SlideShare une entreprise Scribd logo
1  sur  22
Télécharger pour lire hors ligne
Facteurs génétiques humains
    & paludisme à P. falciparum

         Florence Migot-Nabias

UR 10 « Santé de la mère et de l’enfant »
         IRD, Dakar, Sénégal

Existence d’une régulation génétique des
 réponses immunitaires spécifiques du

Différences individuelles, familiales ou ethniques des
réponses immunitaires contre P. falciparum, dans des
conditions d’exposition identiques

Concordance plus importante entre jumeaux
monozygotes que dizygotes:
   Pour le développement de fièvre lors d’un accès palustre:
   régulation génétique des cytokines pyrogènes
   Pour la production d’anticorps dirigés contre différents
   antigènes plasmodiaux
Système HLA & paludisme

  restriction génétique des réponses lymphocytaires à des épitopes de
  la CSP et de Pf155/RESA

Accès palustre grave:
  Protection contre le neuropaludisme (HLA-B53) et contre l’anémie
  sévère liée au paludisme (HLA-DRB1*1302-DQB1*0501)
  Plus grande susceptibilité au neuropaludisme chez les sujets
  homozygotes ou hétérozygotes pour l’allèle TNF-308A
  Allèle TNF-238A associé (+) à l’anémie sévère liée au paludisme ou (-)
  au neuropaludisme

Accès palustre simple:
  HLA I et II non associés à la résistance aux accès simples
  Présence ou non de relations entre allèles HLA I et II et réponse
  immunitaire à des antigènes des stades sanguins de P. falciparum
Organisation génétique du système HLA

                Classe II           Classe III         Classe I

Centromère du
chromosome 6      D         C4A, C4B, C2 α β           B    C A

  (α2)    α1      (α)                   (α2)      α1        α

     DP           DN         D                   DQ         DR

  (β2)    β1                 (β1)       (β2)      β1   β1   β3    β4
Association peptide/HLA I et reconnaissance par les LyT

                                                                       Ly T cytotoxique

             Lyse de la cellule infectée             TCR          CD

         CPA                                                            Vésicule de sécrétion



  protéine          protéasome    peptide   HLA classe I     β2-microglobuline

                                                      In: « Immunologie », Revillard, 1994
Association peptide/HLA II et reconnaissance par les LyT
•Production d’anticorps par les Ly B
                                                                                Ly T
•Relargage de cytokines induisant la lyse                                       auxiliaire
 des micro-organismes intracellulaires par les macrophages
                             Protéine exogène                 TCR          CD

                                                                                CPA -cytoplasme-
                                                                           Compartiment des
                                                                        molécules HLA classe II
                                                                             Dissociation et
    Endosome                                                            dégradation de la chaîne I

          Réticulum endoplasmique               Golgi

             +       +         =

      I          α       β         αβ + I
                                                             In: « Immunologie », Revillard, 1994
Facteurs non-HLA de régulation

Contribution importante de gènes non liés à la région
HLA dans la régulation génétique des réponses
immunitaires dirigées contre P. falciparum

La région chromosomique 5q31-q33 (gènes de
cytokines, gènes de régulation de la réponse immune)
interviendrait dans le contrôle des niveaux d’infection
par P. falciparum
Polymorphisme érythrocytaire &
Protection clinique
   Trait drépanocytaire, alpha-thalassémie, déficit en G6PD, ovalocytose,
   groupe sanguin ABO, groupe Duffy
Mécanismes proposés
   Modification des antigènes érythrocytaires de surface favorisant la
   reconnaissance immunitaire (alpha-thal)
   Sensibilité accrue au stress oxydant favorisant la phagocytose des
   parasites (déficit G6PD)
   Ralentissement de la croissance parasitaire dans les hématies
   anormales (Hb S)
   Facilitation (groupe A) ou limitation (groupe O) de la formation de
Autres polymorphismes érythrocytaires moins directement
liés à la protection
   Hb C, Hb E, béta-thalassémie, récepteur du complément CR1
Pourquoi s’intéresser en 2004 au
polymorphisme érythrocytaire en relation
           avec le paludisme ?
Les particularités des érythrocytes « anormaux » peuvent
être utilisées pour la conception d’un vaccin
  Utilisation de la réponse anticorps anti-bande 3 (protéine exprimée
  à la surface des érythrocytes sénescents, ou infectés par
  Plasmodium, ou de sujets drépanocytaires, déficitaires en G6PD ou
  JR Kennedy, Int J Parasitol 2001 & Med Sci Monit 2002

Les modifications des réponses immunitaires spécifiques
engendrées par les facteurs génétiques affectant
l’érythrocyte restent méconnues
  Nos programmes de recherche au Gabon (1995-2001) puis au
  Sénégal (2002-2005)
Structure de l’hémoglobine
β           β

