15 MAR ONG UNKNOWN PA R OC B LUE ROSE B PI 76 R EX OR O SUPR EME KIT C HILI S AMB A original rice genome S INAWPA GH UNKNOWN Mutations C INA LA T IS A IL TEX AS R SB R GEB 24 PA TNA B LUE B ONNET PETA DGWG C P231 S LO 17 B ENONG IR 86 C P SLO 17 S IGA DIS IR 95 Inversions IR 127 IR 8 C HOW S UNG IR 262 IR 1103 TADUKAN V E LLA IKA R IR 400 T S A I Y UA N C HUNG IR 1006 MUDGO TETEP IR 1163 IR 238 TN1 IR 1416 IR 1641 IR 1402 IR 22 TKM6 IR 746A IR 1704 O. nivara IR 1870 IR 1614 IR 2006 IR 579 IR 747 IR 24/ IR 661 IR 1721 IR 773 A B PI 121 GAM PAI IR 1915 B IR 1833 GAM PA I 15 IR 1561 IR 1737 IR 1916 IR 833 IR 2040 IR 2146 IR 2055 IR 2061 IR 5236 IR 5338 Ultimate Landraces GAM PAI TSAI YUAN CHUNG IR 5657 DEE GEO WOO GEN BENONG CINA Unknow n IR 18348 LATISAIL CHOW SUNG TADUKAN MUDGO IR 64 KITCHILI SAMBA TETEP PA CHIAM SINAWPAGH SERAUPBESAR 15 UNKNOWN (JAPANESE) NAHNG MON S 4 O. nivara (IRGC 101508) VELLAIKAR MARONG PAROC C O 18 NA HNG MON S 4 NMS 4 IR 64 è Recombinations Translocation s Deletions è Accumula3on de ces muta3ons pour créer un riz cultivé Slide courtesy of Ingo Potrykus Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 38. 38 U3lisa3on de la mutagenèse La mutagenèse ar3ficielle est très u3lisée depuis le milieu du 20ème et la démonstraKon de l’héritabilité des altéraKons (mutaKons) provoquées par les radiaKons (1927), puis la diversificaKon des agents mutagènes, physique (rayons, γ, UV, X), chimiques -­‐ En 2000, + de 2200 variétés recensées par la FAO sont issues de mutagenèses ar3ficielles 1948, Begerave mutaKon monogerme (démariage inuKle) 1986 Pois proteagineux mutaKon « afila » facilitant la récolte 1930 Rose Couleur orangée ajoutée à la palege de couleurs 1984 Pamplemousse Aspermie, Couleur rouge de la pulpe 1985 Cerisier AutoferKlité 1970 Riz Qualité du grain 1976 Tournesol richesse en acide oléique 1985 Forsythia Port compact + Orge à brasserie semi-­‐nanisme (plus de 150 variétés) + Colza richesse en acide oléique. / RéducKon acide linolénique, glucosinolates -­‐ Une nouvelle méthode, le TILLING (Targeted Induced Local Lesion IN Genome) permet de faire de la « généKque réverse », c’est à dire d’idenKfier des mutants affectés dans un gène donné (dont on connaît la foncKon) et pour lequel on cherche de nouveaux allèles Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 39. 39 Conclusions • Les mutaKons sont donc à la base de l’évoluKon, de l’adaptaKon des espèces, de la domesKcaKon ou de la sélecKon. • Les données génomiques montrent que le monde vivant consKtue un pool de gènes qui évolue en permanence • La quasi unicité du code généKque permet des transferts « horizontaux » nombreux et variés -­‐ Cas des α-­‐protobactéries ⇒ Mitochondries …⇒Champignons, Animaux -­‐ Cas des cyanobactéries (photosynthéKques) ⇒ Chloroplastes ⇒ Plantes Archaea J.R. Brown (2003) Nature Reviews GeneKcs Euryarchaeota Animals Plants Slime moulds Korarchaeota Crenarchaeota Low G+C gram positives a b Thermotogales Eukaryotes Fungi Microsporidia Entamoeba Apicomplexa (such as Plasmodium) Euglena c 'Cenancestor' Kinetoplasta (such as Trypanosoma) Parabasalia (such as Trichomonas) Metamonda (such as Giardia) Mitochondrial loss Séminaire Biotechnologies -­‐ 9 et 10 février 2012 R E V I E W S Box 1 | The universal tree of life High G+C gram positives Bacteria δ/ε purples α purples γ/β purples Spirochaetes Fusobacteria Flexibacter/Bacteriodes Cyanobacteria Thermus Aquifex Putative origins of organelles Chloroplasts Mitochondria Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 In the late 1970s,Woese,Fox and co-workers15,16 pioneered the molecular systematics of prokaryotes. DENDOGRAMSbased
