SlideShare une entreprise Scribd logo

Conférence sur l'ADNe : introduction d'Argaly et Spygen

Mercredi 15 mai, le bureau du soutien à l'exportation de la DAEI (direction des affaires européennes et internationales) du MTES a organisé une conférence pour mettre en avant le savoir-faire des sociétés ARGALY et SPYGEN dans le domaine de l'ADN environnemental. Voici l'introduction commune sur cette technologie. https://www.linkedin.com/pulse/ladn-environnemental-une-r%C3%A9volution-pour-la-en-bruno-rakedjian/

1  sur  9
Télécharger pour lire hors ligne
L’outil ADN environnemental
Au service de l’évaluation de la biodiversité
Introduction
Contexte
Vers une 6ème
extinction de masse?
Besoin d’inventaires
taxonomiques haut
débit
Introduction
Inventaires d’espèces traditionnels
Inventaires basés sur l’identification moléculaire (ADN)
 Reposent sur l’identification morphologique
• Expertise
• Impossible à certains stades biologiques
• Parfois subjectifs
 Standardisation difficile entre groupes
 Parfois coûteux à cause du temps passé sur le
terrain ou des technologies utilisées
Différenciation difficile!
Introduction
 « ADN pouvant être extrait à partir d'échantillons environnementaux sans avoir besoin d'isoler au préalable
d’individus cibles » (Taberlet et al. 2012)
 ADN libéré dans l’environnement par l’intermédiaire de fèces, d’urine, de gamètes, de mucus, de salive, etc.
Définition de l’ADN environnemental
Introduction
Historique de l’ADNe
0
2000
4000
6000
8000
10000
12000
1985 1995 2000 2005 2010 20151990
Microbiologie
Première référence Reconstruction
paléocommunautés
Détection dans l’eau
Régimes
alimentaires
Forte croissance études
ADNe macroorganismes
Première étude
metabarcoding
Nb publications ADNe / an
Introduction
 ADNe Barcoding : étude d’une espèce cible
Deux approches possibles
qPCRExtraction
d’ADN
Polymerase Chain
Reaction en temps réel
Présence / absence
espèce cible
Amplification avec un
couple d’amorces
spécifique
Fluorescence
Nombre de cycles

Recommandé

Les Empreintes Genetiques
Les Empreintes GenetiquesLes Empreintes Genetiques
Les Empreintes GenetiquesLonexax
 
Détection des allèles polymorphiques ou allèles antigènes variants par PCR
Détection des allèles polymorphiques ou allèles antigènes variants par PCRDétection des allèles polymorphiques ou allèles antigènes variants par PCR
Détection des allèles polymorphiques ou allèles antigènes variants par PCRInstitut Pasteur de Madagascar
 
Entomologie moléculaire et étude de la structuration génétique des anophèles
Entomologie moléculaire et étude de la structuration génétique des anophèlesEntomologie moléculaire et étude de la structuration génétique des anophèles
Entomologie moléculaire et étude de la structuration génétique des anophèlesInstitut Pasteur de Madagascar
 

Contenu connexe

Tendances

Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeMiraj Microbio
 
Biologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieBiologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieIMANE HALIMA BENLARIBI
 
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Institut Pasteur de Madagascar
 
ConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyvguili
 
Les technique de protozoaires
Les technique de protozoairesLes technique de protozoaires
Les technique de protozoairesabir
 
ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretvguili
 
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRDétection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRInstitut Pasteur de Madagascar
 
Présentation de stage
Présentation de stagePrésentation de stage
Présentation de stagegblais
 
Projet génome de Plasmodium: Approches utilisées et résultats attendus
Projet génome de Plasmodium: Approches utilisées et résultats attendusProjet génome de Plasmodium: Approches utilisées et résultats attendus
Projet génome de Plasmodium: Approches utilisées et résultats attendusInstitut Pasteur de Madagascar
 