                           Gγ            Αγ            δ        β
                           Gγ            Αγ            δ        β   Chromosome 11
    α     hème
                                                  α2       α1
                                                  α2       α1       Chromosome 16




        Hb F                    Hb A          Hb A2
        α2 γ2                   α2 β 2         α2 δ2
Trait drépanocytaire & Paludisme

Mutation ponctuelle au locus des β globines
(hémoglobine S): Hb AS

Fréquence variant de >20% en Afrique
équatoriale à <5% en Afrique du nord

Protection des jeunes enfants Hb AS contre les
accès simples (60%) et graves (90%) (Hill 1992)

   Élimination plus rapide des GRP falciformes par la rate
   Persistance de Hb F qui retarde la croissance du
Détermination du variant HbS (PCR-RFLP)
                 Séquence du fragment amplifié du variant HbS
          (chromosome 11, exon 6 du gène de la béta-globine, 369 pb)
      HbS-R: 3’agacaggtgaggactacgac 5’

                                               Substitution nucléotidique A>T entraînant
                                                une modification d’acide aminé Glu>Val
                                    294 pb
                                    201 pb    Digestion par l’enzyme de restriction Dde I:
                                                  La mutation abolit le site de coupure
                                    93 pb
                                    75 pb

     Ho      Hé   PM     Hé     N
Alpha-thalassémie & Paludisme

Délétion d’1 à 4 gènes de l’alpha globine

Afrique: -α3.7 thalassémie (5-40%)

La délétion α+ homozygote (-α/-α) favorise
l’infestation précoce des enfants par P. vivax.
Ceci permettrait le développement ultérieur d’une
meilleure immunité vis-à-vis de P. falciparum et
aussi envers d’autres agents infectieux (Williams
1996, Allen 1997)
Détermination des –α3.7 thalassémies par
               TS1      TS2      TS1        TS3

5’                 α2                  α1                 3’

                                                  La délétion -α 3.7 de 3.7 kb entraîne la formation
                                                        d’un gène hybride fonctionnel α2α1
                          α2 α1

     Appellation          Génotype                   TS1/TS2 (α2)               TS1/TS3 (α1)
                               αα/αα                        1,9 kb                      2,1 kb
 α+ hétérozygote              -α3.7/αα                         1,9                    1,9 + 2,1
 α+ homozygote           -α3.7/-α3.7                            -                         1,9
       α0/α+                  --/-α3.7                          -                         1,9
Déficit en G6PD & Paludisme

Etudes épidémiologiques
  400 millions de personnes concernées dans le monde
  Variant G6PD A- associé à 46% (58%) de réduction du risque
  d’infection sévère chez les filles hétérozygotes (garçons
  hémizygotes) – Ruwende 1995 -

Mécanismes en jeu
  Le déficit en G6PD crée un stress oxydant qui altère la croissance
  du parasite dans le GR
  Après 4 à 5 cycles de schizogonie, le parasite s’adapte en
  exprimant sa propre G6PD – Usanga & Luzzatto 1985 -
Déficit en G6PD / Physiologie

La Glucose-6-Phospho-Déshydrogénase (G6PD)
  Enzyme cytoplasmique qui catalyse la première réaction de la
  voie des pentoses phosphates
  contribue à diminuer le stress oxydant subi par les cellules

Gène porté par le chromosome X
  Phénomène de lyonisation de l’X
  Nécessité de mener des analyses séparées en fonction du
  A un génotype donné ne correspond pas un phénotype donné
Variants G6PD en Afrique sub-
3 variants alléliques principaux parmi les 400

                G6PD B, 60 à 80%
              activité enzym. normale
                                                G6PD A, 15 à 40%
                                              activité enzym. de 85%
                                             mutation ponctuelle 376G

                                G6PD A-, 0 à 25%
                             activité enzym. de 12%
                 mutation ponctuelle 202A additionnelle à 376G
        autres mutations additionnelles: 542T (Santamaria), 680T et 968C

Génotypes et phénotypes
                            Normal                    Déficitaire
      Homme                   B, A                         A-
      Femme               BB, BA, AA                BA-, AA-, A-A-
Détermination du variant G6PD A (PCR-
 Séquence du fragment amplifié du variant G6PD A (chromosome X, exon 5, 585
  G6PD-3                              pb)
  gcttgccgttgccct(117pb) 3’                                                      G6PD-
  2:3’cattccgaacggcaacggga 5’

                                             Substitution nucléotidique A>G en position 376
                                            de la partie codante, entraînant une modification
402 pb                                    d’acide aminé Asn>Asp en position 126 de la protéine
285 pb
                                               Digestion par l’enzyme de restriction Fok
183 pb
                                                 I: la mutation crée le site de coupure
117 pb