  • 40. 40 Le Génie Géné3que naturel d’Agrobacterium Elysia chloroMca 0,5 mm LB ADN-T simple brin VirD2 Rumpho et al, 2008, PNAS,105(46) 17867 Agrobacterium tumefaciens AttR L’arrimage de la bactérie à la cellule végétale est contrôlé par les produits de quelques gènes du chromosome bactérien Chv CelA VirG+PO 4 Gènes vir Plasmide Ti ADN-T RB Vir B VirD2 VirE2 ADN-T VirA Oses, acides organiques, phénols... Paroi végétale Cellule végétale blessée VirE2 Opine Auxine Cytokinine Cellule végétale viable et activée Membrane nucléaire Chromosome végétal ADN-T double brin Noyau végétal Chloroplaste Y. Chupeau (2001) M&S Figure 3. Un processus naturel de transfert d’ADN. Les agrobactéries ont développé la capacité d’exciser une portion d’un plasmide particulier (Ti), puis de l’exporter en l’adressant efficacement aux noyaux de cellules végé-tales. Après l’ancrage, par les produits de gènes chromosomiques, d’une agrobactérie sur la paroi d’une cellule A. rhizogenes sur Kalanchoe, INRA A. tumefaciens sur Tabac, Y. Chupeau (2001) M&S Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 41. 41 Plan • Introduc3on – Enjeux sociétaux et amélioraKon des plantes – De la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et Génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 42. 42 Bases théoriques de la transgenèse • Universalité du code génétique: • Rend possible l’utilisation de la séquence d’un gène quelle que soit son origine: plante, bactérie, animal • Existent des vecteurs de transfert de gènes • Font pénétrer un fragment d’ADN dans la cellule et le génome végétal • Biologique (agrobacteries, virus) • Physiques (biolistique, injection, électroportation), • Chimiques (PEG, liposomes) • Totipotence cellulaire : • Rend possible la régénération de plantes entières à partir d’une cellule (pas forcément nécessaires avec certains vecteurs biologiques) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 adapaté de C. PanneKer
  • 43. 43 Historique de l’ingénierie géné3que végétale A. rhizogenes sur Kalanchoe, INRA 1907, Agrobacterium tumefaciens agent de la galle du collet 1968, Transfère d’informaKon et producKon d’une opine (G. Morel) 1975, Plasmide Ti porteur du principe tumoral (Schell, Van Montagu) 1977, Transfert d’ADN du plasmide Ti dans la cellule végétale (Chilton, Nester) 1982, Plantes transformées par exploitaKon d’A. rhizogenes (Chilton, Tempé) 1983, Tabacs transgéniques résistants à un anKbioKque (Van Montagu et Schell / Bevan, Flavell and Chilton) 1984, transfert direct de gènes dans des protoplastes et régénéraKon, (Paskowski, Caboche) 1985, Premiers essais en champ de plantes transgéniques aux USA 1986, Premières plantes résistantes à un herbicide 1987/1993 TransformaKon «in planta» d’Arabidopsis (Feldman, PelleKer) 1994, 1er PGM mis sur le marché (Tomate FlavSav) Calgene 1995, Mise sur le marché de soja, maïs et coton transgénique aux USA. 1998, AutorisaKon de vente de 3 variétés de maïs en France, qui devient le premier pays européen à culKver des PGMs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 44. 44 Les étapes de la transgenèse 27 Le s é t a p e s d e l a t r a nsg é n è s e Id e n t i f i e r u n g è n e d ’ i n t é r ê t su r u n o r g a n isme d o n n e u r bact érie, plant e… Tr a nsf é r e r l e g è n e Ré g é n é r e r E v a l u e r l ’ e x p r e ssi o n d u g è n e Inco r p o r e r p a r d e s cro is eme n ts d a ns u n e v a r i é t é co m me rci a l e Tr a nsf o rma t i o n b i o l o g i q u e Tr a nsf e r t d i r e ct Iso l e r l e g è n e d ’ i n t é r ê t In t é g r e r l e g è n e d ’ i n t é r ê t d a ns u n e co nst r uct i o n g é n é t i q u e Mu l t i p l i e r l a co nst r uct i o n g é n é t i q u e microparticules Agrobact erium enrobé es d’ADN Sé l e ct i o n d e s c e l l u l e s t r a nsf o rmé e s Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Source : GNIS
  • 45. www.labomics.com Grizot et al. (2010) NAR 45 Limita3on de la transgénèse Le site d’inserKon dans le génome reste aléatoire (effet de posiKon sur l’expression du transgène ou créaKon de mutaKons). Les évènements de transformaKon sont donc parfois similaires à des mutaKons «classiques». Il serait uKle de pouvoir cibler les modificaKons Des technologies d’ingénierie moléculaires sont en cours de développement Les Nucléases à domaine en doigt de Zn (ZFNs) Les Méganucléases Les protéines TALEs (TranscripKon AcKvator-­‐Like Effectors) M. Mahfouz and L. Li (2012) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Figure 1. Representation of TALEs structural features and the possible functional domains to generate
  • 46. Les domaines d’application de la transgénèse L’agronomie • La résistance à des insectes • La résistance à des maladies • La résistance à des herbicides L’alimentation • Les qualités nutritionnelles • La maturation des fruits • La transformation agro-alimentaire L’industrie Les applications de la transgénèse • Les pâtes à papier • Les huiles industrielles • Les colorants La santé • Les produits sanguins • Les vaccins • Les protéines humaines Cf Ho‡e H. 36 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 46
