Organisation du Génome humain 
Notions essentielles 
Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion 
« Ho...
Organisation du Génome humain 
Notions essentielles 
Martin Krahn 
martin.krahn@ap-hm.fr 
Département de Génétique Médical...
Organisation du Génome humain 
Notions essentielles 
Quelques rappels historiques 
Séquençage du Génome humain 
Organisati...
Génome 
= ensemble du matériel génétique 
d'une espèce (ADN) 
≠ ensemble des gènes !!! 
! 
M. KRAHN M2 2009
Pourquoi cartographier le génome ? 
 Clonage positionnel : 
identification de gènes par exploration du génome suivant un 
...
Histoire 
• De l’Antiquité au 19e siècle : transmission de 
caractères parents-enfants selon diverses théories: 
préformis...
Histoire 
• 1953: J. Watson, F. Crick et R. Franklin décryptent des 
clichés de diffraction et publient la structure en do...
Histoire 
• Années 1980: découverte des marqueurs 
polymorphiques, des techniques de RFLP, des 
microsatellites, grands pr...
Histoire 
• 2000: premiers résultats de thérapie génique sur l’homme 
(Fischer) 
• 2001: premier assemblage de la séquence...
HUGO – Human Genome Project 
• Plus grand projet scientifique mondial lancé en 1988/1989 
HGP démarre en 1990 
• Ampleur d...
HUGO - HGP CELERA 
HGP / Celera 
M. KRAHN M2 2009
Séquence finale 
• CELERA: Seuls 2 ADN ont servi de matrice (dont celui de C. 
Venter). Celera a intégré les données publi...
Coûts de séquençage 
M. KRAHN M2 2009
Organisation du génome humain 
1/3 2/3 
3% code des protéines 
50% séquences répétées M. KRAHN M2 2009
Le génome humain 
• Le génome humain est composé de 
3 272 millions de nucléotides 
• Les régions riches en gènes sont éga...
Le génome humain 
• Le nombre total de gènes se situe entre 25 000 et 30 000 
• La taille moyenne d’un gène est de 
3000 b...
Organisation du Génome 
Vitesse de réassociation du génome 
On dénature l'ADN par chauffage 
On mesure la vitesse de réhyb...
Vitesse de réassociation du génome 
% de réhybridation 
100 
75 
50 
25 
0 
E. Coli 
10-2 10-1 1 101 102 
Rapide Lente 
Vi...
Le génome est hétérogène 
• Zones fortement répétitives 
 10 à 15% du génome, non codées en protéines 
Centromères, Télomè...
Les zones répétitives 
Les minisatellites ou VNTR (Variable Numbers of Tandem Repeats): 
- séquences de 11 à 16 pb 
- répé...
Marqueurs génétiques 
• Les MARQUEURS génétiques: 
Variations polymorphes de la séquence d’ADN 
- répartis uniformément su...
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
M. KRAHN M2 2009
Et maintenant ? 
Clonage positionnel révolu – gènes localisés 
Agronomie dopée – OGM par analyse QTL 
Catalogue des gènes:...
Analyses génomiques 
en pathologie humaine 
M. KRAHN M2 2009
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
? 
M. KRAHN ...
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
 Délétions 
...
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
METHODES D’A...
Anomalies du Génome et 
Pathologie humaine 
MACROLESIONS MICROLESIONS 
Echelle du Chromosome Echelle du Gène 
CARYOTYPE ME...
Rappel: Mutations « classiques » 
Exon Intron 
5´ CAAT TATA ATG 
3´ 
Région 5´UTR 
Mutations en séquence non codante: 
per...
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interpré...
Les avancées méthodologiques qui ont 
révolutionné la génétique moléculaire 
1970: Endonucléases de restriction 
1972-1973...
Principes des Études Moléculaires en 
Génétique Humaine 
Transcription Traduction 
ADN 
Génome 
ARN 
Transcriptome 
Protéi...
Principes des Études Moléculaires en 
Génétique Humaine 
En principe identique 
pour toutes les cellules d’un individu 
AD...
Principes des Études Moléculaires en 
ADN 
Génome 
ARN 
Transcriptome 
Protéines 
Protéome 
En principe identique 
pour to...
Notions essentielles 
• Stratégies de Diagnostic génétique 
- Diagnostic direct vs indirect 
- Précriblage mutationnel 
• ...
Stratégie diagnostique dans les 
maladies génétiques 
CONSULTATION DIAGNOSTIQUE: 
Interrogatoire et examen clinique Histoi...
Stratégie diagnostique dans les 
maladies génétiques 
CONSULTATION DIAGNOSTIQUE: 
Interrogatoire et examen clinique Histoi...
Diagnostic moléculaire 
des maladies génétiques 
 Objectif: établir un diagnostic précis par l’identification 
de l’anomal...
Rappel: le rôle central de la PCR 
ADN du patient en faible quantité 
Région d’intérêt 
PCR Région d’intérêt 
AMPLIFIEE 
e...
Séquençage complet 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
Gène de 3 exons 
PRECRIBLAGE puis Séquençage ciblé 
- Dif...