                                               M = homo- ou hémi-zygote
                                               H = hétérozygote
Détermination du variant G6PD A- (PCR-
Séquence du fragment amplifié du variant G6PD A- (chromosome X, exon 4,
                                 109 pb)
  G6PD-7: 3’cgtttgtctcactcgggaagaagttc 5’

                                                     Substitution nucléotidique G>A
                                                  en position 202 de la partie codante,
                                                entraînant une modification d’aa Val>Meth
                                                       en position 68 de la protéine

                  109 pb
                                                   Digestion par Nla III: la mutation
                  63 pb
                                                        crée le site de coupure
                  46 pb

Hét   PM      N            Hom            PM
Génotypage de la G6PD / Niakhar,
403 enfants d’origine Sereer, sans lien de parenté
  G6PD A: Filles G6PD BA = 38% et G6PD AA = 9%
          Garçons G6PD A = 30%
  G6PD A-: seulement 1,2% (3 G6PD BA-, 1 G6PD AA-, 1 G6PD A-)

  Particularité génétique de l’ethnie Sereer
  Autre mutation additionnelle associée à un déficit enzymatique
  que la mutation 202A

Poursuite du génotypage      (collaboration Hôp. Robert Debré, Paris)
  Enfants G6PD A: recherche des mutations 968C, 542T
  (Santamaria) et 680T
  Enfants G6PD B: recherche de la mutation 542T (Malaga)

Discordance des études
   Association possible de plusieurs anomalies génétiques

Modifications géniques importantes de l’hôte en réponse
à la pression de sélection exercée par P. falciparum
   Hématie: site direct d’action de l’infection palustre
   Système immunitaire (MBP, répertoire TCR, cytokines …)
   Autres systèmes (HTA, surcharge en fer)

Polymorphisme antigénique du parasite

          Complexité des interactions hôte-parasite
          Implications vaccinales potentielles
Les facteurs génétiques d'hôte en relation avec le paludisme

Contenu connexe


Branche- bibliographic report 1
Branche- bibliographic report 1Branche- bibliographic report 1
Branche- bibliographic report 1
Emilie Branche
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.ppt
Zarski Antiviraux, Cytokines
Zarski Antiviraux, CytokinesZarski Antiviraux, Cytokines
Zarski Antiviraux, Cytokines
Mémoire de dea
Mémoire de deaMémoire de dea
Mémoire de dea
Said Talbi Poster VITO
Said Talbi Poster VITOSaid Talbi Poster VITO
Said Talbi Poster VITO
Said Talbi
Zarski cytokines 2013
Zarski   cytokines 2013Zarski   cytokines 2013
Zarski cytokines 2013
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...

Tendances (20)

De l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorpsDe l'ADN à la protéine & de l'antigène à l'anticorps
De l'ADN à la protéine & de l'antigène à l'anticorps
Lecture 7 Immunoglobulins
Lecture 7 ImmunoglobulinsLecture 7 Immunoglobulins
Lecture 7 Immunoglobulins
Cours 7 lymphocyte b et immunoglobulines
Cours 7 lymphocyte b et immunoglobulinesCours 7 lymphocyte b et immunoglobulines
Cours 7 lymphocyte b et immunoglobulines
Diu Cytometriegrenoble2011
Diu Cytometriegrenoble2011Diu Cytometriegrenoble2011
Diu Cytometriegrenoble2011
Branche- bibliographic report 1
Branche- bibliographic report 1Branche- bibliographic report 1
Branche- bibliographic report 1
Lymphocytotoxicité Lymphocytotoxicité
Oncogène oncogénèse
Oncogène   oncogénèseOncogène   oncogénèse
Oncogène oncogénèse
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.ppt
Zarski Antiviraux, Cytokines
Zarski Antiviraux, CytokinesZarski Antiviraux, Cytokines
Zarski Antiviraux, Cytokines
Oncogenes & oncogenese
Oncogenes & oncogeneseOncogenes & oncogenese
Oncogenes & oncogenese
Production des ac recombinant
Production des ac recombinantProduction des ac recombinant
Production des ac recombinant
Le système du complément
Le système du complémentLe système du complément
Le système du complément
Particularité de transfusion au niveau du service d'oncologie -HUDERF
Particularité de transfusion au niveau du service d'oncologie -HUDERFParticularité de transfusion au niveau du service d'oncologie -HUDERF
Particularité de transfusion au niveau du service d'oncologie -HUDERF
Mémoire de dea
Mémoire de deaMémoire de dea
Mémoire de dea
Said Talbi Poster VITO
Said Talbi Poster VITOSaid Talbi Poster VITO
Said Talbi Poster VITO
les anticorps monoclonaux
les anticorps monoclonaux les anticorps monoclonaux
les anticorps monoclonaux
Zarski cytokines 2013
Zarski   cytokines 2013Zarski   cytokines 2013
Zarski cytokines 2013
Hepatitis B and C in renal transplantation
Hepatitis B and C in renal transplantationHepatitis B and C in renal transplantation
Hepatitis B and C in renal transplantation
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...

