SlideShare une entreprise Scribd logo
1  sur  77
Télécharger pour lire hors ligne
Les OGM


5 décembre 2008




Nicole Mounier

Université Claude Bernard Lyon 1
CGMC, bâtiment Gregor Mendel
43, boulevard du 11 Novembre 1918
69622 Villeurbanne Cedex
OGM
Organismes Génétiquement Modifiés

Transfert de gènes

      Bactéries

      Eucaryotes
           Microorganismes
           Animaux
           Végétaux

Transfert nucléaire
Rappels
Comment fonctionne un gène ?
Comment manipuler l’ADN et les gènes ?

Effet attendu au niveau du produit du gène dans
      la cellule
      l’organisme
      la population d’organisme




        Les outils enzymatiques

        Couper, copier, coller l’ADN
Couper un ADN
       par une enzyme de restriction


5’ ATCGCGTAACGTATTCGAATTCTTCAGGCTAAGCTA 3’
3’ TAGCGCATTGCATAAGCTTAAGAAGTCCGATTCGAT 5’


5’ ATCGCGTAACGTATTCGAATTCTTCAGGCTAAGCTA 3’
3’ TAGCGCATTGCATAAGCTTAAGAAGTCCGATTCGAT 5’


5’ ATCGCGTAACGTATTCG         AATTCTTCAGGCTAA
3’ TAGCGCATTGCATAAGCTTAA         GAAGTCCGATT
Copier, recopier un ADN
grâce à une ADN polymérase
Coller deux fragments d’ADN




5’... TCGCATCACG           AATTCCGATCA ...3’
3’... AGCGTAGTGCTTAA           GGCTAGT ...5’


                          + ADN ligase

 5’... TCGCATCACGAATTCCGATCA ... 3’
 3’... AGCGTAGTGCTTAAGGCTAGT ... 5’
Hybridation moléculaire
Sonde
Le clonage
Comment cloner un fragment d’ADN ?
Bactérie transformée

                 =

                OGM
Protéines produites par des bactéries
génétiquement modifiées :

Insuline
Hormone de croissance
Erythropoïétine
Facteur VIII
Interféron gamma
Facteurs de croissance
Activateur tissulaire du plasminogène
Interleukine-2
…
Enzymes impliquées dans
     la fromagerie
     la boulangerie
     la pâtisserie

      la dégradation des graisses
      le blanchiment du papier, des textiles
      la dépollution

      la manipulation de l’ADN
            Taq polymérase
            séquenase
Transfert de gènes

         chez les eucaryotes




Transfert de gènes dans des cellules en culture

                      =

                 transfection
Expression du gène transfecté




Clones cellulaires
Analyse de l’ARNm, ou de la protéine,
ou de l’effet sur la cellule
Transgènes

-  gène d’intérêt, avec ou non
ses propres séquences régulatrices

- gène rapporteur
      CAT
      lacZ
      GFP
      luciférase
Vecteur d’expression : un exemple
Méthodes

     chimiques
     biologiques
     mécaniques
Phosphate de calcium
liposomes
Vecteurs viraux
      SV40
      adenovirus
      virus Herpès
      retrovirus

      baculovirus
      …
électroporation
Canon à
particules
Micro injection dans le noyau
Expression transitoire

ou expression stable

du gène transfecté




                     Expression du gène transfecté




                                 Clones cellulaires
Fibroblastes
24h après transfection
Application

correction génique
(SCID)-X1
Severe Combined ImmunoDeficiency
liée à X

Avril 2000
Hôpital Necker
sur 630 essais de thérapie génique (somatique) :
Thérapie génique
(somatique)
      ex vivo
      in vivo
      in situ


Beaucoup d’espoir
Peu de réussite à ce jour …
Transgenèse
               =
      Transfert d’un gène
dans un organisme pluricellulaire
Transgenèse
                   =
          Transfert d’un gène
    dans un organisme pluricellulaire

Organismes génétiquement modifiés OGM

               Bactéries
                Levures
               Animaux
                    mammifères
                    oiseaux
                    poissons …
                Plantes
Exemple : chez la souris