Diagnostic direct et Diagnostic indirect 
Analyses en 
Génétique moléculaire 
DIAGNOSTIC DIRECT 
Patient atteint 
Phénotyp...
Diagnostic indirect 
Utilisation de marqueurs pour analyser la 
coségrégation marqueur/maladie 
• on connaît la localisati...
Diagnostic indirect 
Utilisation de marqueurs pour analyser la 
coségrégation marqueur/maladie 
• on connaît la localisati...
Diagnostic moléculaire indirect 
Principes 
105 113 
Marqueur 
105 115 
113 115 
105 115 
Étude de microsatellites. 
Exemp...
Diagnostic moléculaire indirect 
Principes 
Étude de microsatellites. 
Exemple: étude familiale, maladie autosomique domin...
Diagnostic moléculaire indirect 
Principes 
Allèle 105 Allèle 115 
Étude de microsatellites. 
Exemple: étude familiale, ma...
Diagnostic direct 
DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire 
 identification de mutations constitutio...
Diagnostic moléculaire direct 
Stratégie 
Patient atteint 
Phénotype: diagnostic clinique 
Ou suspicion diagnostique 
Gène...
Diagnostic moléculaire direct 
Exemple: gène de petite taille 
• Gène de la cavéoline-3 (CAV3) : 
localisé en 3p25 
séquen...
Diagnostic moléculaire direct 
Exemple: gène de petite taille 
• Gène de la cavéoline-3 (CAV3) : 
localisé en 3p25 
séquen...
Diagnostic moléculaire direct 
Exemple: gène de grande taille 
• Gène de la dysferline (DYSF) : 
localisé en 2p13.3-13.1 
...
Diagnostic moléculaire direct 
Exemple: gène de grande taille 
Patient IVS 6 
c.946-1GA 
Patient Exon 17 
c.1979AG 
Profil...
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Comparaison à séquence de référence 
- UCSC Geno...
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interpré...
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HG...
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HG...
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HG...
Consultation de bases de données 
Mutation rapportée au préalable ? 
Human Genome Variation Society 
www.hgvs.org 
Porte d...
Diagnostic moléculaire direct 
Identification de variations de séquence 
 Description précise du variant : NOMENCLATURE HG...
Diagnostic moléculaire direct 
Variation de séquence non connue au préalable 
Mutation délétère ou Polymorphisme? 
? 
M. K...
Diagnostic moléculaire direct 
Variation de séquence non connue au préalable 
Mutation délétère ou Polymorphisme? 
 (Consu...
Modélisation bio-informatique 
Analyse de l’effet sur l’épissage/l’ARNm 
Epissage anormal, dégradation,.. 
Analyse de la c...
Problématiques des études 
moléculaires en génétique humaine 
• Stratégies de Diagnostic génétique 
• Problèmes d’interpré...
Rappel: Mutations « classiques » 
Exon Intron 
5´ CAAT TATA ATG 
3´ 
Région 5´UTR 
Mutations en séquence non codante: 
per...
Séquençage complet 
Mutation ponctuelle 
Exon 1 
Exon 2 
Exon 3 
Gène de 3 exons 
PRECRIBLAGE puis Séquençage ciblé 
- Dif...
Suspicion d’une pathologie particulière 
…sans identification de mutations 
Exemple: Maladies autosomiques récessives 
Sen...
Réarrangements intragéniques de grande taille 
Délétions/Amplifications exoniques 
Parfois détectées de manière fortuite 
...
Diagnostic moléculaire de routine 
Moyens actuels et Perspectives 
Techniques de criblage mutationnel « efficaces » 
Outil...
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
CGH Arrays 
 ADN génomique non amplifié 
Patient e...
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
CGH Arrays 
2.1M 
385K 
4-plex 12-plex 
4 x 70 K 1...
DYSF CGH arrays 
Duplication hétérozygote exons 37+38 (+39) 
71684074-71693259 
Nimblegen-Roche 
Délétion homozygote exons...
DYS et SGC CGH arrays 
gSarcoglycan 
LGMD2C 
Dystrophin 
DMD 
Saillour et al, 2008 M. KRAHN M2 2009
Séquençage à haut débit 
400000 lectures 
Fragments de 250-300bp 
500Mb de séquence/run 
Couverture 15x/région 
5Mb de séq...
Sequence Capture arrays et Séquençage à haut débit 
Séquençage à haut débit 
5Mb de séquence interprétable / run 
Nimblege...
2.1M 
4-plex 1-plex 
12-plex 
4 x 70 K 1 x 2.1 M 
12 x 135 K 
385K 
1-plex 
1 x 385 K 
Nimblegen-Roche 
Sequence Capture a...
Nouvelles technologies d’analyse 
mutationnelle génomique à haut débit 
PERSPECTIVES 
Criblage mutationnel à haut débit en...
Diagnostic moléculaire 
PERSPECTIVES 
Procédure actuelle 
Approche « gène par gène » 
Procédure future 
Approche « haut dé...
Conclusion – Notions essentielles 
• Stratégies de Diagnostic génétique 
- Diagnostic direct vs indirect 
- Précriblage mu...