En vedette

Les chiffres cle de l’internet
Les chiffres cle de l’internet Les chiffres cle de l’internet
Les chiffres cle de l’internet
Atelier tic et évaluation aqep_dec13
Atelier tic et évaluation aqep_dec13Atelier tic et évaluation aqep_dec13
Atelier tic et évaluation aqep_dec13
Mélanie Ducharme
Des Animaux en Danger
Des Animaux en DangerDes Animaux en Danger
Des Animaux en Danger

En vedette (20)

Financement pour faire reculer le paludisme (FRP) : l'exemple Global Fund et ...
Financement pour faire reculer le paludisme (FRP) : l'exemple Global Fund et ...Financement pour faire reculer le paludisme (FRP) : l'exemple Global Fund et ...
Financement pour faire reculer le paludisme (FRP) : l'exemple Global Fund et ...
Actualités de la chimioprophylaxie antipaludique dans les armées françaises e...
Actualités de la chimioprophylaxie antipaludique dans les armées françaises e...Actualités de la chimioprophylaxie antipaludique dans les armées françaises e...
Actualités de la chimioprophylaxie antipaludique dans les armées françaises e...
Les stades hépatiques
Les stades hépatiquesLes stades hépatiques
Les stades hépatiques
Drep sisto oct2012
Drep sisto oct2012Drep sisto oct2012
Drep sisto oct2012
Facteurs de survenue et prise en charge d'une épidémie du paludisme
Facteurs de survenue et prise en charge d'une épidémie du paludismeFacteurs de survenue et prise en charge d'une épidémie du paludisme
Facteurs de survenue et prise en charge d'une épidémie du paludisme
La Compagnie Fredonia - Gagner-la-confiance 2
La Compagnie Fredonia - Gagner-la-confiance 2La Compagnie Fredonia - Gagner-la-confiance 2
La Compagnie Fredonia - Gagner-la-confiance 2
Système d’Information Géographique et Télédétection: généralités
Système d’Information Géographique et Télédétection: généralitésSystème d’Information Géographique et Télédétection: généralités
Système d’Information Géographique et Télédétection: généralités
Les chiffres cle de l’internet
Les chiffres cle de l’internet Les chiffres cle de l’internet
Les chiffres cle de l’internet
Paludisme : du parasite à la prévention
Paludisme : du parasite à la préventionPaludisme : du parasite à la prévention
Paludisme : du parasite à la prévention
Atelier tic et évaluation aqep_dec13
Atelier tic et évaluation aqep_dec13Atelier tic et évaluation aqep_dec13
Atelier tic et évaluation aqep_dec13
Moustiquaires imprégnées d'insecticide ; pour qui ?
Moustiquaires imprégnées d'insecticide ; pour qui ?Moustiquaires imprégnées d'insecticide ; pour qui ?
Moustiquaires imprégnées d'insecticide ; pour qui ?
Quelles stratégies pour la lutte contre le paludisme chez la femme enceinte e...
Quelles stratégies pour la lutte contre le paludisme chez la femme enceinte e...Quelles stratégies pour la lutte contre le paludisme chez la femme enceinte e...
Quelles stratégies pour la lutte contre le paludisme chez la femme enceinte e...
Les vecteurs du paludisme
Les vecteurs du paludismeLes vecteurs du paludisme
Les vecteurs du paludisme
Lean and mobility
Lean and mobility Lean and mobility
Lean and mobility
Diversité des plasmodies
Diversité des plasmodiesDiversité des plasmodies
Diversité des plasmodies
Phases pré érythrocytaires des érythrocytaires des plasmodiums humains
Phases pré érythrocytaires des érythrocytaires des plasmodiums humainsPhases pré érythrocytaires des érythrocytaires des plasmodiums humains
Phases pré érythrocytaires des érythrocytaires des plasmodiums humains
Des Animaux en Danger
Des Animaux en DangerDes Animaux en Danger
Des Animaux en Danger
E bulletin vol1 #7
E  bulletin vol1 #7E  bulletin vol1 #7
E bulletin vol1 #7
La chimioprophylaxie et les groupes - cibles
La chimioprophylaxie et les groupes - ciblesLa chimioprophylaxie et les groupes - cibles
La chimioprophylaxie et les groupes - cibles

