Les processus de l'évolution  La vie grâce aux mutations !  Laurent Duret Laboratoire de Biométrie et Biologie Evolutive, ...
Qu’est-ce que la vie? C arbure silicium Champignon A lgue rouge D épots sel cuivrique Cristaux de glace Corail
Qu’est-ce que la vie? Cristaux de glace Lithoptera mulleri  (plancton)  Diatomée (microalgue)  Cristaux de carbonate de ca...
Propriétés fondamentales des organismes vivants <ul><li>Reproduction : créer de façon autonome d'autres entités similaires...
Les processus de l'évolution <ul><li>Diversité et unicité du vivant </li></ul><ul><li>Nature et causes des mutations </li>...
La diversité du monde vivant
La diversité du monde vivant
Unicité du monde vivant <ul><li>La cellule: unité de base des organismes vivants </li></ul><ul><li>Acides nucléiques (ADN,...
Unicité du monde vivant <ul><li>Comparaison de séquences de génomes </li></ul><ul><li>Génome de mammifère: ≈20,000 gènes <...
Unicité et Diversité du monde vivant <ul><li>Les organismes vivants ont évolué à partir d’un même ancêtre commun  </li></u...
Le secret de l’hérédité <ul><li>Avery et al. (1944): l’ADN est le support de l’information génétique </li></ul><ul><li>Wat...
Le secret de l’hérédité <ul><li>ADN: structure en double hélice = reproduction (réplication de l’information nécessaire au...
Le secret de la vie:  réplication PRESQUE à l’identique <ul><li>Mutation = modification du matériel génétique = modificati...
Processus mutationnels: l’exemple du génome humain  <ul><li>Un génome animal ordinaire (mais bien connu) </li></ul><ul><li...
Les mutations ponctuelles <ul><li>Génome humain:  </li></ul><ul><ul><li>2 à 3 10 -8  mutations ponctuelles/pb/génération  ...
Taux de mutation / pb / génération <ul><li>Comparaison de différents groupes taxonomiques </li></ul>
Taux de mutation / pb / an <ul><li>Homme vs.  Escherichia coli : </li></ul><ul><li>Taux de mutation / pb / génération: env...
Taux de mutation <ul><li>HIV: virus du SIDA:  </li></ul><ul><ul><li>5 10 -6  mutations / pb / génération (environ 100x mam...
Mutations ponctuelles: l’effet du sexe <ul><li>Nombre de divisions cellulaires dans la lignée germinale à chaque génératio...
Taux de mutations ponctuelles dans l’espèce humaine: 6 fois plus élevé chez les mâles Parmi les ≈150 mutations nouvelles d...
Mutations induites par l’activité de parasites intragénomiques <ul><li>Rétrovirus: virus intégrant son propre génome dans ...
Rétrovirus et éléments transposables <ul><li>Rétrovirus: transmission horizontale (infection) </li></ul><ul><li>Rétrotrans...
Eléments transposables: 44% du génome humain SINE (rétrotransposon non-autonome) LINE (rétroposon) Rétrovirus endogènes Tr...
Eléments transposables: dispersés dans tout le génome Fragment du chromosome Y bovin
Eléments transposables dans le génome humain <ul><li>Dispersés dans tout le génome: à l’intérieur des gènes (dans les intr...
Conséquences de l'activité des éléments transposables <ul><li>Insertion dans les régions codantes d'un gène => inactivatio...
Mutations par duplication ou délétion de fragments génomiques (1):  à petite échelle (quelques pb) <ul><li>Les duplication...
Mutations par duplication ou délétion de fragments génomiques (1):  à petite échelle (quelques pb) <ul><li>Environ 20 à 30...
Mutations par duplication ou délétion de fragments génomiques (2):  à grande échelle  <ul><li>Recombinaison entre séquence...
Mutations par duplication ou délétion de fragments génomiques (2):  à grande échelle  <ul><li>L'abondance des éléments tra...
Mutations par duplication ou délétion de fragments génomiques (2):  à grande échelle  <ul><li>Duplication de gènes: opport...
Mutations par duplication ou délétion de fragments génomiques (2):  à grande échelle  <ul><li>Evolution de la famille de g...
Mutations par duplication ou délétion de fragments génomiques (2):  à grande échelle  <ul><li>Conséquences fonctionnelles ...
Réarrangements chromosomiques <ul><li>Inversions, translocations chromosomiques, fusion or fissions chromosomiques ... </l...
Polyploïdisation: duplication globale du génome <ul><li>Evènements rares mais récurrents au cours de l'évolution des eucar...
Origine des nouveaux gènes <ul><li>Duplication: </li></ul><ul><ul><li>Recombinaison inégale, duplication de génome </li></...
Origine des nouveaux gènes <ul><li>Duplication: </li></ul><ul><ul><li>Recombinaison inégale, duplication de génome </li></...
Conséquences fonctionnelles des mutations <ul><li>Mutations => diversité génétique => diversité phénotypique </li></ul>
Conséquences fonctionnelles des mutations <ul><li>Mutations délétères (nocives) </li></ul><ul><ul><li>E.g.: maladies génét...
Conséquences évolutives des mutations <ul><li>Mutations => diversité génétique : de nouveaux allèles (i.e. de nouveaux var...
Evolution : de l'individu à la population Erreur de réplication, délétion, insertion, ...  = prémutation Substitution = mu...
Evolution = changement de fréquences alléliques Générations 1 0 Individus 2 3 4 5 … G
Quels sont les processus qui contribuent aux changements de fréquences alléliques?
La sélection naturelle (1):  sélection positive  <ul><li>Sélection positive (directionnelle): adaptation </li></ul><ul><li...
La sélection positive Individus Générations 1 2 3 4 5 … G
La sélection naturelle (1):  sélection positive  <ul><li>Le succès reproducteur d'un individu dépend de: </li></ul><ul><ul...