Transfert de gènes : souris transgéniques
1982
Animaux transgéniques

-  Amélioration

-  « bioréacteurs »

-  Xénogreffes

-  Lutte contre certaines pandémies

- Modèle animal pour étude des maladies humaines
production de molécules
      à intérêt
      pharmaceutique
      industriel
Janvier 2007
Poules transgéniques

Transgène sur-exprimé dans le blanc d’oeuf
-  interféron
- un anticancéreux potentiel
Transgenèse
par transformation
de cellules souches embryonnaires
The Nobel Prize in Physiology or Medicine 2007


"for their discoveries of principles for introducing specific gene
modifications in mice by the use of embryonic stem cells"




 Mario R. Capecchi     Sir Martin J. Evans     Oliver Smithies

 1/3 of the prize    1/3 of the prize        1/3 of the prize

 USA                United    Kingdom             USA
Fécondation
Développement embryonnaire
Invalidation ciblée de gène

Construction d’une version invalidée
du gène d’intérêt dans un vecteur de ciblage

Intégration du gène invalidé
à la place du gène « normal » dans les cellules ES:
        - Transformation des cellules ES avec le vecteur
        de ciblage contenant le gène invalidé
        - Sélection des cellules ES knock out (KO) pour
        le gène d’intérêt

Injection des cellules ES KO dans un blastocyste et
implantation dans une souris receveuse

Souris KO pour le gène d’intérêt
Obtention de cellules ES recombinées
(par ciblage génétique, recombinaison homologue)
Injection des cellules ES KO dans un blastocyste et
implantation dans une souris receveuse
KO conditionnels



 Knock out

 et

 Knock in
Transgenèse chez la drosophile

Transposon : élément P
Transgenèse chez les plantes

Protoplastes
Canon à particules
Plasmide Ti d’Agrobacterium tumefaciens
Plasmide Ti
(Tumor inducing)

- 206 kb
- 196 gènes
- ADN-T :
transfert
Interaction plante-Agrobacterium
Si blessure, induction de l’expression des gènes vir.
Les protèines vir excisent l’ADN-T (= brin T) qui est transféré dans la plante
Résistance   aux herbicides
             aux insectes nuisibles

Amélioration nutritionnelle

Production de molécules à usage thérapeutique
USA : 2/3 de la production mondiale
Riz doré

produit
du beta-carotène
(précurseur de
la vitamine A)
Risques




http://www.ogm.gouv.fr
http://www.ogm.gouv.fr
Clonage par transfert nucléaire
1997
Clonage reproductif

Clonage thérapeutique

Interdit en France
(chez l’homme)

Contenu connexe

Tendances

Génie génétique
Génie génétiqueGénie génétique
Génie génétiquePierreComeau
 
Greenpeace Rapport - La bombe OGM
Greenpeace Rapport - La bombe OGMGreenpeace Rapport - La bombe OGM
Greenpeace Rapport - La bombe OGMSERGE ROMAN
 
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...Pôle Qualiméditerranée
 
Biotechnologies végétales
Biotechnologies végétalesBiotechnologies végétales
Biotechnologies végétalesLoïc Lepiniec
 
Amélioration des Plantes par les Biotechnologies.pdf
Amélioration des Plantes par les Biotechnologies.pdfAmélioration des Plantes par les Biotechnologies.pdf
Amélioration des Plantes par les Biotechnologies.pdfMOHAMED SLIM
 
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdf
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdfEsposé de Elisée le Jeune Informaticien sur La Transgénèse.pdf
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdfElisée Samuel SOHOUNGBLE
 
Tp 25 la domestication des plantes, exemple du maïs
Tp 25  la domestication des plantes, exemple du maïsTp 25  la domestication des plantes, exemple du maïs
Tp 25 la domestication des plantes, exemple du maïsJef Chouzier
 
Chapitre 01 amélioration génétique
Chapitre 01 amélioration génétiqueChapitre 01 amélioration génétique
Chapitre 01 amélioration génétiqueSELLANI Halima
 
Culture in vitro des plantes
Culture in vitro des plantesCulture in vitro des plantes
Culture in vitro des plantesAhmed Dellaa
 