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...Pasteur_Tunis
 
Cycle biologique de Plasmodium: processus d'invasion du mérozoïte
Cycle biologique de Plasmodium: processus d'invasion du mérozoïteCycle biologique de Plasmodium: processus d'invasion du mérozoïte
Cycle biologique de Plasmodium: processus d'invasion du mérozoïteInstitut Pasteur de Madagascar
 
Identification rapide de pathogènes sans marquage par diffusion élastique opt...
Identification rapide de pathogènes sans marquage par diffusion élastique opt...Identification rapide de pathogènes sans marquage par diffusion élastique opt...
Identification rapide de pathogènes sans marquage par diffusion élastique opt...Pierre R. Marcoux
 

Tendances (20)

Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
ExposeeeeeeeeeeeeeeeeeeeeeeeeeeeeeExposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
Exposeeeeeeeeeeeeeeeeeeeeeeeeeeeee
 
Biologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieBiologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologie
 
Diagnostic biologique du paludisme
Diagnostic biologique du paludismeDiagnostic biologique du paludisme
Diagnostic biologique du paludisme
 
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
Séquence complète du génome de Plasmodium falciparum: intérêts pour les cherc...
 
ConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouyConfEvolutionPrecoceGouy
ConfEvolutionPrecoceGouy
 
Les technique de protozoaires
Les technique de protozoairesLes technique de protozoaires
Les technique de protozoaires
 
ConfProcessusEvolutionDuret
ConfProcessusEvolutionDuretConfProcessusEvolutionDuret
ConfProcessusEvolutionDuret
 
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRDétection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
 
Diagnostic biologique du paludisme
Diagnostic biologique du paludismeDiagnostic biologique du paludisme
Diagnostic biologique du paludisme
 
Présentation de stage
Présentation de stagePrésentation de stage
Présentation de stage
 
Gamétocytes de Plasmodium infectant l’homme
Gamétocytes de Plasmodium infectant l’hommeGamétocytes de Plasmodium infectant l’homme
Gamétocytes de Plasmodium infectant l’homme
 
Résistance de Plasmodium vivax à la chloroquine
Résistance de Plasmodium vivax à la chloroquineRésistance de Plasmodium vivax à la chloroquine
Résistance de Plasmodium vivax à la chloroquine
 
Projet génome de Plasmodium: Approches utilisées et résultats attendus
Projet génome de Plasmodium: Approches utilisées et résultats attendusProjet génome de Plasmodium: Approches utilisées et résultats attendus
Projet génome de Plasmodium: Approches utilisées et résultats attendus
 
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...
EVALUATION ET PREVENTION DES RISQUES INFECTIEUX DANS LES LABORATOIRES DE MICR...
 
CV MA
CV MA CV MA
CV MA
 
SP Tests antipaludogrammes
SP Tests antipaludogrammesSP Tests antipaludogrammes
SP Tests antipaludogrammes
 
Etude de la Phyllosphère
Etude de la PhyllosphèreEtude de la Phyllosphère
Etude de la Phyllosphère
 
Cycle biologique de Plasmodium: processus d'invasion du mérozoïte
Cycle biologique de Plasmodium: processus d'invasion du mérozoïteCycle biologique de Plasmodium: processus d'invasion du mérozoïte
Cycle biologique de Plasmodium: processus d'invasion du mérozoïte
 
Pourquoi un diagnostic du paludisme ?
Pourquoi un diagnostic du paludisme ?Pourquoi un diagnostic du paludisme ?
Pourquoi un diagnostic du paludisme ?
 
Identification rapide de pathogènes sans marquage par diffusion élastique opt...
Identification rapide de pathogènes sans marquage par diffusion élastique opt...Identification rapide de pathogènes sans marquage par diffusion élastique opt...
Identification rapide de pathogènes sans marquage par diffusion élastique opt...
 