  • 47. 47 ApplicaKons agronomiques : Les maladies et les ravageurs => +25% pertes des récoltes Wheat infected with wheat stem rust Puccinia graminis And from G. PelleKer Fusarium sur blé Oomycetes Bacteria Insects Wheat infected with root Fungi knot nematode Epi de maïs Infecté Larve de Pyrale par Fusarium Tige de maïs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 48. 48 Jaunisse nanisante (orge) PLRV, P de terre Les stratégies an3virales sont parmi les premiers exemples de plantes transgéniques (1986) Une stratégie générale consiste à acKver les mécanismes de contrôle des virus en faisant produire à la plante transgénique des porKons du génome du virus, comme le gène codant l’enveloppe de ce virus Premier essai en champs, 1987, résistance à un virus de la Tomate From G. PelleKer Coat Protein Mediated Resistance 1986, From R. Beachy Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 49. Autre exemple, les résistances aux insectes Très peu de solu3on conven3onnelle (ex. Résistance aux pucerons chez le melon. Limité à 49 cege espèce) Solu3ons transgéniques existent -­‐ ProducKon par la plante d’une protéine de B. thuringiensis toxique pour les larves de lépidoptères. From G. PelleKer and R. Beachy Pyrale du maïs Rem ProtecKon simultanée contre les mycotoxines de fusarium (surinfecKon) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 50. 50 Résistance / tolérance aux stress abio3ques -­‐ Tolérance aux métaux toxiques -­‐ Stress hydrique, de nombreux gènes candidats testés Tomates résistantes au sel (200 mM NaCl) Surexpression d’un anKport Na+ Concentre le Na+ dans la vacuole Zhang& Blumwald -­‐ Nature Biotech, 2001 transgéniques WT Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 51. 51 Améliorera3on de la qualité La qualité industrielle ou nutri3onnelle -­‐ AugmentaKon de la teneur en huile de la graine (+40%) de colza, par sur-­‐expression d’une glycérol 3P deshydrogénase de levure, Vigeolas et al. 2007, Plant Biotech J.) -­‐ Doublement de la teneur en sucre de la canne à sucre par expression d’une isomérase bactérienne qui transforme le saccharose en iso-­‐ maltulose qui se trouve séquestré, Shiromani et al., 2011, Plant Biotech J.) -­‐ L’adaptaKon de la biomasse lignocellulosique à ses usages (cf. H. H.) -­‐ La modificaKon de la structure de l’amidon (cf. S. B.) -­‐ Autres -­‐ ModificaKon de la nature et de quanKté d’acides gras… -­‐ producKon de flavonoïdes chez le riz -­‐ inhibiKon des allergènes de tomate -­‐ riz riche en provitamine A (riz doré) -­‐ Maïs enrichi en lysine et tryptophane (par sélecKon ou transgénèse) … Wild-type (top) and antioxidant-enriched tomatoes β-carotene makes the rice look golden Iron-enriched rice Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 52. Figure 2 Carotenoid enhancement endosperm by transformation and crtI. (a) Schematic used to generate transgenic T-DNA comprised the rice (Glu) and the first intron gene from castor bean functionally fused to the chloroplast transit peptide phytoene synthase from species (psy), with a nos selectable marker cassette maize polyubiquitin (Ubi1) Lepiniec hygromycin resistance 52 (b) Photograph of polished Enrichissement du riz en provitamine A : le riz doré Expression de 2 gènes, Psy de maïs et crt1 d’Erwinia (Paine et al. 2005) -­‐ Introgression en cours dans des variétés culKvées et première dérégulaKon agendue aux Philippines en 2012/2013. LB SSUcrtI nos Glu Psy nos nos I Ubi1 hpt Adapté de E. Guiderdoni Wild Type Np Psy/crtI Zm Psy/crtI L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 53. Research in Cologne. In Amflora, the gene encoding the key enzyme for the synthesis of amylose, the granule bound starch synthase (GBSS), was switched off using the so-called antisense method through which a mirrored copy of the GBSS gene was reinserted into the genome of the potato. Starch Potato 20% > 98% Amylose 2010-03-30 page 5 of Apart from the intended change in the composition of its starch, Amflora maintains all the 53 Autre exemple d’applica3on industrielle Pomme de Terre produisant Uniquement de l’amylopecKne (AmfloraTM, BASF, InacKvaKon de la Granule Bound Starch Synthase) Ø Iitérêts industrielles : Ø Epaississant (amidon de haut poids moléculaire, de faibles teneurs en lipide et protéines), transparent,, bonne solubilité, characteristics of its mother variety, the starch potato variety Prevalent. Ø Papier, adhésifs, texKles, construcKon, cosméKques Amflora Starch potato Potato starch Content 100% Amylopec3n 80% Amylopectin Amylopectin Switched off gene for key enzyme of amylose synthesis Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 54. 