La sélection naturelle (1):  sélection positive  <ul><li>Pas uniquement la &quot;lutte pour la survie&quot;,  </li></ul><u...
La sélection naturelle (1):  sélection positive  <ul><li>Pas uniquement la &quot;lutte pour la survie&quot;,  </li></ul><u...
La sélection naturelle (1):  sélection positive  <ul><li>Exemples de sélection positive dans la lignée humaine: adaptation...
La sélection naturelle (1):  sélection positive  <ul><ul><li>Digestion de l'amidon: Amylase (AMY1) </li></ul></ul><ul><ul>...
La sélection naturelle (1):  sélection positive  <ul><ul><li>Digestion du lactose: Lactase (LCT) </li></ul></ul><ul><ul><u...
La sélection naturelle (2):  sélection négative  <ul><li>Sélection négative (purificatrice): conservation </li></ul><ul><l...
La sélection négative Individus Générations 1 2 3 4 5
La sélection naturelle (3):  sélection balancée <ul><li>Mutations avantageuses à l'état hétérozygotes </li></ul><ul><li>La...
La sélection naturelle (3):  sélection balancée <ul><li>Exemple: drépanocytose (anémie à cellule falciforme) </li></ul><ul...
La sélection naturelle n'est pas l'unique mécanisme de l'évolution!! <ul><li>Même en absence de pression de sélection, il ...
La dérive génétique aléatoire Individus Générations 1 2 3 4 5 … G
Evolution des patronymes Duret EyreWalker Arndt Galtier Arndt Arndt EyreWalker Galtier Galtier Galtier Galtier Galtier <ul...
La dérive génétique aléatoire <ul><li>L'impact de la dérive génétique aléatoire dépend de la taille des populations: plus ...
La dérive génétique interfère avec la sélection naturelle <ul><li>Du fait de la dérive génétique, même les mutations avant...
Analyse comparative de séquences génomiques:  la pierre de Rosette des généticiens
Projets de séquençage de génomes <ul><li>Objectif: faire l'inventaire de toute l'information génétique nécessaire au dével...
Qu'y a-t-il dans un génome de mammifère? <ul><li>3.1 10 9  bp </li></ul><ul><li>Eléments transposables:  ~50% </li></ul><u...
agtgctaaccactgagccatcatgcctacgacactatttattacagtttattagttcattatagtccatactacagtatgctggagcattcattaactaagagtagcaataatatgtacagt...
Comment trouver les éléments fonctionnels ?
Qu'est-ce qui nous distingue de notre cousin? <ul><li>Quels sont les éléments fonctionnels responsables des adaptations sp...
Génomique comparative:  la pierre de Rosette <ul><li>Principe de l'approche: </li></ul><ul><ul><li>Elément fonctionnel <=>...
Analyser les vitesses d'évolution des séquences pour détecter la sélection <ul><li>Vitesse d'évolution = taux de substitut...
Vitesse d'évolution de séquences neutres
Probabilité de Fixation Probabilité de fixation = 1/N = 1/4 Duret EyreWalker Arndt Galtier Arndt Arndt EyreWalker Galtier ...
Taux de mutation D o ret EyreWalker Arndt Galtier Arndt Arnd s EyreWalker Galtie x Galtie x Galtie x Galtie x Galtie x Nom...
Vitesse d'évolution de séquences neutres Taille de la population = N =  4 Taux de mutation/génération/individu = u =  1/5 ...
Démontrer l'action de la sélection = rejeter l'hypothèse d'évolution neutre <ul><li>En absence de sélection, V = u </li></...
Eléments fonctionnels sous pression de sélection négative <ul><li>Evoluent plus lentement que le reste du génome </li></ul...
Analyse comparative des gènes de   -actine de l'homme et de la carpe Carpe Homme 5’UTR  3 ’ UTR échelle de similarité :  ...
 
Comparaison des génomes de l’homme et de la souris <ul><li>Alignement des génomes de l’homme et de la souris: 40% du génom...
Comparaison des génomes de l’homme et de la souris <ul><li>Plus de 5% du génome des mammifères est sous pression de sélect...
Quantifier les éléments fonctionnels dans notre génome <ul><li>Problème: on ne détecte que les éléments fonctionnels déjà ...
Contribution relative de la dérive génétique et de la sélection positive à l'évolution des génomes <ul><li>Sélection négat...
Contribution relative de la dérive génétique et de la sélection positive à l'évolution des génomes <ul><li>Comparaison hom...
Importance de la dérive <ul><li>Dans les espèces à faible taille de population, la sélection est moins efficace: </li></ul...
Conclusions (1) <ul><li>&quot; En biologie, rien n'a de sens si ce n'est à la lumière de l'évolution &quot; (T. Dobzhansky...
Conclusions (2) <ul><li>Les processus de l'évolution (à l'échelle moléculaire) ... Seulement un des versants de la questio...