Similaire à Conférence sur l'ADNe : introduction d'Argaly et Spygen

cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfkristinacraft1
 
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...Pôle Qualiméditerranée
 
Conférence sur l'ADNe : présentation de l'expérience d'ARGALY
Conférence sur l'ADNe : présentation de l'expérience d'ARGALYConférence sur l'ADNe : présentation de l'expérience d'ARGALY
Conférence sur l'ADNe : présentation de l'expérience d'ARGALYBruno Rakedjian
 
extraction-de-ADN.docx pour la biologie molécula
extraction-de-ADN.docx pour la biologie moléculaextraction-de-ADN.docx pour la biologie molécula
extraction-de-ADN.docx pour la biologie moléculassuser011000
 
Techniques de PCR.pptx
Techniques de PCR.pptxTechniques de PCR.pptx
Techniques de PCR.pptxHICHAM215202
 
Poster 98 parasitologie
Poster 98 parasitologiePoster 98 parasitologie
Poster 98 parasitologieJIB Congress
 
Papilons mus e vert 2012 1
Papilons mus e vert 2012  1Papilons mus e vert 2012  1
Papilons mus e vert 2012 1jaco49
 
La pcr
La  pcr La  pcr
La pcr BeTy10
 
Outil moléculaire global pour déterminer l’origine géographique des aliments ...
Outil moléculaire global pour déterminer l’origine géographique des aliments ...Outil moléculaire global pour déterminer l’origine géographique des aliments ...
Outil moléculaire global pour déterminer l’origine géographique des aliments ...Pôle Qualiméditerranée
 
cours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdfcours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdfFatimaZohra85
 
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du CamerounBiodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du CamerounUniversité de Dschang
 
Bases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesBases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesPasteur_Tunis
 
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Claire Nedellec
 

Similaire à Conférence sur l'ADNe : introduction d'Argaly et Spygen (20)

COURS 2 PCR.ppt
COURS 2 PCR.pptCOURS 2 PCR.ppt
COURS 2 PCR.ppt
 
cours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdfcours2pcr-221104185906-d4700dd6.pdf
cours2pcr-221104185906-d4700dd6.pdf
 
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...
Des bio-puces pour la mesure des contaminations microbiennes. Outils de mesur...
 
Exposé pcr
Exposé pcrExposé pcr
Exposé pcr
 
Nothern blot
Nothern blotNothern blot
Nothern blot
 
Conférence sur l'ADNe : présentation de l'expérience d'ARGALY
Conférence sur l'ADNe : présentation de l'expérience d'ARGALYConférence sur l'ADNe : présentation de l'expérience d'ARGALY
Conférence sur l'ADNe : présentation de l'expérience d'ARGALY
 
extraction-de-ADN.docx pour la biologie molécula
extraction-de-ADN.docx pour la biologie moléculaextraction-de-ADN.docx pour la biologie molécula
extraction-de-ADN.docx pour la biologie molécula
 
Clonage
ClonageClonage
Clonage
 
Techniques de PCR.pptx
Techniques de PCR.pptxTechniques de PCR.pptx
Techniques de PCR.pptx
 
Poster 98 parasitologie
Poster 98 parasitologiePoster 98 parasitologie
Poster 98 parasitologie
 
Caractérisation de chitinases chez les nématodes
Caractérisation de chitinases chez les nématodesCaractérisation de chitinases chez les nématodes
Caractérisation de chitinases chez les nématodes
 
Papilons mus e vert 2012 1
Papilons mus e vert 2012  1Papilons mus e vert 2012  1
Papilons mus e vert 2012 1
 
La leptospirose
La leptospirose La leptospirose
La leptospirose
 
La pcr
La  pcr La  pcr
La pcr
 
Cellules animales
Cellules animalesCellules animales
Cellules animales
 
Outil moléculaire global pour déterminer l’origine géographique des aliments ...
Outil moléculaire global pour déterminer l’origine géographique des aliments ...Outil moléculaire global pour déterminer l’origine géographique des aliments ...
Outil moléculaire global pour déterminer l’origine géographique des aliments ...
 
cours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdfcours-biologie-moleculaire-neh.pdf
cours-biologie-moleculaire-neh.pdf
 
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du CamerounBiodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
Biodiversité moléculaire des écotypes de chèvres (Capra hircus) du Cameroun
 
Bases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesBases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditaires
 
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
Ontologies et fouille de données textuelles pour l'analyse et la découverte d...
 