7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetauxzakaria2008
 
Production des anticorps monoclonaux
Production des anticorps monoclonauxProduction des anticorps monoclonaux
Production des anticorps monoclonauxAsmae LGUENSAT
 
Presentation ifoam - 2014
Presentation   ifoam - 2014Presentation   ifoam - 2014
Presentation ifoam - 2014PABE BENIN
 
Chapitre 04 fécondation in vetro
Chapitre 04 fécondation in vetroChapitre 04 fécondation in vetro
Chapitre 04 fécondation in vetroSELLANI Halima
 

Tendances (19)

Génie génétique
Génie génétiqueGénie génétique
Génie génétique
 
Greenpeace Rapport - La bombe OGM
Greenpeace Rapport - La bombe OGMGreenpeace Rapport - La bombe OGM
Greenpeace Rapport - La bombe OGM
 
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...
Les outils de la biologie moléculaire appliqués à la recherche d’OGM. Authent...
 
Biotechnologies végétales
Biotechnologies végétalesBiotechnologies végétales
Biotechnologies végétales
 
Amélioration des Plantes par les Biotechnologies.pdf
Amélioration des Plantes par les Biotechnologies.pdfAmélioration des Plantes par les Biotechnologies.pdf
Amélioration des Plantes par les Biotechnologies.pdf
 
Esposé samuel sur la transgénèse.pdf
Esposé samuel sur la transgénèse.pdfEsposé samuel sur la transgénèse.pdf
Esposé samuel sur la transgénèse.pdf
 
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdf
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdfEsposé de Elisée le Jeune Informaticien sur La Transgénèse.pdf
Esposé de Elisée le Jeune Informaticien sur La Transgénèse.pdf
 
Tp 25 la domestication des plantes, exemple du maïs
Tp 25  la domestication des plantes, exemple du maïsTp 25  la domestication des plantes, exemple du maïs
Tp 25 la domestication des plantes, exemple du maïs
 
Chapitre 01 amélioration génétique
Chapitre 01 amélioration génétiqueChapitre 01 amélioration génétique
Chapitre 01 amélioration génétique
 
Culture in vitro des plantes
Culture in vitro des plantesCulture in vitro des plantes
Culture in vitro des plantes
 
tous sur les anticorps monoclonaux
tous sur les anticorps monoclonauxtous sur les anticorps monoclonaux
tous sur les anticorps monoclonaux
 
7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux7.1 la multiplication_vegetative_des_vegetaux
7.1 la multiplication_vegetative_des_vegetaux
 
Production des anticorps monoclonaux
Production des anticorps monoclonauxProduction des anticorps monoclonaux
Production des anticorps monoclonaux
 
Presentation ifoam - 2014
Presentation   ifoam - 2014Presentation   ifoam - 2014
Presentation ifoam - 2014
 
La callogenèse
La callogenèseLa callogenèse
La callogenèse
 
Chapitre 04 fécondation in vetro
Chapitre 04 fécondation in vetroChapitre 04 fécondation in vetro
Chapitre 04 fécondation in vetro
 
La Bactériologie
La BactériologieLa Bactériologie
La Bactériologie
 
anticorps monoclonaux
anticorps monoclonauxanticorps monoclonaux
anticorps monoclonaux
 
Acs polyclonaux et monoclonaux master 2014
Acs polyclonaux et monoclonaux master 2014Acs polyclonaux et monoclonaux master 2014
Acs polyclonaux et monoclonaux master 2014
 

Similaire à Conference OGM Mounier

ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretvguili
 
souris transgéniques10000000000000000000
souris transgéniques10000000000000000000souris transgéniques10000000000000000000
souris transgéniques10000000000000000000hibasadiki377
 
Oncogene & oncogenese
Oncogene & oncogeneseOncogene & oncogenese
Oncogene & oncogenesehind henzazi
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinantetutankanson
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinantetutankanson
 
Signalisation cellulaire
Signalisation cellulaireSignalisation cellulaire
Signalisation cellulaireARICHI Bouchra
 
Biotec06_final (1).ppt
Biotec06_final (1).pptBiotec06_final (1).ppt
Biotec06_final (1).pptMounirSaggai1
 