Prochain SlideShare
Chargement dans…5
×

ConfProcessusEvolutionDuret

5 626 vues

Publié le

Publié dans : Formation
0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
5 626
Sur SlideShare
0
Issues des intégrations
0
Intégrations
3 530
Actions
Partages
0
Téléchargements
78
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive
  • ConfProcessusEvolutionDuret

    1. 1. Les processus de l'évolution La vie grâce aux mutations ! Laurent Duret Laboratoire de Biométrie et Biologie Evolutive, CNRS, Université Lyon 1
    2. 2. Qu’est-ce que la vie? C arbure silicium Champignon A lgue rouge D épots sel cuivrique Cristaux de glace Corail
    3. 3. Qu’est-ce que la vie? Cristaux de glace Lithoptera mulleri (plancton) Diatomée (microalgue) Cristaux de carbonate de calcium Fougère
    4. 4. Propriétés fondamentales des organismes vivants <ul><li>Reproduction : créer de façon autonome d'autres entités similaires à soi-même. </li></ul><ul><li>Evolution : reproduction PRESQUE à l’identique </li></ul><ul><li>Sans mutation, pas d’évolution </li></ul><ul><li>Sans évolution, pas de vie </li></ul>
    5. 5. Les processus de l'évolution <ul><li>Diversité et unicité du vivant </li></ul><ul><li>Nature et causes des mutations </li></ul><ul><li>Les conséquences phénotypiques des mutations </li></ul><ul><li>Le devenir des mutations: </li></ul><ul><ul><li>Sélection naturelle </li></ul></ul><ul><ul><li>Dérive génétique </li></ul></ul><ul><li>Comment tirer parti de l'évolution pour déchiffrer les génomes </li></ul>
    6. 6. La diversité du monde vivant
    7. 7. La diversité du monde vivant
    8. 8. Unicité du monde vivant <ul><li>La cellule: unité de base des organismes vivants </li></ul><ul><li>Acides nucléiques (ADN, ARN): support de l’information nécessaire au développement et au fonctionnement des organismes </li></ul><ul><li>Expression de l’information génétique: </li></ul><ul><ul><li>ADN  ARN  protéine </li></ul></ul><ul><ul><li>Code génétique universel (presque) </li></ul></ul><ul><ul><li>Machinerie d’expression des gènes conservée chez tous les organismes vivants (bactéries, archées, eucaryotes) </li></ul></ul>
    9. 9. Unicité du monde vivant <ul><li>Comparaison de séquences de génomes </li></ul><ul><li>Génome de mammifère: ≈20,000 gènes </li></ul><ul><ul><li>Primates/carnivores: ≈19,000 gènes homologues </li></ul></ul><ul><ul><li>Homologues chez insectes: ≈10,000 gènes </li></ul></ul><ul><ul><li>Homologues chez champignons: ≈5,000 gènes </li></ul></ul><ul><ul><li>Homologues chez plantes: ≈6,000 gènes </li></ul></ul><ul><ul><li>Homologues chez bactéries ou archées: ≈3,800 gènes </li></ul></ul>
    10. 10. Unicité et Diversité du monde vivant <ul><li>Les organismes vivants ont évolué à partir d’un même ancêtre commun </li></ul><ul><li>LUCA: Last Universal Common Ancestor ( Cf exposé M. Gouy ) </li></ul>
    11. 11. Le secret de l’hérédité <ul><li>Avery et al. (1944): l’ADN est le support de l’information génétique </li></ul><ul><li>Watson, Crick, Franklin (1953): structure en double hélice de la molécule d’ADN </li></ul>
    12. 12. Le secret de l’hérédité <ul><li>ADN: structure en double hélice = reproduction (réplication de l’information nécessaire au développement d’un organisme) </li></ul>
    13. 13. Le secret de la vie: réplication PRESQUE à l’identique <ul><li>Mutation = modification du matériel génétique = modification de la séquence d'ADN </li></ul><ul><li>Mutations ponctuelles: modifications très locales </li></ul><ul><li>Mutations larges: modifications de grands fragments génomiques, réarrangements chromosomiques </li></ul><ul><li>Erreurs de la machinerie cellulaire, action d'agents mutagènes biotiques (parasites intragénomiques) ou abiotiques (radiations, mutagènes chimiques, ...) </li></ul>
    14. 14. Processus mutationnels: l’exemple du génome humain <ul><li>Un génome animal ordinaire (mais bien connu) </li></ul><ul><li>Variabilité phénotypique très bien étudiée (maladies) </li></ul><ul><ul><li>Taille du génome haploïde: 3 10 9 pb </li></ul></ul><ul><ul><li>22 paires d’autosomes + une paire de chromosomes sexuels (X, Y) </li></ul></ul><ul><ul><li>20,000 gènes protéiques </li></ul></ul><ul><ul><li>Les régions codantes de ces gènes représentent 1% du génome </li></ul></ul>
    15. 15. Les mutations ponctuelles <ul><li>Génome humain: </li></ul><ul><ul><li>2 à 3 10 -8 mutations ponctuelles/pb/génération </li></ul></ul><ul><ul><li>Principalement dues à des erreurs de la machinerie de réplication </li></ul></ul><ul><li>=> 60 à 90 mutations ponctuelles par gamète </li></ul><ul><li>=> chaque individu (2n) est porteur d'environ 120 à 180 mutations nouvelles (i.e. qui n'existaient pas dans les génomes de ses parents) </li></ul><ul><li>La plupart des maladies génétiques humaines répertoriées à ce jour sont la conséquence de mutations ponctuelles (dans des régions régulatrices ou codantes) </li></ul>AGC T GTCTC -> AGC C GTCTC
    16. 16. Taux de mutation / pb / génération <ul><li>Comparaison de différents groupes taxonomiques </li></ul>