Plus de Bruno Rakedjian

20190618 wastewater litter rakedjian
20190618 wastewater litter rakedjian20190618 wastewater litter rakedjian
20190618 wastewater litter rakedjianBruno Rakedjian
 
Conférence sur l'ADNe : présentation de l'expérience de SPYGEN
Conférence sur l'ADNe : présentation de l'expérience de SPYGENConférence sur l'ADNe : présentation de l'expérience de SPYGEN
Conférence sur l'ADNe : présentation de l'expérience de SPYGENBruno Rakedjian
 
20180920 ppt stockage energie conference 1
20180920 ppt stockage energie conference 120180920 ppt stockage energie conference 1
20180920 ppt stockage energie conference 1Bruno Rakedjian
 
2016 11 08_ewa_storm_water_overflow_final
2016 11 08_ewa_storm_water_overflow_final2016 11 08_ewa_storm_water_overflow_final
2016 11 08_ewa_storm_water_overflow_finalBruno Rakedjian
 
Europe environnement mai 2016
Europe environnement mai 2016Europe environnement mai 2016
Europe environnement mai 2016Bruno Rakedjian
 
Filieres d'assainissement juin 2012
Filieres d'assainissement juin 2012Filieres d'assainissement juin 2012
Filieres d'assainissement juin 2012Bruno Rakedjian
 
Situation assainissement en France Mars 2013
Situation assainissement en France Mars 2013Situation assainissement en France Mars 2013
Situation assainissement en France Mars 2013Bruno Rakedjian
 
How to implement the urban waste water directive - Presentation given in Mont...
How to implement the urban waste water directive - Presentation given in Mont...How to implement the urban waste water directive - Presentation given in Mont...
How to implement the urban waste water directive - Presentation given in Mont...Bruno Rakedjian
 
France : mise en oeuvre efficace de la directive européenne sur les eaux usées
France : mise en oeuvre efficace de la directive européenne sur les eaux uséesFrance : mise en oeuvre efficace de la directive européenne sur les eaux usées
France : mise en oeuvre efficace de la directive européenne sur les eaux uséesBruno Rakedjian
 

Plus de Bruno Rakedjian (10)

20190618 wastewater litter rakedjian
20190618 wastewater litter rakedjian20190618 wastewater litter rakedjian
20190618 wastewater litter rakedjian
 
Conférence sur l'ADNe : présentation de l'expérience de SPYGEN
Conférence sur l'ADNe : présentation de l'expérience de SPYGENConférence sur l'ADNe : présentation de l'expérience de SPYGEN
Conférence sur l'ADNe : présentation de l'expérience de SPYGEN
 
20180920 ppt stockage energie conference 1
20180920 ppt stockage energie conference 120180920 ppt stockage energie conference 1
20180920 ppt stockage energie conference 1
 
Europe and environment
Europe and environmentEurope and environment
Europe and environment
 
2016 11 08_ewa_storm_water_overflow_final
2016 11 08_ewa_storm_water_overflow_final2016 11 08_ewa_storm_water_overflow_final
2016 11 08_ewa_storm_water_overflow_final
 
Europe environnement mai 2016
Europe environnement mai 2016Europe environnement mai 2016
Europe environnement mai 2016
 
Filieres d'assainissement juin 2012
Filieres d'assainissement juin 2012Filieres d'assainissement juin 2012
Filieres d'assainissement juin 2012
 
Situation assainissement en France Mars 2013
Situation assainissement en France Mars 2013Situation assainissement en France Mars 2013
Situation assainissement en France Mars 2013
 
How to implement the urban waste water directive - Presentation given in Mont...
How to implement the urban waste water directive - Presentation given in Mont...How to implement the urban waste water directive - Presentation given in Mont...
How to implement the urban waste water directive - Presentation given in Mont...
 