Le processus de_cancerisation_
Le processus de_cancerisation_Le processus de_cancerisation_
Le processus de_cancerisation_Karol Aguilar
 
Agents transmissibles non conventionnels Prions Alger.ppsx
Agents transmissibles non conventionnels Prions Alger.ppsxAgents transmissibles non conventionnels Prions Alger.ppsx
Agents transmissibles non conventionnels Prions Alger.ppsxSamirMeddoura1
 
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Claire Nedellec
 
How fat stem cells could or not form muscle cells (French)
How fat stem cells could or not form muscle cells (French)How fat stem cells could or not form muscle cells (French)
How fat stem cells could or not form muscle cells (French)Ari Massoudi
 
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Institut Pasteur de Madagascar
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeMiraj Microbio
 
Anticorps thérapeutiques
Anticorps thérapeutiquesAnticorps thérapeutiques
Anticorps thérapeutiquesSofia Azirar
 
M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009Elsa von Licy
 
ConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyvguili
 

Similaire à Conference OGM Mounier (20)

Esposé samuel sur la transgénèse.pdf
Esposé samuel sur la transgénèse.pdfEsposé samuel sur la transgénèse.pdf
Esposé samuel sur la transgénèse.pdf
 
ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuret
 
souris transgéniques10000000000000000000
souris transgéniques10000000000000000000souris transgéniques10000000000000000000
souris transgéniques10000000000000000000
 
Oncogene & oncogenese
Oncogene & oncogeneseOncogene & oncogenese
Oncogene & oncogenese
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinante
 
Expression d'une protéine recombinante
Expression d'une protéine recombinanteExpression d'une protéine recombinante
Expression d'une protéine recombinante
 
Signalisation cellulaire
Signalisation cellulaireSignalisation cellulaire
Signalisation cellulaire
 
Biotec06_final (1).ppt
Biotec06_final (1).pptBiotec06_final (1).ppt
Biotec06_final (1).ppt
 
Le processus de_cancerisation_
Le processus de_cancerisation_Le processus de_cancerisation_
Le processus de_cancerisation_
 
Agents transmissibles non conventionnels Prions Alger.ppsx
Agents transmissibles non conventionnels Prions Alger.ppsxAgents transmissibles non conventionnels Prions Alger.ppsx
Agents transmissibles non conventionnels Prions Alger.ppsx
 
Caractérisation de chitinases chez les nématodes
Caractérisation de chitinases chez les nématodesCaractérisation de chitinases chez les nématodes
Caractérisation de chitinases chez les nématodes
 
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
 
UMTeBIS_conf - 20221013 - 2_Genomes.pptx
UMTeBIS_conf - 20221013 - 2_Genomes.pptxUMTeBIS_conf - 20221013 - 2_Genomes.pptx
UMTeBIS_conf - 20221013 - 2_Genomes.pptx
 
How fat stem cells could or not form muscle cells (French)
How fat stem cells could or not form muscle cells (French)How fat stem cells could or not form muscle cells (French)
How fat stem cells could or not form muscle cells (French)
 
Cellules animales
Cellules animalesCellules animales
Cellules animales
 
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
 
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
 
Anticorps thérapeutiques
Anticorps thérapeutiquesAnticorps thérapeutiques
Anticorps thérapeutiques
 
M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009M krahn organisation_genome_et_analyses_genomiques_2009
M krahn organisation_genome_et_analyses_genomiques_2009
 
ConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouy
 

Plus de vguili

Présentation de la spécialité SVT pour les secondes
Présentation de la spécialité SVT pour les secondesPrésentation de la spécialité SVT pour les secondes
Présentation de la spécialité SVT pour les secondesvguili
 
Choix de la specialité SVT en seconde
Choix de la specialité SVT en secondeChoix de la specialité SVT en seconde
Choix de la specialité SVT en secondevguili
 
Etudes à l’université - académie de Lyon
Etudes à l’université - académie de LyonEtudes à l’université - académie de Lyon
Etudes à l’université - académie de Lyonvguili
 
Formations professionalisantes - académie Lyon
Formations professionalisantes - académie LyonFormations professionalisantes - académie Lyon
Formations professionalisantes - académie Lyonvguili
 