    17. 17. Taux de mutation / pb / an <ul><li>Homme vs. Escherichia coli : </li></ul><ul><li>Taux de mutation / pb / génération: environ x100 </li></ul><ul><li>Temps de génération: environ x 10 5 (20 ans vs. 1-2 h) </li></ul><ul><li>Taux de mutation / pb / an : de l'ordre de 1/1000 </li></ul>
    18. 18. Taux de mutation <ul><li>HIV: virus du SIDA: </li></ul><ul><ul><li>5 10 -6 mutations / pb / génération (environ 100x mammifères) </li></ul></ul><ul><ul><li>Evolution mesurable au cours de l'infection d'un individu </li></ul></ul><ul><ul><li>Résistance au système immunitaire, au traitements antiviraux </li></ul></ul>
    19. 19. Mutations ponctuelles: l’effet du sexe <ul><li>Nombre de divisions cellulaires dans la lignée germinale à chaque génération (zygote -> gamète) </li></ul><ul><ul><li>Femme: ≈ 33 divisions cellulaires </li></ul></ul><ul><ul><li>Homme: ≈ 200 divisions cellulaires (à 20 ans) </li></ul></ul><ul><ul><li>Plus de réplications dans la lignée mâle => plus d’opportunités de mutations </li></ul></ul><ul><li>Quantification de l’effet du sexe: comparaison des vitesses d’évolutions des chromosomes sexuels et des autosomes </li></ul><ul><ul><li>Temps passé dans les lignées mâles et femelle au fil des générations: </li></ul></ul>Autosomes 50% 50% X 33% 66% Y 100% 0%
    20. 20. Taux de mutations ponctuelles dans l’espèce humaine: 6 fois plus élevé chez les mâles Parmi les ≈150 mutations nouvelles dont chaque individu est porteur, environ 20 proviennent de sa mère, 130 de son père. Chromosome Divergence homme/chimpanzé (nombre de substitutions/pb)
    21. 21. Mutations induites par l’activité de parasites intragénomiques <ul><li>Rétrovirus: virus intégrant son propre génome dans le génome de son hôte </li></ul><ul><li>Eléments transposables: éléments capables de se dupliquer et de se déplacer dans les génomes: </li></ul><ul><ul><li>Via un intermédiaire ADN (transposons) </li></ul></ul><ul><ul><li>Via un intermédaire ARN (rétrotransposons) </li></ul></ul>
    22. 22. Rétrovirus et éléments transposables <ul><li>Rétrovirus: transmission horizontale (infection) </li></ul><ul><li>Rétrotransposon: transmission verticale </li></ul>Transcriptase inverse: Noyau Cellule ARN ADN transcription T ranscription inverse intégration LTR gag pol env LTR Rétrovirus Rétrovirus Rétrotransposon Rétroposon Rétrotransposon non-autonome Rétrovirus endogène
    23. 23. Eléments transposables: 44% du génome humain SINE (rétrotransposon non-autonome) LINE (rétroposon) Rétrovirus endogènes Transposons Autres séquences répétées Principales classes d’éléments transposables dans le génome humain AAAA LINE SINE Rétrovirus endogènes Transposons gag pol (env) (gag) transposase autonome non-autonome autonome non-autonome autonome non-autonome Taille 6-8 kb 100-300 pb 6-11 kb 1,5-3 kb 2-3 kb 80-3000 pb Nombre de copies 850 000 1 500 000 450 000 300 000 Fraction du génome 20% 13% 8% 3% Séquences non-répétées AAAA ORF1 ORF2 (pol)
    24. 24. Eléments transposables: dispersés dans tout le génome Fragment du chromosome Y bovin
    25. 25. Eléments transposables dans le génome humain <ul><li>Dispersés dans tout le génome: à l’intérieur des gènes (dans les introns) et entre les gènes </li></ul><ul><li>La plupart des copies présentes dans notre génome sont des &quot;fossiles moléculaires&quot;: éléments transposables défectifs, incapables de transposer </li></ul><ul><li>Environ 80-100 copies de LINEs et quelques milliers de SINEs encore actifs: </li></ul><ul><li>À chaque génération, 1 individu sur 20 porteur d'une nouvelle insertion </li></ul>
    26. 26. Conséquences de l'activité des éléments transposables <ul><li>Insertion dans les régions codantes d'un gène => inactivation du gène </li></ul><ul><li>Insertion à proximité d'un gène => perturbation de la régulation de l’expression du gène </li></ul><ul><li>Environ 50 cas décrits de maladies génétiques humaines causées par des insertions d'éléments transposables </li></ul><ul><li>Faible activité chez les primates par rapport à d'autres taxons (e.g. maïs, drosophiles, …) </li></ul>
    27. 27. Mutations par duplication ou délétion de fragments génomiques (1): à petite échelle (quelques pb) <ul><li>Les duplications ou délétions sont favorisées par la présence de petits motifs répétées (généralement 1 à 5 pb) </li></ul><ul><li>Dérapage de l'ADN polymérase: </li></ul>5'-CA -> 3'-GTGTGTGTGTGTGTGTGT 5' 5'-CA CACACAC-> 3'-GTGTGTGTGTGTGTGTGT-5' 5'-CA CACACACACACACACACA-3' 3'-GTGTGTGTGTGTGTGTGT-5' 5'-CA CACACAC-> 3'-GTGTGTGTGTGTGTGTGT-5'
    28. 28. Mutations par duplication ou délétion de fragments génomiques (1): à petite échelle (quelques pb) <ul><li>Environ 20 à 30 maladies génétiques humaines causées par des expansions de motifs répétés </li></ul><ul><li>e.g. chorée de Huntington (dégénérescence neuronale): </li></ul><ul><ul><li>Le gène JPH3 contient des répétitions de la séquence CAG </li></ul></ul><ul><ul><li>La nombre de répétitions est variable dans la population normale (6 à 26 fois) </li></ul></ul><ul><ul><li>Le nombre de copies peut augmenter ou diminuer au fil des générations en raison des erreurs de réplication au cours de la gamétogénèse </li></ul></ul><ul><ul><li>Si le trinucléotide est répété plus de 36 fois, la personne a un fort risque de développer la maladie </li></ul></ul>