54 Le développement du “molecular farming” Nombre de producKon de protéines pour la santé et l’industrie Lo ̈ıc Faye and Veronique Gomord (2010) Plant Biotechnology Journal Volume 8, Issue 5, pages 525-­‐528, Publishing activity in molecular farming classified per product (original papers). *From January to August 2009. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 55. 55 Bilan: les OGM dans le monde (2011) -­‐ 160 millions d’hectares d’OGM culKvées (+ 10% surfaces culKvées mondiales, + 8% /2010), -­‐ 29 Pays au total, 50% dans les PED . USA (69 millions ha), Brésil (30), ArgenKne (24), Inde (11), Canada (10), Chine (4), Paraguay (3), Pakistan (3) Afrique du Sud (2 millions) -­‐ La Chine invesKt 2,4 milliards d’euros sur 12 ans dans un programme massif «OGM» C. James ISAAA 2012 Source ISAAA 2011 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 56. 56 11 plantes cul3vées en 2011, -­‐ 4 principales soja (75% en PGM), coton (82 %), maize (32%), colza (26%), -­‐ mais aussi la begerave sucrière, luzerne, Papaye, courge, peuplier, poivron doux, tomate, pomme de terre, + riz en cours et 26 espèces avec des évènements approuvés Global Area of Biotech Crops, 1996 to 2011: Crop (Million Hectares, Million Acres) Global Area of Biotech Crops, 1996 to 2011: By Crop (Million Hectares, Million Acres) Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Surfaces culKvées en Millions hectares I S A A A 80 70 198 173 60 148 50 124 40 99 30 74 20 49 10 25 0 Soybean Maize Cotton Canola I S A A A 80 70 60 50 40 30 20 10 2009 2010 2011 Soybean Maize Cotton Canola 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 Acres Source: Clive James, 2012 I S A A A 0 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 M Acres 0 Source: Clive James, 2012
  • 57. 57 Conclusions -­‐ Les espèces évoluent conKnuellement et les hommes ont mis à profit cege variabilité pour adapter les végétaux culKvés à leurs besoins. Il sera toujours nécessaire d’améliorer les plantes pour répondre à l’évoluKon des contraintes bioKques par exemple (maladies, prédateurs) et assurer des rendements minimum. De nouveaux objec3fs de qualité et de durabilité s’y ajoutent. -­‐ Les méthodes classiques de sélec3on restent nécessaires, en parKculier pour les caractères quanKtaKfs et mulKgéniques. Le développement de la génomique facilite et augmente la puissance de ces approches et ouvre de nouvelles perspec3ves de sélec3on « génomique ». -­‐ Les biotechnologies permegent d’élargir la base géné3que u3lisable (ex gènes bactériens ou de levures) et, en faisant progresser les connaissances, d’envisager une véritable ingénierie géné3que. Elles permegent également de réduire considérablement le temps d’introgression des caractères d’intérêt dans de nombreuses variétés localement adaptées . -­‐ Les biotechnologies ne modifient pas les contraintes classiques qui s’imposent à l’amélioraKon des plantes et à l’agriculture (mainKen de la biodiversité, appariKons de résistances aux herbicides, maladies, prédateurs ou d’effets non agendus). Mais elles offrent des ouKls supplémentaires pour y répondre. -­‐ Que cela soit pour l’amélioraKon convenKonnelle ou reposant sur les biotechnologies, la disponibilité/diffusion des ressources géné3ques reste un facteur clef et stratégique. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  • 58. 58 Remerciements • P. Colonna • M. Caboche • Y. Chupeau • M. Jullien • G. Pelletier • A. Bendahmane • B. Chaloub • B. Dubreucq • E. Guiderdoni • F. Nogué • C. Pannetier • M. Tepfer • collègues du laboratoire • INRA • J. Tempé • M.D. Chilton • M. Van Montagu • J. Schell • R. Beachy • GNIS (J. Greffier) • The Plant Cell • www.wikimedia.org Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012