Similaire à Les facteurs génétiques d'hôte en relation avec le paludisme

Pawlotsky cycle
Pawlotsky  cyclePawlotsky  cycle
Pawlotsky cycle
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Alloimmunisation 2011 sf
Alloimmunisation 2011 sfAlloimmunisation 2011 sf
Alloimmunisation 2011 sf
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012
Carcinogenèse hépatique d'origine virale.ppt
Carcinogenèse hépatique d'origine virale.pptCarcinogenèse hépatique d'origine virale.ppt
Carcinogenèse hépatique d'origine virale.ppt
Dysglobulinemies cf 12 10 10
Dysglobulinemies cf 12 10 10Dysglobulinemies cf 12 10 10
Dysglobulinemies cf 12 10 10

Similaire à Les facteurs génétiques d'hôte en relation avec le paludisme (20)

Pawlotsky cycle
Pawlotsky  cyclePawlotsky  cycle
Pawlotsky cycle
Histocompatibilité et Facteurs pré-implantatoires- Madkour-SMFC-2019
Histocompatibilité et Facteurs pré-implantatoires- Madkour-SMFC-2019Histocompatibilité et Facteurs pré-implantatoires- Madkour-SMFC-2019
Histocompatibilité et Facteurs pré-implantatoires- Madkour-SMFC-2019
Oncogene & oncogenese
Oncogene & oncogeneseOncogene & oncogenese
Oncogene & oncogenese
Focal segmental glomerulosclerosis and transplantation
Focal segmental glomerulosclerosis and transplantationFocal segmental glomerulosclerosis and transplantation
Focal segmental glomerulosclerosis and transplantation
Lerat bis hép virologie du16
Lerat bis hép virologie du16  Lerat bis hép virologie du16
Lerat bis hép virologie du16
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
Données actuelles sur la physiopathologie du paludisme à Plasmodium falciparum
Données actuelles sur la physiopathologie du paludisme à Plasmodium falciparumDonnées actuelles sur la physiopathologie du paludisme à Plasmodium falciparum
Données actuelles sur la physiopathologie du paludisme à Plasmodium falciparum
Polymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez PlasmodiumPolymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez Plasmodium
Lerat du hépatites virales 2015
Lerat  du hépatites virales 2015Lerat  du hépatites virales 2015
Lerat du hépatites virales 2015
Lecture 2 Complement System for 2nd Year DMD Students
Lecture 2 Complement System for 2nd Year DMD StudentsLecture 2 Complement System for 2nd Year DMD Students
Lecture 2 Complement System for 2nd Year DMD Students
Lerat hép virologie du16
Lerat  hép virologie du16Lerat  hép virologie du16
Lerat hép virologie du16
Cours complement pharmacie 2016
Cours complement pharmacie 2016Cours complement pharmacie 2016
Cours complement pharmacie 2016
Alloimmunisation 2011 sf
Alloimmunisation 2011 sfAlloimmunisation 2011 sf
Alloimmunisation 2011 sf
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012
Résistance et réponse thérapeutique
Résistance et réponse thérapeutiqueRésistance et réponse thérapeutique
Résistance et réponse thérapeutique
Lecture 2 The Complement System
Lecture 2 The Complement SystemLecture 2 The Complement System
Lecture 2 The Complement System
Génétique humaine et susceptibilité au paludisme
Génétique humaine et susceptibilité au paludismeGénétique humaine et susceptibilité au paludisme
Génétique humaine et susceptibilité au paludisme
Carcinogenèse hépatique d'origine virale.ppt
Carcinogenèse hépatique d'origine virale.pptCarcinogenèse hépatique d'origine virale.ppt
Carcinogenèse hépatique d'origine virale.ppt
Dysglobulinemies cf 12 10 10
Dysglobulinemies cf 12 10 10Dysglobulinemies cf 12 10 10
Dysglobulinemies cf 12 10 10

Plus de Institut Pasteur de Madagascar

Plus de Institut Pasteur de Madagascar (20)