    29. 29. Mutations par duplication ou délétion de fragments génomiques (2): à grande échelle <ul><li>Recombinaison entre séquences homologues présentes à des locus différents (e.g. éléments transposables) </li></ul>Recombinaison normale: alignement de chromosomes homologues Recombinaison inégale
    30. 30. Mutations par duplication ou délétion de fragments génomiques (2): à grande échelle <ul><li>L'abondance des éléments transposables dispersés dans le génome favorise les évènements de recombinaison inégale </li></ul><ul><li>Duplications ou perte de gènes: </li></ul>Gène Recombinaison inégale Gène Gène
    31. 31. Mutations par duplication ou délétion de fragments génomiques (2): à grande échelle <ul><li>Duplication de gènes: opportunité d'évoluer vers de nouvelles fonctions </li></ul><ul><li>Génome humain: la majorité des 20,000 gènes font partie de familles multigéniques (duplication = processus majeur d'innovation génique chez les eucaryotes) </li></ul>
    32. 32. Mutations par duplication ou délétion de fragments génomiques (2): à grande échelle <ul><li>Evolution de la famille de gènes de globines </li></ul>
    33. 33. Mutations par duplication ou délétion de fragments génomiques (2): à grande échelle <ul><li>Conséquences fonctionnelles des duplications: </li></ul><ul><ul><li>Long terme (dizaines de millions d'années): innovations fonctionnelles </li></ul></ul><ul><ul><li>Court terme: dosage génique => niveau d'expression </li></ul></ul><ul><li>Ces évènements de duplication/délétion font que les génomes de 2 individus présentent en moyenne 24 à 70 Mb de différence (1% à 2%) </li></ul><ul><li>Répertoire génique de 2 individus: ± 200 à 600 gènes ! </li></ul>
    34. 34. Réarrangements chromosomiques <ul><li>Inversions, translocations chromosomiques, fusion or fissions chromosomiques ... </li></ul><ul><li>Réarrangements favorisés par la présence d'éléments transposables </li></ul><ul><li>Problèmes de ségrégation des chromosomes à la méiose suivante </li></ul><ul><li>Cause de stérilité </li></ul>
    35. 35. Polyploïdisation: duplication globale du génome <ul><li>Evènements rares mais récurrents au cours de l'évolution des eucaryotes (plantes, animaux, champignons, protistes) </li></ul><ul><li>Mécanismes méconnus: </li></ul><ul><ul><li>Problème de ségrégation des chromosomes à la méiose </li></ul></ul><ul><ul><li>Hybridation entre espèces proches (e.g. blé, colza) </li></ul></ul><ul><ul><li>Favorisé par autofécondation </li></ul></ul><ul><li>Doublement du répertoire génique, suivi de pertes massives de gènes (re-diploïdisation) sur le long terme (dizaines de millions d'années) </li></ul><ul><li>Une fraction des gènes dupliqués impliqués dans l'évolution de nouvelles fonctions </li></ul><ul><li>Nous sommes des paléo-octoploïdes ! </li></ul>
    36. 36. Origine des nouveaux gènes <ul><li>Duplication: </li></ul><ul><ul><li>Recombinaison inégale, duplication de génome </li></ul></ul>Cluster de gènes Hox
    37. 37. Origine des nouveaux gènes <ul><li>Duplication: </li></ul><ul><ul><li>Recombinaison inégale, duplication de génome </li></ul></ul><ul><ul><li>Rétrotransposition (rétrogène) </li></ul></ul><ul><li>Formation de gènes chimères (réarrangements de gènes pré-existants) </li></ul><ul><li>Acquisition de gènes par transfert horizontal </li></ul><ul><ul><li>e.g. HERVW1 (placentation): dérivé d'un rétrovirus </li></ul></ul><ul><li>Recrutement de gènes de parasites intragénomiques (domestication, exaptation) </li></ul><ul><ul><li>e.g. Gènes impliqués dans les réarrangement du locus des immunoglobulines </li></ul></ul>
    38. 38. Conséquences fonctionnelles des mutations <ul><li>Mutations => diversité génétique => diversité phénotypique </li></ul>
    39. 39. Conséquences fonctionnelles des mutations <ul><li>Mutations délétères (nocives) </li></ul><ul><ul><li>E.g.: maladies génétiques </li></ul></ul><ul><li>Mutations avantageuses: </li></ul><ul><ul><li>Contribuent à l'adaptation des espèces </li></ul></ul><ul><li>Mutations neutres: sans effet significatif sur le phénotype </li></ul><ul><ul><li>NB: les régions fonctionnelles (régions codantes, régulatrices) constituent moins de 10% du génome humain </li></ul></ul><ul><ul><li>Même dans les régions fonctionnelles, de nombreuses mutations sont sans conséquence </li></ul></ul>
    40. 40. Conséquences évolutives des mutations <ul><li>Mutations => diversité génétique : de nouveaux allèles (i.e. de nouveaux variants d'un même gène) apparaissent dans la population </li></ul><ul><li>Comment cette diversité conduit-elle à l'évolution de l'espèce? </li></ul>
    41. 41. Evolution : de l'individu à la population Erreur de réplication, délétion, insertion, ... = prémutation Substitution = mutation fixée dans la population Mutation Réparation de l'ADN germen T ransmission à la descendance (polymorphisme) Disparition du nouvel allèle Individu Population (N) Fixation Substitution P as de transmission à la descendance soma
    42. 42. Evolution = changement de fréquences alléliques Générations 1 0 Individus 2 3 4 5 … G
    43. 43. Quels sont les processus qui contribuent aux changements de fréquences alléliques?