Prochain SlideShare
Chargement dans…5
×

M krahn organisation_genome_et_analyses_genomiques_2009

631 vues

Publié le

0 commentaire
2 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

Aucun téléchargement
Vues
Nombre de vues
631
Sur SlideShare
0
Issues des intégrations
0
Intégrations
3
Actions
Partages
0
Téléchargements
36
Commentaires
0
J’aime
2
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

M krahn organisation_genome_et_analyses_genomiques_2009

  1. 1. Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion « How to sequence a genome » (film): www.genome.gov/25019885 Human Genome Project: http://www.genome.gov/HGP/ Analyses génomiques en pathologie humaine Problématiques des études moléculaires en génétique humaine Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion Human Genome Variation Society: www.hgvs.org Nomenclature mutationnelle: www.hgvs.org/mutnomen Analyse de variants faux-sens: http://genetics.bwh.harvard.edu/pph/ Analyse de l’effet de variants de séquence sur l’épissage: www.umd.be/HSF/ Bases de données: Bases de données « locus-spécifiques » Listing disponible site HGVS www.hgvs.org/dblist/glsdb.html Bases de données « centrales/globales » Human Gene Mutation Database www.hgmd.org SNP database www.ncbi.nlm.nih.gov/SNP/ UCSC Genome Browser genome.ucsc.edu Ensembl www.ensembl.org Dr. Martin Krahn martin.krahn@ap-hm.fr Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR 910 - Faculté de Médecine Université de la Méditerranée Marseille
  2. 2. Organisation du Génome humain Notions essentielles Martin Krahn martin.krahn@ap-hm.fr Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR 910 - Faculté de Médecine Université de la Méditerranée Marseille
  3. 3. Organisation du Génome humain Notions essentielles Quelques rappels historiques Séquençage du Génome humain Organisation du Génome humain M. KRAHN M2 2009
  4. 4. Génome = ensemble du matériel génétique d'une espèce (ADN) ≠ ensemble des gènes !!! ! M. KRAHN M2 2009
  5. 5. Pourquoi cartographier le génome ? Clonage positionnel : identification de gènes par exploration du génome suivant un balisage de marqueurs Médecine: pour localiser les loci morbides, associés à des maladies héréditaires, voire pour appréhender les maladies multifactorielles Depuis les premières cartes, plus de 2500 gènes impliqués dans des syndromes héréditaires ont été identifiés (OMIM, sept.2009) Cette phase est suivie d’exploration thérapeutique (voir site essais cliniques AFM) Agronomie: pour localiser et cloner les gènes d’intérêt ou les zones du génome impliquées dans des traits intéressants et les transférer entre espèces… Bond des biotechnologies végétales, clonage, OGM… M. KRAHN M2 2009
  6. 6. Histoire • De l’Antiquité au 19e siècle : transmission de caractères parents-enfants selon diverses théories: préformisme, animalculisme, patroclinisme, ovisme, épigénisme… • 1865: G. Mendel jette les bases de la génétique moderne, allèles, dominance, hétérozygotie… • 1910: T. Morgan découvre la recombinaison méiotique et publie ses résultats qui sont les bases de la théorie chromosomique de l’hérédité • 1913: première carte génétique M. KRAHN M2 2009
  7. 7. Histoire • 1953: J. Watson, F. Crick et R. Franklin décryptent des clichés de diffraction et publient la structure en double hélice de l’ADN • 1965: J. Monod, F. Jacob et A. Lwoff « découvrent » les ARN et la régulation de l’expression génique • 1973: moratoire sur le clonage et le génie génétique M. KRAHN M2 2009
  8. 8. Histoire • Années 1980: découverte des marqueurs polymorphiques, des techniques de RFLP, des microsatellites, grands progrès du génie génétique. Cartographie intensive • 1983: découverte de la PCR. Les cartes s’enrichissent de toutes ces techniques • 1989: un programme mondial de séquençage du génome humain se met en place : HUGO • 1992-1996: publication des premières cartes du génome humain par le Généthon M. KRAHN M2 2009
  9. 9. Histoire • 2000: premiers résultats de thérapie génique sur l’homme (Fischer) • 2001: premier assemblage de la séquence du génome humain (Science 291, Nature 409) • 2003: finition de l’assemblage de notre séquence génomique CELERA HUGO-HGP M. KRAHN M2 2009
  10. 10. HUGO – Human Genome Project • Plus grand projet scientifique mondial lancé en 1988/1989 HGP démarre en 1990 • Ampleur de la tâche – 1 page = 3000 bases – 1 tome: 500 pages = 1 500 000 bases – 1 génome = 1 000 tomes !!! • Capacité de séquençage – En 1975, 1 000 nucléotides/semaine 500 ans pour 100 personnes ! – En 1986, 10 000 nucléotides/jour 8 ans pour 100 machines – En 1998, 200 000 nucléotides/jour 5 mois pour 100 machines • Stratégie du Human Genome Project vs Stratégie de CELERA Genomics M. KRAHN M2 2009
  11. 11. HUGO - HGP CELERA HGP / Celera M. KRAHN M2 2009