Vensim - presentation modelisation pinsons
Vensim - presentation modelisation pinsonsVensim - presentation modelisation pinsons
Vensim - presentation modelisation pinsonsvguili
 
Risque securite svt 2015
Risque securite svt 2015Risque securite svt 2015
Risque securite svt 2015vguili
 
Sortie géologique briançonnais
Sortie géologique briançonnaisSortie géologique briançonnais
Sortie géologique briançonnaisvguili
 
2015 luis cours metagenomique
2015 luis cours metagenomique2015 luis cours metagenomique
2015 luis cours metagenomiquevguili
 
Conf biodiversité michalet
Conf biodiversité michaletConf biodiversité michalet
Conf biodiversité michaletvguili
 
Presentation programme 1ere S SVT
Presentation programme 1ere S SVTPresentation programme 1ere S SVT
Presentation programme 1ere S SVTvguili
 
Ens les ppt presentation2012
Ens les ppt presentation2012Ens les ppt presentation2012
Ens les ppt presentation2012vguili
 
Bilan semaine éco citoyenne 2011
Bilan semaine éco citoyenne 2011Bilan semaine éco citoyenne 2011
Bilan semaine éco citoyenne 2011vguili
 
Livret personnel de compétences. information aux parents
Livret personnel de compétences. information aux parentsLivret personnel de compétences. information aux parents
Livret personnel de compétences. information aux parentsvguili
 
Diaporama3 tâche complexe jd-ijan2011
Diaporama3 tâche complexe jd-ijan2011Diaporama3 tâche complexe jd-ijan2011
Diaporama3 tâche complexe jd-ijan2011vguili
 
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11vguili
 
Diaporama1 socle sciences&techno-jd_ijan11
Diaporama1 socle sciences&techno-jd_ijan11Diaporama1 socle sciences&techno-jd_ijan11
Diaporama1 socle sciences&techno-jd_ijan11vguili
 
Brochure P2S
Brochure P2SBrochure P2S
Brochure P2Svguili
 
Formation spip st ex
Formation spip st exFormation spip st ex
Formation spip st exvguili
 
Vensim presentation modelisation-pinsons
Vensim   presentation modelisation-pinsonsVensim   presentation modelisation-pinsons
Vensim presentation modelisation-pinsonsvguili
 
Energie modelisation
Energie modelisationEnergie modelisation
Energie modelisationvguili
 

Plus de vguili (20)

Présentation de la spécialité SVT pour les secondes
Présentation de la spécialité SVT pour les secondesPrésentation de la spécialité SVT pour les secondes
Présentation de la spécialité SVT pour les secondes
 
Choix de la specialité SVT en seconde
Choix de la specialité SVT en secondeChoix de la specialité SVT en seconde
Choix de la specialité SVT en seconde
 
Etudes à l’université - académie de Lyon
Etudes à l’université - académie de LyonEtudes à l’université - académie de Lyon
Etudes à l’université - académie de Lyon
 
Formations professionalisantes - académie Lyon
Formations professionalisantes - académie LyonFormations professionalisantes - académie Lyon
Formations professionalisantes - académie Lyon
 
Vensim - presentation modelisation pinsons
Vensim - presentation modelisation pinsonsVensim - presentation modelisation pinsons
Vensim - presentation modelisation pinsons
 
Risque securite svt 2015
Risque securite svt 2015Risque securite svt 2015
Risque securite svt 2015
 
Sortie géologique briançonnais
Sortie géologique briançonnaisSortie géologique briançonnais
Sortie géologique briançonnais
 
2015 luis cours metagenomique
2015 luis cours metagenomique2015 luis cours metagenomique
2015 luis cours metagenomique
 
Conf biodiversité michalet
Conf biodiversité michaletConf biodiversité michalet
Conf biodiversité michalet
 
Presentation programme 1ere S SVT
Presentation programme 1ere S SVTPresentation programme 1ere S SVT
Presentation programme 1ere S SVT
 
Ens les ppt presentation2012
Ens les ppt presentation2012Ens les ppt presentation2012
Ens les ppt presentation2012
 