Annexe 3 atelier paludisme 2009
Annexe 3  atelier paludisme 2009Annexe 3  atelier paludisme 2009
Annexe 3 atelier paludisme 2009
Rapport audit 2007
Rapport audit 2007Rapport audit 2007
Rapport audit 2007
Bilan evaluations 2007
Bilan evaluations 2007Bilan evaluations 2007
Bilan evaluations 2007
Exemple evaluation 2007
Exemple evaluation 2007Exemple evaluation 2007
Exemple evaluation 2007
Presentation atelier paludisme 2007
Presentation atelier paludisme 2007Presentation atelier paludisme 2007
Presentation atelier paludisme 2007
Comparaison entre les premières et les dernières évaluations - 2006
Comparaison entre les premières et les dernières évaluations - 2006Comparaison entre les premières et les dernières évaluations - 2006
Comparaison entre les premières et les dernières évaluations - 2006
Exemple grille evaluation 2006
Exemple grille evaluation 2006Exemple grille evaluation 2006
Exemple grille evaluation 2006
Présentation Atelier Paludisme 2006
Présentation Atelier Paludisme 2006Présentation Atelier Paludisme 2006
Présentation Atelier Paludisme 2006
Rapport evaluations 1an 2 ans - 2005
Rapport evaluations 1an 2 ans - 2005Rapport evaluations 1an 2 ans - 2005
Rapport evaluations 1an 2 ans - 2005
Synthese 2005
Synthese 2005Synthese 2005
Synthese 2005
Grille d'evalution 2005
Grille d'evalution 2005Grille d'evalution 2005
Grille d'evalution 2005
Participants tables rondes 2005
Participants tables rondes 2005Participants tables rondes 2005
Participants tables rondes 2005
Diaporama 2003
Diaporama 2003Diaporama 2003
Diaporama 2003
Certificat 2003
Certificat 2003Certificat 2003
Certificat 2003
Grilles d'évaluations 2004
Grilles d'évaluations 2004Grilles d'évaluations 2004
Grilles d'évaluations 2004
Synthèse des Grilles Evaluations 2003
Synthèse des Grilles Evaluations 2003Synthèse des Grilles Evaluations 2003
Synthèse des Grilles Evaluations 2003
Guide pour le suivi et l'évaluation des programmes
Guide pour le suivi et l'évaluation des programmesGuide pour le suivi et l'évaluation des programmes
Guide pour le suivi et l'évaluation des programmes
Monitoring and Evaluation Toolkit
Monitoring and Evaluation ToolkitMonitoring and Evaluation Toolkit
Monitoring and Evaluation Toolkit
Développement nouveaux médicaments
Développement nouveaux médicamentsDéveloppement nouveaux médicaments
Développement nouveaux médicaments
Diagnostic biologique du paludisme
Diagnostic biologique du paludismeDiagnostic biologique du paludisme
Diagnostic biologique du paludisme