  12. 12. Séquence finale • CELERA: Seuls 2 ADN ont servi de matrice (dont celui de C. Venter). Celera a intégré les données publiques dans sa base au fur et à mesure de leur publication • HGP: profondeur de séquence: 10X (10 équivalents génomiques séquençés) à partir de près d'une vingtaine d'individus différents • Travail de finition poursuivi jusqu'en avril 2003 • Précision finale: 99.99 % = 1 erreur toutes les 10 000 bases environ • Coût global: environ 2.7 milliards $ • Parties manquantes: hétérochromatine, télomères et centromères M. KRAHN M2 2009
  13. 13. Coûts de séquençage M. KRAHN M2 2009
  14. 14. Organisation du génome humain 1/3 2/3 3% code des protéines 50% séquences répétées M. KRAHN M2 2009
  15. 15. Le génome humain • Le génome humain est composé de 3 272 millions de nucléotides • Les régions riches en gènes sont également les régions riches en nucléotides G/C • Les régions pauvres en gènes sont riches en A/T Ces différentes régions peuvent généralement être visualisées comme des bandes claires ou sombres sur les chromosomes métaphasiques (banding) Bandes G: riches en AT, pauvres en gènes Bandes R: riches en GC, riches en gènes • Le chromosome 1 contient le plus grand nombre de gènes estimés (environ 3000) tandis que le chromosome Y en a le moins (231) • Moins de 3% de l’ADN code pour des protéines • Les séquences répétées composent environ 50% de la totalité du génome M. KRAHN M2 2009
  16. 16. Le génome humain • Le nombre total de gènes se situe entre 25 000 et 30 000 • La taille moyenne d’un gène est de 3000 bases, 9 exons, mais la taille varie beaucoup (ex : le gène de la dystrophine a une taille de 2,4 millions bp) • 99.9% des nucléotides sont identiques entre deux personnes. Il existe donc 0,1% de différences (soit environ 3,5 millions de différences par génome) • Plus de 50% des gènes ont une fonction inconnue M. KRAHN M2 2009
  17. 17. Organisation du Génome Vitesse de réassociation du génome On dénature l'ADN par chauffage On mesure la vitesse de réhybridation L'ADN d'E. coli se réhybride suivant une courbe sigmoïde simple quand un fragment d'ADN trouve son fragment complémentaire, les séquences adjacentes se réhybrident rapidement de façon coopérative, comme une fermeture éclair M. KRAHN M2 2009
  18. 18. Vitesse de réassociation du génome % de réhybridation 100 75 50 25 0 E. Coli 10-2 10-1 1 101 102 Rapide Lente Vitesse de réassociation H. Sapiens 1 3 2 M. KRAHN M2 2009
  19. 19. Le génome est hétérogène • Zones fortement répétitives 10 à 15% du génome, non codées en protéines Centromères, Télomères, Mégasatellites, Minisatéllites, Microsatellites • Zones moyennement répétitives 20 à 40 % du génome, non codées en protéines Transposons, séquences SINE (Alu) et LINE, Rétrovirus endogènes Quelques gènes codant des rRNA, tRNA, RNA5S et 7SL • Séquences uniques ~50% du génome, contiennent la plupart des gènes codant pour des protéines (ARNm) M. KRAHN M2 2009
  20. 20. Les zones répétitives Les minisatellites ou VNTR (Variable Numbers of Tandem Repeats): - séquences de 11 à 16 pb - répétées parfois jusqu'à 1000 fois - Localisations surtout télomériques (ou centromériques) - peu utilisés en pratique Les microsatellites - séquences de 1 à 4 pb - souvent (CA)n, n variant de 12 à 40. - répartition homogène sur tout le génome, tous les 25 à 100 kb - très variables donc informatifs - facilement amplifiés par PCR - utilisation pour les analyses de liaison - utilisation en diagnostic moléculaire (« indirect ») et pour les empreintes génétiques M. KRAHN M2 2009
  21. 21. Marqueurs génétiques • Les MARQUEURS génétiques: Variations polymorphes de la séquence d’ADN - répartis uniformément sur le génome - localisation connue - PAS d’effet direct sur le phénotype • Microsatellites (utilisés ++) : Polymorphismes de répétition Exple: répétitions de motif « CA » - séquences répétées NON codantes - réparties uniformément dans le génome - polymorphes = à un même endroit du génome, des individus pris au hasard (pop.gén.) présentent un nombre différent de répétitions sur chaque chromosome Exemple: chromosome 4 …ATCGTCTCACACACACACACACATGTCGTAT… …ATCGTCTCACACACACACACACACACACACATGTCGTAT… 8 répétitions CA 12 répétitions CA ADN Marqueur Gène M. KRAHN M2 2009
  22. 22. Et maintenant ? M. KRAHN M2 2009
  23. 23. Et maintenant ? M. KRAHN M2 2009
  24. 24. Et maintenant ? M. KRAHN M2 2009
  25. 25. Et maintenant ? Clonage positionnel révolu – gènes localisés Agronomie dopée – OGM par analyse QTL Catalogue des gènes: GenAtlas, OMIM, Genome Browser, bases de données de SNP, de miARN… Séquençage en masse d'autres organismes Cartes de synténie inter-espèces, évolution Séquençage personnalisé possible Nouvelles technologies mêlant bioinformatique, robotique et nanobiologie… Thérapie génique, pharmacologique ou cellulaire utilisant les données acquises… M. KRAHN M2 2009
  26. 26. Analyses génomiques en pathologie humaine M. KRAHN M2 2009
  27. 27. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène ? M. KRAHN M2 2009