Bilan semaine éco citoyenne 2011
Bilan semaine éco citoyenne 2011Bilan semaine éco citoyenne 2011
Bilan semaine éco citoyenne 2011
 
Livret personnel de compétences. information aux parents
Livret personnel de compétences. information aux parentsLivret personnel de compétences. information aux parents
Livret personnel de compétences. information aux parents
 
Diaporama3 tâche complexe jd-ijan2011
Diaporama3 tâche complexe jd-ijan2011Diaporama3 tâche complexe jd-ijan2011
Diaporama3 tâche complexe jd-ijan2011
 
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11
Diaporama2 miseen oeuvre-ateliers-socle-jd_ijan11
 
Diaporama1 socle sciences&techno-jd_ijan11
Diaporama1 socle sciences&techno-jd_ijan11Diaporama1 socle sciences&techno-jd_ijan11
Diaporama1 socle sciences&techno-jd_ijan11
 
Brochure P2S
Brochure P2SBrochure P2S
Brochure P2S
 
Formation spip st ex
Formation spip st exFormation spip st ex
Formation spip st ex
 
Vensim presentation modelisation-pinsons
Vensim   presentation modelisation-pinsonsVensim   presentation modelisation-pinsons
Vensim presentation modelisation-pinsons
 
Energie modelisation
Energie modelisationEnergie modelisation
Energie modelisation
 

Dernier

PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024
PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024
PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024frizzole
 
Les débuts de la collection "Le livre de poche"
Les débuts de la collection "Le livre de poche"Les débuts de la collection "Le livre de poche"
Les débuts de la collection "Le livre de poche"ArchivesdeLyon
 
PowerPoint-de-Soutenance-de-TFE-infirmier.pdf
PowerPoint-de-Soutenance-de-TFE-infirmier.pdfPowerPoint-de-Soutenance-de-TFE-infirmier.pdf
PowerPoint-de-Soutenance-de-TFE-infirmier.pdfDafWafia
 
Nathanaëlle Herbelin.pptx Peintre française
Nathanaëlle Herbelin.pptx Peintre françaiseNathanaëlle Herbelin.pptx Peintre française
Nathanaëlle Herbelin.pptx Peintre françaiseTxaruka
 
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptx
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptxGHASSOUB _Seance 4_ measurement and evaluation in education_-.pptx
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptxAbderrahim GHASSOUB
 
rapport de stage gros oeuvre_compressed.pdf
rapport de stage gros oeuvre_compressed.pdfrapport de stage gros oeuvre_compressed.pdf
rapport de stage gros oeuvre_compressed.pdfOssamaLachheb
 
Réunion des directeurs de Jonzac - 15 mai 2024
Réunion des directeurs de Jonzac - 15 mai 2024Réunion des directeurs de Jonzac - 15 mai 2024
Réunion des directeurs de Jonzac - 15 mai 2024IEN_Jonzac
 
Quitter la nuit. pptx
Quitter          la        nuit.    pptxQuitter          la        nuit.    pptx
Quitter la nuit. pptxTxaruka
 
Fiche de vocabulaire pour faire une appréciation
Fiche de vocabulaire pour faire une appréciationFiche de vocabulaire pour faire une appréciation
Fiche de vocabulaire pour faire une appréciationLeBaobabBleu1
 
Àma Gloria.pptx Un film tourné au Cap Vert et en France
Àma Gloria.pptx   Un film tourné au Cap Vert et en FranceÀma Gloria.pptx   Un film tourné au Cap Vert et en France
Àma Gloria.pptx Un film tourné au Cap Vert et en FranceTxaruka
 
Quitter la nuit. pptx
Quitter        la             nuit.   pptxQuitter        la             nuit.   pptx
Quitter la nuit. pptxTxaruka
 
GHASSOUB _Seance 3_ measurement and evaluation in education.pptx
GHASSOUB _Seance 3_ measurement and evaluation in education.pptxGHASSOUB _Seance 3_ measurement and evaluation in education.pptx
GHASSOUB _Seance 3_ measurement and evaluation in education.pptxAbderrahim GHASSOUB
 