Les facteurs génétiques d'hôte en relation avec le paludisme

  • 1. Facteurs génétiques humains & paludisme à P. falciparum Florence Migot-Nabias UR 10 « Santé de la mère et de l’enfant » IRD, Dakar, Sénégal
  • 2. Existence d’une régulation génétique des réponses immunitaires spécifiques du paludisme Différences individuelles, familiales ou ethniques des réponses immunitaires contre P. falciparum, dans des conditions d’exposition identiques Concordance plus importante entre jumeaux monozygotes que dizygotes: Pour le développement de fièvre lors d’un accès palustre: régulation génétique des cytokines pyrogènes Pour la production d’anticorps dirigés contre différents antigènes plasmodiaux
  • 3. Système HLA & paludisme Souris: restriction génétique des réponses lymphocytaires à des épitopes de la CSP et de Pf155/RESA Accès palustre grave: Protection contre le neuropaludisme (HLA-B53) et contre l’anémie sévère liée au paludisme (HLA-DRB1*1302-DQB1*0501) Plus grande susceptibilité au neuropaludisme chez les sujets homozygotes ou hétérozygotes pour l’allèle TNF-308A Allèle TNF-238A associé (+) à l’anémie sévère liée au paludisme ou (-) au neuropaludisme Accès palustre simple: HLA I et II non associés à la résistance aux accès simples Présence ou non de relations entre allèles HLA I et II et réponse immunitaire à des antigènes des stades sanguins de P. falciparum
  • 4. Organisation génétique du système HLA Classe II Classe III Classe I Centromère du chromosome 6 D C4A, C4B, C2 α β B C A 21-OHase TNF (α2) α1 (α) (α2) α1 α DP DN D DQ DR O (β2) β1 (β1) (β2) β1 β1 β3 β4
  • 5. Association peptide/HLA I et reconnaissance par les LyT cytotoxiques Ly T cytotoxique Lyse de la cellule infectée TCR CD 8 CPA Vésicule de sécrétion cytoplasme Golgi Réticulum endoplasmiqu e protéine protéasome peptide HLA classe I β2-microglobuline In: « Immunologie », Revillard, 1994
  • 6. Association peptide/HLA II et reconnaissance par les LyT auxiliaires •Production d’anticorps par les Ly B Ly T •Relargage de cytokines induisant la lyse auxiliaire des micro-organismes intracellulaires par les macrophages Protéine exogène TCR CD 4 récepteur CPA -cytoplasme- Compartiment des molécules HLA classe II Dissociation et + Endosome dégradation de la chaîne I peptides (protéases ) Réticulum endoplasmique Golgi Lysosome + + = I α β αβ + I In: « Immunologie », Revillard, 1994
  • 7. Facteurs non-HLA de régulation génétique Contribution importante de gènes non liés à la région HLA dans la régulation génétique des réponses immunitaires dirigées contre P. falciparum La région chromosomique 5q31-q33 (gènes de cytokines, gènes de régulation de la réponse immune) interviendrait dans le contrôle des niveaux d’infection par P. falciparum
  • 8. Polymorphisme érythrocytaire & paludisme Protection clinique Trait drépanocytaire, alpha-thalassémie, déficit en G6PD, ovalocytose, groupe sanguin ABO, groupe Duffy Mécanismes proposés Modification des antigènes érythrocytaires de surface favorisant la reconnaissance immunitaire (alpha-thal) Sensibilité accrue au stress oxydant favorisant la phagocytose des parasites (déficit G6PD) Ralentissement de la croissance parasitaire dans les hématies anormales (Hb S) Facilitation (groupe A) ou limitation (groupe O) de la formation de rosettes Autres polymorphismes érythrocytaires moins directement liés à la protection Hb C, Hb E, béta-thalassémie, récepteur du complément CR1
  • 9. Pourquoi s’intéresser en 2004 au polymorphisme érythrocytaire en relation avec le paludisme ? Les particularités des érythrocytes « anormaux » peuvent être utilisées pour la conception d’un vaccin Utilisation de la réponse anticorps anti-bande 3 (protéine exprimée à la surface des érythrocytes sénescents, ou infectés par Plasmodium, ou de sujets drépanocytaires, déficitaires en G6PD ou béta-thalassémiques) JR Kennedy, Int J Parasitol 2001 & Med Sci Monit 2002 Les modifications des réponses immunitaires spécifiques engendrées par les facteurs génétiques affectant l’érythrocyte restent méconnues Nos programmes de recherche au Gabon (1995-2001) puis au Sénégal (2002-2005)
  • 10. Structure de l’hémoglobine α β β Gγ Αγ δ β Gγ Αγ δ β Chromosome 11 α hème α2 α1 α2 α1 Chromosome 16 naissance α β γ δ Hb F Hb A Hb A2 α2 γ2 α2 β 2 α2 δ2
  • 11. Trait drépanocytaire & Paludisme Mutation ponctuelle au locus des β globines (hémoglobine S): Hb AS Fréquence variant de >20% en Afrique équatoriale à <5% en Afrique du nord Protection des jeunes enfants Hb AS contre les accès simples (60%) et graves (90%) (Hill 1992) Mécanismes: Élimination plus rapide des GRP falciformes par la rate Persistance de Hb F qui retarde la croissance du parasite
  • 12. Détermination du variant HbS (PCR-RFLP) Séquence du fragment amplifié du variant HbS (chromosome 11, exon 6 du gène de la béta-globine, 369 pb) HbS-F 5’agtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggt gcatctgactcc(93pb)/tgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgag gccctgggcaggttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactc ttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc(201pb)/ttAggctgctggtggtctacc cttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctg(75pb) HbS-R: 3’agacaggtgaggactacgac 5’ Substitution nucléotidique A>T entraînant une modification d’acide aminé Glu>Val 294 pb 201 pb Digestion par l’enzyme de restriction Dde I: La mutation abolit le site de coupure 93 pb 75 pb Ho Hé PM Hé N