  28. 28. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène Délétions Duplications Amplifications Translocations Inversions Insertions (...) Mutations ponctuelles Insertions/délétions de qques nucléotides Insertions/délétions de qques 10aines ou 100aines de nt Mutations dynamiques/amplifications (...) Maladies génétiques: anomalies génétiques causales Maladies polyfactorielles: prédisposition génétique M. KRAHN M2 2009
  29. 29. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène METHODES D’ANALYSE ? M. KRAHN M2 2009
  30. 30. Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome Echelle du Gène CARYOTYPE METHODES D’ANALYSE FISH CGH CRIBLAGE MUTATIONNEL SEQUENCAGE M. KRAHN M2 2009
  31. 31. Rappel: Mutations « classiques » Exon Intron 5´ CAAT TATA ATG 3´ Région 5´UTR Mutations en séquence non codante: perturbations d‘éléments régulateurs mutations perturbant l‘épissage Région 3´UTR TAA TAG TGA AATAAA Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l‘épissage = perte/gain de fonction GT AG Site donneur Site accepteur M. KRAHN M2 2009
  32. 32. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  33. 33. Les avancées méthodologiques qui ont révolutionné la génétique moléculaire 1970: Endonucléases de restriction 1972-1973: Ligases 1975: Séquençage (SangerCoulon, MaxamGilbert, Hood) 1985: PCR (Karry Mullis) 1998: Puces à ADN (“microarrays”) Années 1990 à aujourd’hui: Développement +++ de nouvelles techniques Les applications/progrès réalisées grâce aux techniques de Biologie moléculaire: • Meilleure connaissance des mécanismes physiopathologiques des maladies: - Identification et études fonctionnelles de gènes impliqués dans des maladies humaines, création et analyse de modèles animaux, séquençage du génome humain,,… • Généralisation des applications diagnostiques en routine hospitalière M. KRAHN M2 2009
  34. 34. Principes des Études Moléculaires en Génétique Humaine Transcription Traduction ADN Génome ARN Transcriptome Protéines Protéome Reverse Transcription Réplication Analyses génétiques/ Biologie moléculaire Biochimie M. KRAHN M2 2009
  35. 35. Principes des Études Moléculaires en Génétique Humaine En principe identique pour toutes les cellules d’un individu ADN Génome ARN Transcriptome Spécifiques d’un tissu d’un type cellulaire d’un état Protéines Protéome Analyses génétiques/ Biologie moléculaire Biochimie M. KRAHN M2 2009
  36. 36. Principes des Études Moléculaires en ADN Génome ARN Transcriptome Protéines Protéome En principe identique pour toutes les cellules d’un individu Spécifiques d’un tissu d’un type cellulaire d’un état Prélèvement de « base » en Génétique = prélèvement sanguin périphérique Extraction d’ADN génomique à partir de LYMPHOCYTES du sang Analyses en Génétique moléculaire: Directes ou Indirectes Autres prélèvements: •Tissus embryonnaires/foetaux (villosités choriales, liquide amniotique,…) pour DPN • Autres tissus: analyses complémentaires dans certaines pathologies (surtout analyses d’expression du ARNm) ATTENTION: Toujours avec CONSENTEMENT de l’individu Génétique Humaine M. KRAHN M2 2009
  37. 37. Notions essentielles • Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel • Problèmes d’interprétation de données mutationnelles - Bases de données mutationnelles - Variants « nouveaux » = recueil d’arguments de pathogénicité - Outils bioinformatiques ++ • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  38. 38. Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE M. KRAHN M2 2009
  39. 39. Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE ⇒ DIAGNOSTIC GENETIQUE ANALYSES GENETIQUES: Génétique moléculaire: Diagnostic direct: Recherche de l’anomalie génétique primaire Diagnostic indirect: Analyses de liaison Cytogénétique: Caryotype constitutionnel standard FISH,… (Cf cours) M. KRAHN M2 2009
  40. 40. Diagnostic moléculaire des maladies génétiques Objectif: établir un diagnostic précis par l’identification de l’anomalie génétique Intérêt: certitude diagnostique prise en charge adaptée conseil génétique 2 approches: DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire identification de Mutations constitutionnelles délétères DIAGNOSTIC INDIRECT: Analyses de liaison Utilisation de marqueurs pour analyser la coségrégation d’un phénotype avec un allèle particulier dans une famille M. KRAHN M2 2009
  41. 41. Rappel: le rôle central de la PCR ADN du patient en faible quantité Région d’intérêt PCR Région d’intérêt AMPLIFIEE en grande quantité ANALYSE de la région d’intérêt Analyse de la SEQUENCE Recherche de MUTATIONS dans la région d’intérêt Analyse de la TAILLE Applications diverses Analyse de Microsatellites Gène de 3 exons Exon 1 Exon 2 Exon 3 M. KRAHN M2 2009
  42. 42. Séquençage complet Mutation ponctuelle Exon 1 Exon 2 Exon 3 Gène de 3 exons PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM,… - Intérêt: détecter les exons porteurs d’une variation de séquence Mutation ponctuelle Exon 1 Exon 2 Exon 3 = réduction du temps d’analyse et des coûts Profil NORMAL Profil ANORMAL Profil NORMAL M. KRAHN M2 2009