    44. 44. La sélection naturelle (1): sélection positive <ul><li>Sélection positive (directionnelle): adaptation </li></ul><ul><li>Mutation avantageuse = qui augmente le succès reproducteur d'un individu (sa &quot;fitness&quot;) </li></ul>
    45. 45. La sélection positive Individus Générations 1 2 3 4 5 … G
    46. 46. La sélection naturelle (1): sélection positive <ul><li>Le succès reproducteur d'un individu dépend de: </li></ul><ul><ul><li>Sa survie </li></ul></ul><ul><ul><li>Sa capacité à trouver un partenaire sexuel </li></ul></ul><ul><ul><li>Sa capacité à favoriser le développement de sa progéniture </li></ul></ul>
    47. 47. La sélection naturelle (1): sélection positive <ul><li>Pas uniquement la &quot;lutte pour la survie&quot;, </li></ul><ul><ul><li>Exemple 1: Sélection sexuelle </li></ul></ul><ul><ul><li>Compétition en vue d'être le plus attirant pour les membres du sexe opposé </li></ul></ul><ul><ul><li>Evolution de caractères qui peuvent s'avérer néfastes pour la survie </li></ul></ul>
    48. 48. La sélection naturelle (1): sélection positive <ul><li>Pas uniquement la &quot;lutte pour la survie&quot;, </li></ul><ul><ul><li>Exemple 2: Sélection de parentèle </li></ul></ul><ul><ul><li>Un individu peut transmettre des copies de ses propres gènes non seulement en se reproduisant, mais aussi en favorisant la reproduction d'individus apparentés </li></ul></ul><ul><ul><li>Evolution de l'altruisme (i.e. comportement favorable à d'autres individus, au détriment de ses propres chances de survie) – grâce au gène égoïste ... </li></ul></ul>
    49. 49. La sélection naturelle (1): sélection positive <ul><li>Exemples de sélection positive dans la lignée humaine: adaptation aux changements de mode alimentaire (agriculture, domestication: < 10,000 ans) </li></ul>
    50. 50. La sélection naturelle (1): sélection positive <ul><ul><li>Digestion de l'amidon: Amylase (AMY1) </li></ul></ul><ul><ul><ul><li>Famille multigénique; chez l'homme, variabilité du nombre de copies: entre 3 et 11 par génome (moyenne = 6); seulement 2 copies chez le chimpanzé </li></ul></ul></ul><ul><ul><ul><li>Concentration en amylase salivaire corrélée au nombre de copies </li></ul></ul></ul><ul><ul><ul><li>Nombre de copies significativement plus élevé dans les populations où l'alimentation traditionnelle est riche en amidon </li></ul></ul></ul>
    51. 51. La sélection naturelle (1): sélection positive <ul><ul><li>Digestion du lactose: Lactase (LCT) </li></ul></ul><ul><ul><ul><li>La capacité à digérer le lait diminue après le sevrage (réduction de la concentration en lactase dans l'intestin) </li></ul></ul></ul><ul><ul><ul><li>Intolérance au lactose fréquente parmi les adultes (douleurs abdominales, diarrhées) </li></ul></ul></ul><ul><ul><ul><li>Société traditionnelles pastorales: tolérance au lactose </li></ul></ul></ul><ul><ul><ul><li>Mutation dans le promoteur du gène LCT: l'expression de LCT se poursuit chez l'adulte </li></ul></ul></ul><ul><ul><ul><li>La distribution géographique de cet allèle 'persistance de la lactase' est corrélée au niveau historique de consommation de lait </li></ul></ul></ul>
    52. 52. La sélection naturelle (2): sélection négative <ul><li>Sélection négative (purificatrice): conservation </li></ul><ul><li>Mutation délétère = qui diminue le succès reproducteur d'un individu (sa &quot;fitness&quot;) </li></ul><ul><li>Les individus porteurs de cette mutation ont une probabilité plus faible d'avoir une descendance </li></ul><ul><li>Ces mutations tendent à disparaître de la population </li></ul>
    53. 53. La sélection négative Individus Générations 1 2 3 4 5
    54. 54. La sélection naturelle (3): sélection balancée <ul><li>Mutations avantageuses à l'état hétérozygotes </li></ul><ul><li>La sélection naturelle favorise le maintien du polymorphisme </li></ul><ul><li>Situation rare </li></ul>
    55. 55. La sélection naturelle (3): sélection balancée <ul><li>Exemple: drépanocytose (anémie à cellule falciforme) </li></ul><ul><li>Maladie relativement fréquente (notamment en Afrique) </li></ul>Mutation dans le gène de la beta-globine: - hétérozygotes - résistance partielle au paludisme - fréquence de l'allèle muté peut atteindre 20% - homozygotes - léthal AA AS SS Sains 2333 335 (0.14) 1 Malades 671 23 (0.03) 0
    56. 56. La sélection naturelle n'est pas l'unique mécanisme de l'évolution!! <ul><li>Même en absence de pression de sélection, il y a évolution (des fréquences alléliques) </li></ul><ul><li>Motoo Kimura: The Neutral Theory of Evolution </li></ul>
    57. 57. La dérive génétique aléatoire Individus Générations 1 2 3 4 5 … G
    58. 58. Evolution des patronymes Duret EyreWalker Arndt Galtier Arndt Arndt EyreWalker Galtier Galtier Galtier Galtier Galtier <ul><li>Pas de sélection: tous les individus ont la même probabilité de se reproduire </li></ul><ul><li>Mais le nombre de descendants n'est pas illimité => à chaque génération, tirage aléatoire des allèles qui seront présents à la génération suivante </li></ul><ul><li>A chaque génération, il existe une probabilité non-nulle qu'un allèle donné ne soit pas transmis => perte progressive d'allèles => perte aléatoire de la diversité génétique </li></ul>
    59. 59. La dérive génétique aléatoire <ul><li>L'impact de la dérive génétique aléatoire dépend de la taille des populations: plus les populations sont petites, plus les effets stochastiques sont importants </li></ul><ul><li>Importance des goulots d'étranglement (e.g. au moment d'une colonisation): effet fondateur </li></ul><ul><li>Exemple: patronymes les plus fréquents </li></ul><ul><ul><li>France: Durand, Petit, Dupont </li></ul></ul><ul><ul><li>Québec: Roy, Gauthier, Gagnon </li></ul></ul>
    60. 60. La dérive génétique interfère avec la sélection naturelle <ul><li>Du fait de la dérive génétique, même les mutations avantageuses ont une probabilité assez faible de se fixer </li></ul><ul><li>Du fait de la dérive génétique, les mutations faiblement délétères ont une probabilité non-nulle de se fixer </li></ul>
    61. 61. Analyse comparative de séquences génomiques: la pierre de Rosette des généticiens
    62. 62. Projets de séquençage de génomes <ul><li>Objectif: faire l'inventaire de toute l'information génétique nécessaire au développement d'un organisme: génes, régions régulatrices </li></ul><ul><li>Développement rapide des techniques de séquençage </li></ul><ul><ul><li>Séquençage d'un génome humain: </li></ul></ul><ul><ul><ul><li>2004: 6 ans, 300,000 k€ </li></ul></ul></ul><ul><ul><ul><li>2008: 8 semaines, 250 k€ </li></ul></ul></ul><ul><li>Des centaines de génomes séquencés, dont une vingtaine de mammifères </li></ul>
    63. 63. Qu'y a-t-il dans un génome de mammifère? <ul><li>3.1 10 9 bp </li></ul><ul><li>Eléments transposables: ~50% </li></ul><ul><li>20,000 gènes protéiques </li></ul><ul><li>Régions codantes des gènes protéiques : 1% </li></ul><ul><li>Autres éléments fonctionnels: ?? </li></ul><ul><li>Quelle fraction de notre génome est fonctionnelle? </li></ul>100%? 50%? 10%? 1%?