Texte avec différentes critiques positives, négatives ou mitigées
Texte avec différentes critiques positives, négatives ou mitigéesTexte avec différentes critiques positives, négatives ou mitigées
Texte avec différentes critiques positives, négatives ou mitigéesLeBaobabBleu1
 
Un petit coin etwinning- Au fil des cultures urbaines
Un petit coin  etwinning- Au fil des cultures urbainesUn petit coin  etwinning- Au fil des cultures urbaines
Un petit coin etwinning- Au fil des cultures urbainesSocratis Vasiopoulos
 
Exemple de grille d'audit 5S, check liste Audit
Exemple de grille d'audit 5S, check liste AuditExemple de grille d'audit 5S, check liste Audit
Exemple de grille d'audit 5S, check liste Audittechwinconsulting
 

Dernier (15)

PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024
PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024
PLANNING HEBDO ET CR LYCEE COUDON 21 MAI2024
 
Les débuts de la collection "Le livre de poche"
Les débuts de la collection "Le livre de poche"Les débuts de la collection "Le livre de poche"
Les débuts de la collection "Le livre de poche"
 
PowerPoint-de-Soutenance-de-TFE-infirmier.pdf
PowerPoint-de-Soutenance-de-TFE-infirmier.pdfPowerPoint-de-Soutenance-de-TFE-infirmier.pdf
PowerPoint-de-Soutenance-de-TFE-infirmier.pdf
 
Nathanaëlle Herbelin.pptx Peintre française
Nathanaëlle Herbelin.pptx Peintre françaiseNathanaëlle Herbelin.pptx Peintre française
Nathanaëlle Herbelin.pptx Peintre française
 
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptx
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptxGHASSOUB _Seance 4_ measurement and evaluation in education_-.pptx
GHASSOUB _Seance 4_ measurement and evaluation in education_-.pptx
 
rapport de stage gros oeuvre_compressed.pdf
rapport de stage gros oeuvre_compressed.pdfrapport de stage gros oeuvre_compressed.pdf
rapport de stage gros oeuvre_compressed.pdf
 
Réunion des directeurs de Jonzac - 15 mai 2024
Réunion des directeurs de Jonzac - 15 mai 2024Réunion des directeurs de Jonzac - 15 mai 2024
Réunion des directeurs de Jonzac - 15 mai 2024
 
Quitter la nuit. pptx
Quitter          la        nuit.    pptxQuitter          la        nuit.    pptx
Quitter la nuit. pptx
 
Fiche de vocabulaire pour faire une appréciation
Fiche de vocabulaire pour faire une appréciationFiche de vocabulaire pour faire une appréciation
Fiche de vocabulaire pour faire une appréciation
 
Àma Gloria.pptx Un film tourné au Cap Vert et en France
Àma Gloria.pptx   Un film tourné au Cap Vert et en FranceÀma Gloria.pptx   Un film tourné au Cap Vert et en France
Àma Gloria.pptx Un film tourné au Cap Vert et en France
 
Quitter la nuit. pptx
Quitter        la             nuit.   pptxQuitter        la             nuit.   pptx
Quitter la nuit. pptx
 
GHASSOUB _Seance 3_ measurement and evaluation in education.pptx
GHASSOUB _Seance 3_ measurement and evaluation in education.pptxGHASSOUB _Seance 3_ measurement and evaluation in education.pptx
GHASSOUB _Seance 3_ measurement and evaluation in education.pptx
 
Texte avec différentes critiques positives, négatives ou mitigées
Texte avec différentes critiques positives, négatives ou mitigéesTexte avec différentes critiques positives, négatives ou mitigées
Texte avec différentes critiques positives, négatives ou mitigées
 
Un petit coin etwinning- Au fil des cultures urbaines
Un petit coin  etwinning- Au fil des cultures urbainesUn petit coin  etwinning- Au fil des cultures urbaines
Un petit coin etwinning- Au fil des cultures urbaines
 
Exemple de grille d'audit 5S, check liste Audit
Exemple de grille d'audit 5S, check liste AuditExemple de grille d'audit 5S, check liste Audit
Exemple de grille d'audit 5S, check liste Audit
 

Conference OGM Mounier