  43. 43. Diagnostic direct et Diagnostic indirect Analyses en Génétique moléculaire DIAGNOSTIC DIRECT Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique CAACANNNNNNNNNNNNN Forw. Identification de mutation(s) dans le gène impliqué Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Patient atteint Phénotype: diagnostic clinique (certitude diagnostique nécessaire) 105 113 105 115 113 115 105 115 Coségrégation familiale phénotype/marqueur M. KRAHN M2 2009
  44. 44. Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie • on connaît la localisation du gène morbide • on connaît des marqueurs localisés à proximité • étude de la Coségrégation familiale phénotype/marqueur Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Marqueur Patient atteint Avec Diagnostic clinique CERTAIN 105 113 105 115 113 115 105 115 Coségrégation familiale phénotype/marqueur Gène morbide Permet de suivre INDIRECTEMENT la transmission d’une mutation M. KRAHN M2 2009
  45. 45. Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie • on connaît la localisation du gène morbide • on connaît des marqueurs localisés à proximité • étude de la Coségrégation familiale phénotype/marqueur Marqueur Gène morbide Permet de suivre INDIRECTEMENT la transmission d’une mutation Approche utilisée quand diagnostic direct non faisable, trop difficile… Principaux problèmes posés: - nécessite de connaître le gène impliqué (ou le locus) pour choisir les marqueurs à utiliser (problème posé si hétérogénéité génétique) - nécessite une certitude du diagnostic clinique - nécessite une étude FAMILIALE - nécessite une famille « informative »: parfois non concluant - risque d’erreur par recombinaison M. KRAHN M2 2009
  46. 46. Diagnostic moléculaire indirect Principes 105 113 Marqueur 105 115 113 115 105 115 Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante Gène morbide M. KRAHN M2 2009
  47. 47. Diagnostic moléculaire indirect Principes Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante 105 113 105 115 105 115 Étude de la Coségrégation familiale phénotype/marqueur Marqueur Gène morbide Phénotype atteint Allèles 105 et 113 Phénotype sain Allèles 105 et 115 Phénotype sain Phénotype atteint Allèles 105 et 115 Allèles 113 et 115 113 115 NB: Diagnostic indirect nécessite - Certitude du diagnostic clinique - Étude familiale L’enfant atteint a reçu l’allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause M. KRAHN M2 2009
  48. 48. Diagnostic moléculaire indirect Principes Allèle 105 Allèle 115 Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante 105 113 105 115 113 115 105 115 Étude de la Coségrégation familiale phénotype/marqueur Gène morbide Phénotype atteint Allèles 105 et 113 Phénotype sain Allèles 105 et 115 Allèle 105 Allèle 113 Mutation dans le gène impliqué * Chez le père, l’allèle 113 du marqueur est sur le même chromosome que la mutation impliquée dans la maladie Allèle 105 Allèle 113 Phénotype atteint Allèles 113 et 115 * Phénotype sain Allèles 105 et 115 Allèle 105 Allèle 115 Marqueur Lorsque le père transmet le chromosome avec la mutation, il transmet AUSSI l’allèle 113 ⇒ Permet de suivre indirectement la transmission de la mutation L’enfant atteint a reçu l’allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE « atteint » et l’allèle 113 paternel L’allèle 113, d’origine paternelle est lié à l’allèle muté du gène en cause M. KRAHN M2 2009
  49. 49. Diagnostic direct DIAGNOSTIC DIRECT: Recherche de l’anomalie génétique primaire identification de mutations constitutionnelles délétères approche utilisée de préférence, permet un diagnostic de certitude principaux problèmes posés: - parfois lourd sur le plan technique - parfois non concluant - polymorphismes ou mutations constitutionnelles délétères? Analyses en Génétique moléculaire DIAGNOSTIC DIRECT Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique CAACANNNNNNNNNNNNN Forw. Identification de mutation dans le gène impliqué M. KRAHN M2 2009
  50. 50. Diagnostic moléculaire direct Stratégie Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique Gène impliqué de GRANDE TAILLE +/- Spectre mutationnel large Précriblage mutationnel Gène impliqué de PETITE TAILLE et/ou mutations récurrentes Séquençage complet trop lourd et trop coûteux Profil ANORMAL Séquençage ciblé des exons présentant des profils anormaux Séquençage complet de la totalité de la séquence codante d’intérêt (tous les exons codants) • techniques permettant d’identifier les exons présentant des variations de séquence • mais SANS préciser quelle est la variation de séquence • ORIENTATION Identification de variations de séquence Mutation ponctuelle M. KRAHN M2 2009
  51. 51. Diagnostic moléculaire direct Exemple: gène de petite taille • Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d’ expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante M. KRAHN M2 2009
  52. 52. Diagnostic moléculaire direct Exemple: gène de petite taille • Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d’ expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante • Gène de petite taille: analyse « facile » par séquençage direct Contrôle Patient Confirmation du diagnostic par IDENTIFICATION directe de la mutation For. For. c.298AT hétérozygote p.Ile100Phe M. KRAHN M2 2009