    64. 64. agtgctaaccactgagccatcatgcctacgacactatttattacagtttattagttcattatagtccatactacagtatgctggagcattcattaactaagagtagcaataatatgtacagtaaaaaacactagtatggttcaaaaacactaatatttactatacattacaataatatacagttgaagtcagaattattagccccctttttattttttgtgccaatttctgtttaacggagagatttttttcaacacatttctaatcataatagttttaataactcatttataatagctgatttattttatctttgccatgatgacagtaaataatgttttactagatgtttttcaagacacttctatacagcttaaagtgacatttaaaggcttaactaggttaattaggttaactaggcaggttaggataactaggcaagttattgtataatgatggtttgttctttagactatcaaaaaaataacttaaaggggctaaaaaatttttaccttaaaatgtttttttttttttaattaaaaaactgcttttattctagccaaaaataaaacaaataagactatctccagaagaaacaatattatcagacatactgtgaaaatatctttggtcatttgggaaatattttacaacgaaaacaaaatcctaaggggggctaatatgtctgacttcaactgtatatatatattttttcatgtggatatgctaatgtgtaaaaatttcaatccccagtgaatgcaatggatggataattcgaataaacagagtagttttcctttattttattattcatttaggtatttacttttatgtttttatattttgtttgtttctccagcatatagaagccaactgtattattgcagccaataattaatatatcagtaaggcttttatgatttaacatcaaactgcattaacattacccaatagttaaaagaataaaaaatttaaactcattaataattcttaacccttatgttgtttcaatcccctgagacattccttcataatctaaaatcaaatgaatatgttttagatgaaatccaacagcagctttcagacactaatgatcacatacaaagctccatgaacatttactttttgtgcaaacgacaaaaaaatgtgtagcttcaaatggttacagttgaaccactaaagtgatctggaatattttgacaaagtttttggtcttttttctggattttgaatgttgttgctgtctatggaggatgagagagctcttgggtttcttctaaaatatctttattggcgttgtgaagataaacgaaggtgatctcaggggtttggaatgatgatgagctttcaattttcaatttcatggagaattttctttaatttcagtccatataaatcgtttgcaaacacttaccttaaaaaaagatagtaaatgcaatgaatcatttttctgtgcatttcaatgcaacacaactctctatagctgaaattattgtgggtgttaacaaagagcagaactgcaggtcagtgcatgaa
    65. 65. Comment trouver les éléments fonctionnels ?
    66. 66. Qu'est-ce qui nous distingue de notre cousin? <ul><li>Quels sont les éléments fonctionnels responsables des adaptations spécifiques de chaque lignée? </li></ul>30 10 6 substitutions ponctuelles + délétions+ duplications
    67. 67. Génomique comparative: la pierre de Rosette <ul><li>Principe de l'approche: </li></ul><ul><ul><li>Elément fonctionnel <=> contraint par la sélection naturelle </li></ul></ul><ul><ul><li>Rechercher les traces de l'action de la sélection dans les séquences genomiques </li></ul></ul><ul><ul><ul><li>Sélection négative (conservation) </li></ul></ul></ul><ul><ul><ul><li>Sélection positive (adaptation) </li></ul></ul></ul>
    68. 68. Analyser les vitesses d'évolution des séquences pour détecter la sélection <ul><li>Vitesse d'évolution = taux de substitution </li></ul><ul><li>Vitesse d'évolution des séquences: V </li></ul><ul><ul><li>u: Taux de mutation par génération </li></ul></ul><ul><ul><li>p: Probabilité de fixation </li></ul></ul><ul><li>La probabilité de fixation d'une mutation dépend de: </li></ul><ul><ul><li>N: taille des populations (dérive génétique) </li></ul></ul><ul><ul><li>s: impact de le mutation sur le succès reproducteur </li></ul></ul><ul><ul><ul><li>s < 0 : mutation désavantageuse </li></ul></ul></ul><ul><ul><ul><li>s = 0 : mutation neutre </li></ul></ul></ul><ul><ul><ul><li>s > 0 : mutation avantageuse </li></ul></ul></ul>
    69. 69. Vitesse d'évolution de séquences neutres
    70. 70. Probabilité de Fixation Probabilité de fixation = 1/N = 1/4 Duret EyreWalker Arndt Galtier Arndt Arndt EyreWalker Galtier Galtier Galtier Galtier Galtier
    71. 71. Taux de mutation D o ret EyreWalker Arndt Galtier Arndt Arnd s EyreWalker Galtie x Galtie x Galtie x Galtie x Galtie x Nombre de Mutations dans la Pop = uN = 1/5 x 4 = 0.8
    72. 72. Vitesse d'évolution de séquences neutres Taille de la population = N = 4 Taux de mutation/génération/individu = u = 1/5 Nombre de mutations à chaque génération= uN = 4/5 Probabilité de fixation = 1/N = 1/4 Taux de substitution dans la population: uN x 1/N = u = 1/5
    73. 73. Démontrer l'action de la sélection = rejeter l'hypothèse d'évolution neutre <ul><li>En absence de sélection, V = u </li></ul><ul><li>Sélection négative: V < u </li></ul><ul><li>Sélection positive: V > u </li></ul>
    74. 74. Eléments fonctionnels sous pression de sélection négative <ul><li>Evoluent plus lentement que le reste du génome </li></ul><ul><li>=> conservés au cours de l'évolution </li></ul><ul><li>=> empreintes phylogénétique </li></ul>
    75. 75. Analyse comparative des gènes de  -actine de l'homme et de la carpe Carpe Homme 5’UTR 3 ’ UTR échelle de similarité : pas de similarité significative 7 0 - 80% identité 8 0 - 90% identité régions codantes: éléments régulateurs: introns: ATG codon stop signal de polyadénylation promoteur enhancer signaux d’adressage intracytoplasmique