France : mise en oeuvre efficace de la directive européenne sur les eaux usées
France : mise en oeuvre efficace de la directive européenne sur les eaux uséesFrance : mise en oeuvre efficace de la directive européenne sur les eaux usées
France : mise en oeuvre efficace de la directive européenne sur les eaux usées
 

Conférence sur l'ADNe : introduction d'Argaly et Spygen

  • 1. L’outil ADN environnemental Au service de l’évaluation de la biodiversité
  • 2. Introduction Contexte Vers une 6ème extinction de masse? Besoin d’inventaires taxonomiques haut débit
  • 3. Introduction Inventaires d’espèces traditionnels Inventaires basés sur l’identification moléculaire (ADN)  Reposent sur l’identification morphologique • Expertise • Impossible à certains stades biologiques • Parfois subjectifs  Standardisation difficile entre groupes  Parfois coûteux à cause du temps passé sur le terrain ou des technologies utilisées Différenciation difficile!
  • 4. Introduction  « ADN pouvant être extrait à partir d'échantillons environnementaux sans avoir besoin d'isoler au préalable d’individus cibles » (Taberlet et al. 2012)  ADN libéré dans l’environnement par l’intermédiaire de fèces, d’urine, de gamètes, de mucus, de salive, etc. Définition de l’ADN environnemental
  • 5. Introduction Historique de l’ADNe 0 2000 4000 6000 8000 10000 12000 1985 1995 2000 2005 2010 20151990 Microbiologie Première référence Reconstruction paléocommunautés Détection dans l’eau Régimes alimentaires Forte croissance études ADNe macroorganismes Première étude metabarcoding Nb publications ADNe / an
  • 6. Introduction  ADNe Barcoding : étude d’une espèce cible Deux approches possibles qPCRExtraction d’ADN Polymerase Chain Reaction en temps réel Présence / absence espèce cible Amplification avec un couple d’amorces spécifique Fluorescence Nombre de cycles
  • 7. Introduction  ADNe Metabarcoding : étude de l’ensemble des espèces d’un groupe taxonomique donné Deux approches possibles Séquençage Nouvelle Génération Liste d’espèces présentes Base de données référence PCRExtraction d’ADN Polymerase Chain Reaction Amplification avec un couple d’amorces universelles
  • 8. Introduction Information fournie par le metabarcoding Chartreuse Grenoble Espèce Séquence ADN Site 1 Site 2 Site 1 Site 2 Aporrectodea icterica catcttaatgaagactaaaacttcactaaa 836954 649677 834031 1359355 Aporrectodea longa tattttaacaaaaacccaaaaattttcaataaa 2 6 244463 271829 Aporrectodea sp cattttaataaaaattataaattttactaaa 0 0 236024 236678 Octolasion cyaneum cattttaatagaagcttactattctaataaa 468462 3823 0 2 Lumbricus terrestris aatttaaataaatataaaaaatttactaaa 0 0 174286 143682 Octolasion tyrtaeum cattttaatagaaaaataatatcctaataaa 306476 0 0 2 Lumbricus castaneus aatttaaataaatataaaaaaatttactaaa 0 0 56 131001 Aporrectodea longa tattttaacaaaacccaaaaattttcaataaa 2469 105312 159 145 Allobophora chlorotica cattttaataaagatataaactttactaaa 0 0 51953 43196 Aporrectodea caliginosa tattttaataaaaaaatataaatttttaataa 0 23005 0 0 Exemple des vers de terre : liste d’espèces et nombre de séquences correspondantes
  • 9. Introduction  L’ADN environnemental exige des contrôles qualités très élevés sur l’ensemble des procédés mis en œuvre :  Protocoles et matériels d’échantillonnage  Protocoles d’analyse laboratoire et Bioinformatique  Equipement et organisation des laboratoires Des exigences qualité poussées