  53. 53. Diagnostic moléculaire direct Exemple: gène de grande taille • Gène de la dysferline (DYSF) : localisé en 2p13.3-13.1 séquence codante de 6243 paires de bases (55 exons) ARNm d’ expression musculaire (et autres tissus) Protéine impliquée dans la réparation de la membrane musculaire (?) • Mutations DYSF : dystrophie musculaire des ceintures autosomique récessive 400 mutations différentes rapportées réparties sur toute la longueur du gène = « Spectre mutationnel large » • Gène de grande taille +/- spectre mutationnel large: Analyse par séquençage complet techniquement trop lourd et trop coûteux: NON faisable Utilisation de techniques de PREcriblage mutationnel M. KRAHN M2 2009
  54. 54. Diagnostic moléculaire direct Exemple: gène de grande taille Patient IVS 6 c.946-1GA Patient Exon 17 c.1979AG Profil hétéroduplex évident dHPLC dHPLC Profil hétéroduplex difficilement mis en évidence Séquençage Séquençage M. KRAHN M2 2009
  55. 55. Diagnostic moléculaire direct Identification de variations de séquence Comparaison à séquence de référence - UCSC Genome Browser genome.ucsc.edu - Ensembl www.ensembl.org Description précise du variant : NOMENCLATURE HGVS www.hgvs.org/mutnomen Nomenclature officielle Human Genome Variation Society Mutations délétères ou Variations de séquence non pathogènes ? M. KRAHN M2 2009
  56. 56. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  57. 57. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  58. 58. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d’autres patients Mutation constitutionnelle délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  59. 59. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: Séance ED Analyses mutationnelles en Génétique Humaine la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d’autres patients Mutation constitutionnelle délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N’EST PAS connue M. KRAHN M2 2009
  60. 60. Consultation de bases de données Mutation rapportée au préalable ? Human Genome Variation Society www.hgvs.org Porte d’entrée pour les Bases de données mutationnelles Bases de données « locus-spécifiques » Listing disponible site HGVS www.hgvs.org/dblist/glsdb.html Bases de données « centrales/globales » Human Gene Mutation Database www.hgmd.org SNP database www.ncbi.nlm.nih.gov/SNP/ UCSC Genome Browser genome.ucsc.edu Ensembl www.ensembl.org M. KRAHN M2 2009
  61. 61. Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère… ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N’EST PAS connue - Évaluation de différentes données pour conclure sur le caractère pathogène ou non de la variation de séquence - Saisie des résultats dans les bases de données M. KRAHN M2 2009
  62. 62. Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme? ? M. KRAHN M2 2009
  63. 63. Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme? (Consultation de bases de données) Nature de la mutation (non-sens, décalage cadre de lecture, épissage, faux-sens, isosémantique,…) Étude de la ségrégation de la variation de séquence à l’intérieur de la famille Recherche de la variation dans une population de témoins sains - absence = en faveur du caractère délétère - présence = polymorphisme probable Études fonctionnelles: transcriptionnelles, protéiques,… Plus difficile, parfois plutôt domaine de la recherche Modélisation bio-informatique: - de l’effet sur l’épissage/l’ARNm - de la conservation du nucléotide impliqué (et AA correspondant) au cours de l’évolution - de l’effet au niveau de la protéine M. KRAHN M2 2009
  64. 64. Modélisation bio-informatique Analyse de l’effet sur l’épissage/l’ARNm Epissage anormal, dégradation,.. Analyse de la conservation du nucléotide impliqué (et AA correspondant) au cours de l’évolution = Surtout pour variants faux-sens, isosémantiques et introniques) - Conservé = important, donc une variation est susceptible d’être délétère - Non conservé = moins important, une variation est possible sans effet majeur Analyse de l’effet au niveau de la protéine Domaines fonctionnels, protéine tronquée,… M. KRAHN M2 2009
  65. 65. Problématiques des études moléculaires en génétique humaine • Stratégies de Diagnostic génétique • Problèmes d’interprétation de données mutationnelles • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009
  66. 66. Rappel: Mutations « classiques » Exon Intron 5´ CAAT TATA ATG 3´ Région 5´UTR Mutations en séquence non codante: perturbations d‘éléments régulateurs mutations perturbant l‘épissage Région 3´UTR TAA TAG TGA AATAAA Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l‘épissage = perte/gain de fonction GT AG Site donneur Site accepteur M. KRAHN M2 2009