    76. 77. Comparaison des génomes de l’homme et de la souris <ul><li>Alignement des génomes de l’homme et de la souris: 40% du génome humain est alignable avec le génome de la souris </li></ul><ul><li>Comparaison des taux de substitution dans les éléments transposables défectifs (marqueurs neutres) et dans le reste du génome </li></ul>Homme caggtggagctgggcgggggccctggtgcaggcagcctg Souris caactggagctgggtgga---ccgggagcaggtgacctt ** ********** ** ** ** ***** ***
    77. 78. Comparaison des génomes de l’homme et de la souris <ul><li>Plus de 5% du génome des mammifères est sous pression de sélection négative </li></ul><ul><li>NB: seulement 1% du génome est codant !! 4 fois plus des regions non-codantes fonctionnelles que de régions codantes !! </li></ul>Distribution des taux de substitution Marqueurs neutres Séquences non-répétées Score de conservation
    78. 79. Quantifier les éléments fonctionnels dans notre génome <ul><li>Problème: on ne détecte que les éléments fonctionnels déjà présents chez l'ancêtre commun aux rongeurs et aux primates – et non pas ceux qui ont évolué spécifiquement dans l'une ou l'autre lignée </li></ul><ul><li>Comparaison entre primates proches (homme, chimpanzé, macaque, ...): environ 10% de notre génome est sous pression de sélection négative </li></ul><ul><li>Ces régions non-codantes fonctionnelles sont probablement impliquées dans la régulation de l'expression des gènes </li></ul>
    79. 80. Contribution relative de la dérive génétique et de la sélection positive à l'évolution des génomes <ul><li>Sélection négative = conservation (pas d'évolution) </li></ul><ul><li>Evolution : </li></ul><ul><ul><li>Sélection positive </li></ul></ul><ul><ul><li>Dérive génétique </li></ul></ul><ul><li>Comparaison homme/chimpanzé: </li></ul><ul><ul><li>1,2% de divergence </li></ul></ul><ul><ul><li>34,000,000 substitutions nucleotidiques dans tout le génome </li></ul></ul><ul><ul><li>290,000 substitutions d'amino-acides dans les protéines </li></ul></ul><ul><li>Quelle fraction de ces substitutions résultent de la sélection? </li></ul>100%? 50%? 10%? 1%?
    80. 81. Contribution relative de la dérive génétique et de la sélection positive à l'évolution des génomes <ul><li>Comparaison homme/chimpanzé: </li></ul><ul><li>Fraction des substitutions résultant de la sélection: indétectable (i.e. très très faible par rapport aux mutations fixées par dérive) </li></ul><ul><li>Drosophiles: environ 50% des substitutions dans les gènes protéiques résultent de la sélection </li></ul><ul><li>Faible taille de population chez les mammifères par rapport aux insectes => dérive plus importante, sélection moins efficace </li></ul>
    81. 82. Importance de la dérive <ul><li>Dans les espèces à faible taille de population, la sélection est moins efficace: </li></ul><ul><ul><li>Pour fixer les mutations avantageuses </li></ul></ul><ul><ul><li>Pour purger les mutations faiblement délétères </li></ul></ul><ul><li>=> accumulations de mutations faiblement délétères </li></ul><ul><li>=> explique l'abondance des éléments transposables (parasites intragénomiques) dans certains groupes taxonomiques </li></ul>
    82. 83. Conclusions (1) <ul><li>&quot; En biologie, rien n'a de sens si ce n'est à la lumière de l'évolution &quot; (T. Dobzhansky, 1973) </li></ul><ul><li>Pour pouvoir déchiffrer (interpréter) les génomes, il est nécessaire de comprendre les processus évolutifs (mutation, sélection, dérive, …) qui affectent les séquences ou qui les ont affectées dans le passé (contingence) </li></ul><ul><li>La connaissance des processus évolutifs à l'échelle moléculaire (i.e. au niveau même du support de l'information génétique) est cruciale pour comprendre l'évolution des organismes (y compris pour anticiper l'émergence de pathogènes résistants aux traitements) </li></ul>
    83. 84. Conclusions (2) <ul><li>Les processus de l'évolution (à l'échelle moléculaire) ... Seulement un des versants de la question </li></ul><ul><li>Evolution des écosystèmes: prendre en compte le processus de co-évolution (mutualisme, parasitisme, prédation) </li></ul><ul><li>Processus de spéciation </li></ul><ul><li>Sélection de second ordre: sélection sur la capacité à évoluer (e.g. évolution de la reprouction sexuée) </li></ul><ul><li>… </li></ul>

    ×