  • 13. Alpha-thalassémie & Paludisme Délétion d’1 à 4 gènes de l’alpha globine Afrique: -α3.7 thalassémie (5-40%) La délétion α+ homozygote (-α/-α) favorise l’infestation précoce des enfants par P. vivax. Ceci permettrait le développement ultérieur d’une meilleure immunité vis-à-vis de P. falciparum et aussi envers d’autres agents infectieux (Williams 1996, Allen 1997)
  • 14. Détermination des –α3.7 thalassémies par PCR TS1 TS2 TS1 TS3 5’ α2 α1 3’ La délétion -α 3.7 de 3.7 kb entraîne la formation d’un gène hybride fonctionnel α2α1 α2 α1 Appellation Génotype TS1/TS2 (α2) TS1/TS3 (α1) αα/αα 1,9 kb 2,1 kb α+ hétérozygote -α3.7/αα 1,9 1,9 + 2,1 α+ homozygote -α3.7/-α3.7 - 1,9 α0/α+ --/-α3.7 - 1,9
  • 15. Déficit en G6PD & Paludisme Etudes épidémiologiques 400 millions de personnes concernées dans le monde Variant G6PD A- associé à 46% (58%) de réduction du risque d’infection sévère chez les filles hétérozygotes (garçons hémizygotes) – Ruwende 1995 - Mécanismes en jeu Le déficit en G6PD crée un stress oxydant qui altère la croissance du parasite dans le GR Après 4 à 5 cycles de schizogonie, le parasite s’adapte en exprimant sa propre G6PD – Usanga & Luzzatto 1985 -
  • 16. Déficit en G6PD / Physiologie La Glucose-6-Phospho-Déshydrogénase (G6PD) Enzyme cytoplasmique qui catalyse la première réaction de la voie des pentoses phosphates contribue à diminuer le stress oxydant subi par les cellules Gène porté par le chromosome X Phénomène de lyonisation de l’X Nécessité de mener des analyses séparées en fonction du sexe A un génotype donné ne correspond pas un phénotype donné
  • 17. Variants G6PD en Afrique sub- saharienne 3 variants alléliques principaux parmi les 400 identifiés G6PD B, 60 à 80% activité enzym. normale G6PD A, 15 à 40% activité enzym. de 85% mutation ponctuelle 376G G6PD A-, 0 à 25% activité enzym. de 12% mutation ponctuelle 202A additionnelle à 376G autres mutations additionnelles: 542T (Santamaria), 680T et 968C Génotypes et phénotypes Normal Déficitaire Homme B, A A- Femme BB, BA, AA BA-, AA-, A-A-
  • 18. Détermination du variant G6PD A (PCR- RFLP) Séquence du fragment amplifié du variant G6PD A (chromosome X, exon 5, 585 G6PD-3 pb) 5’ctgcgttttctccgccaatcatagttgggtgtcatgattttggagagagagctttctccagtgtatttctcccaggtcaaaa tatcctgaaatctggcctctgtcctaaggcacaggggtcccagcctggggcagtgtctgtgctgcctgctttggcctccctccc tctGgatgtgcagagct(183pb)/gctaagatggggctgaacccagtgtgggacggggacactgacttctgagggcaccctcc ctggacctccagggaagaccctccactcccctggggcagaacacacacggactcaaagagaggggctgacatctgtctgtgtgt ctgtctgtccgtgtctcccaggccaccccagaggagaagctcaagctggaggacttctttgcccgcaactcctatgtggctggc cagtacgatgatgcagcctcctaccagcgcctcaacagccacatGgatgccctccacc(285pb)/tggggtcacaggccaacc gcctcttctacctggccttgcccccgaccgtctacgaggccgtcaccaagaacattcacgagtcctgcatgagccagatgtaag gcttgccgttgccct(117pb) 3’ G6PD- 2:3’cattccgaacggcaacggga 5’ Substitution nucléotidique A>G en position 376 de la partie codante, entraînant une modification 402 pb d’acide aminé Asn>Asp en position 126 de la protéine 285 pb Digestion par l’enzyme de restriction Fok 183 pb I: la mutation crée le site de coupure 117 pb M = homo- ou hémi-zygote H = hétérozygote
  • 19. Détermination du variant G6PD A- (PCR- RFLP) Séquence du fragment amplifié du variant G6PD A- (chromosome X, exon 4, 109 pb) G6PD-6 5’gtggctgttccgggatggccttctgcccgaaaacaccttcatcAtg(46pb)/ggctatgcccgttcccgcctca cagtggctgacatccgcaaacagagtgagcccttcttcaag(63pb) G6PD-7: 3’cgtttgtctcactcgggaagaagttc 5’ Substitution nucléotidique G>A en position 202 de la partie codante, entraînant une modification d’aa Val>Meth en position 68 de la protéine 109 pb Digestion par Nla III: la mutation 63 pb crée le site de coupure 46 pb Hét PM N Hom PM Hém
  • 20. Génotypage de la G6PD / Niakhar, Sénégal 403 enfants d’origine Sereer, sans lien de parenté direct G6PD A: Filles G6PD BA = 38% et G6PD AA = 9% Garçons G6PD A = 30% G6PD A-: seulement 1,2% (3 G6PD BA-, 1 G6PD AA-, 1 G6PD A-) Hypothèses Particularité génétique de l’ethnie Sereer Autre mutation additionnelle associée à un déficit enzymatique que la mutation 202A Poursuite du génotypage (collaboration Hôp. Robert Debré, Paris) Enfants G6PD A: recherche des mutations 968C, 542T (Santamaria) et 680T Enfants G6PD B: recherche de la mutation 542T (Malaga)
  • 21. Conclusion Discordance des études Association possible de plusieurs anomalies génétiques Modifications géniques importantes de l’hôte en réponse à la pression de sélection exercée par P. falciparum Hématie: site direct d’action de l’infection palustre Système immunitaire (MBP, répertoire TCR, cytokines …) Autres systèmes (HTA, surcharge en fer) Polymorphisme antigénique du parasite Complexité des interactions hôte-parasite Implications vaccinales potentielles