  67. 67. Séquençage complet Mutation ponctuelle Exon 1 Exon 2 Exon 3 Gène de 3 exons PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM,… - Intérêt: détecter les exons porteurs d’une variation de séquence Mutation ponctuelle Exon 1 Exon 2 Exon 3 = réduction du temps d’analyse et des coûts Profil NORMAL Profil ANORMAL Profil NORMAL M. KRAHN M2 2009
  68. 68. Suspicion d’une pathologie particulière …sans identification de mutations Exemple: Maladies autosomiques récessives Sensibilité insuffisante des techniques utilisées en routine Quelles mutations ne sont pas détectées par les stratégies « classiques » ? Mutations introniques ? Mutations de régions régulatrices ? Mutations dans exons alternatifs ? Réarrangements intragéniques de grande taille ? (…) Hétérozygotes symptomatiques, digénisme… Mutations dans d’autres gènes Même voie physiopathologique ++ M. KRAHN M2 2009
  69. 69. Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques Parfois détectées de manière fortuite (détection en PCR; variants de séquence pseudo-homozygotes;…) Non détectables de manière systématique avec les techniques « classiques » de criblage mutationnel de la séquence codante génique Exemple: délétion exonique Développement récent de techniques adaptées: - Quantitative multiplex PCR of short fluorescent fragments (QMPSF; Casilli et al., 2002) - Multiplex Ligand-dependant Probe Amplification (MLPA; Shouten et al., 2002) Analyse mono-allélique M. KRAHN M2 2009
  70. 70. Diagnostic moléculaire de routine Moyens actuels et Perspectives Techniques de criblage mutationnel « efficaces » Outils bio-informatiques : - Bases de données mutationnelles - Algorithmes d’analyse de variants de séquence … mais sensibilité insuffisante des techniques d’analyse Mutations non détectées par les techniques actuelles de routine Développement de techniques complémentaires Mutations dans d’autres gènes / gènes candidats (…) Nouvelles technologies d’analyse mutationnelle génomique à haut débit Exemples: CGH Microarrays Sequence Capture Arrays et Séquençage à haut débit M. KRAHN M2 2009
  71. 71. Nouvelles technologies d’analyse mutationnelle génomique à haut débit CGH Arrays ADN génomique non amplifié Patient et contrôle Fragmentation aléatoire Marquage avec « random 9mers » - 5’-Cy3 (ADN patient) - 5’-Cy5 (ADN contrôle) et Hybridation sur lame (array) Analyse Capture des signaux fluorescents (Scanner) Analyse des données (Ratio Cy3/Cy5) ADN patient ADN contrôle M. KRAHN M2 2009
  72. 72. Nouvelles technologies d’analyse mutationnelle génomique à haut débit CGH Arrays 2.1M 385K 4-plex 12-plex 4 x 70 K 12 x 135 K M. KRAHN M2 2009
  73. 73. DYSF CGH arrays Duplication hétérozygote exons 37+38 (+39) 71684074-71693259 Nimblegen-Roche Délétion homozygote exons 2 à 40 71562000-71720000 M. KRAHN M2 2009
  74. 74. DYS et SGC CGH arrays gSarcoglycan LGMD2C Dystrophin DMD Saillour et al, 2008 M. KRAHN M2 2009
  75. 75. Séquençage à haut débit 400000 lectures Fragments de 250-300bp 500Mb de séquence/run Couverture 15x/région 5Mb de séquence propre/run Nimblegen-Roche ADN génomique Fragmentation Ligation d’adaptateur Création de microréacteurs par émulsion (billes et fragments ADN) PCR en émulsion Séquençage et analyse M. KRAHN M2 2009
  76. 76. Sequence Capture arrays et Séquençage à haut débit Séquençage à haut débit 5Mb de séquence interprétable / run Nimblegen-Roche Régions cible Fragmentation et ligation d’un « linker » Sélection/Enrichissement en séquence cible (alternative à PCR) Hybridation Élution de la Région d’intérêt Lavages Amplification M. KRAHN M2 2009
  77. 77. 2.1M 4-plex 1-plex 12-plex 4 x 70 K 1 x 2.1 M 12 x 135 K 385K 1-plex 1 x 385 K Nimblegen-Roche Sequence Capture arrays M. KRAHN M2 2009
  78. 78. Nouvelles technologies d’analyse mutationnelle génomique à haut débit PERSPECTIVES Criblage mutationnel à haut débit en routine Analyses de séquence - « Mutations classiques » Substitutions et ins/del de petite taille - Extension de l’analyse aux régions introniques et/ou régions régulatrices (Epissage, 5’UTR, 3’UTR, CNGS, microRNA,…) Anomalies génomiques quantitatives - Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques - Copy Number Variations (…) Analyse de gènes candidats et gènes modificateurs Étapes de validation par techniques complémentaires (Séq. direct, Q-PCR; RT-PCR et Q-RT-PCR, MLPA, Microarrays d’expression,…) M. KRAHN M2 2009
  79. 79. Diagnostic moléculaire PERSPECTIVES Procédure actuelle Approche « gène par gène » Procédure future Approche « haut débit » Orientation clinique anatomopathologique biochimique (…) Orientation clinique anatomopathologique biochimique (…) Un ou quelques gènes Long; 1 semaine à 1 an Coûteux Plusieurs dizaines de gènes Rapide; 72 heures à 1 semaine Réduction des coûts M. KRAHN M2 2009
  80. 80. Conclusion – Notions essentielles • Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel • Problèmes d’interprétation de données mutationnelles - Bases de données mutationnelles - Variants « nouveaux » = recueil d’arguments de pathogénicité - Outils bioinformatiques ++ • Perspectives de criblage mutationnel à haut débit M. KRAHN M2 2009

×