SlideShare une entreprise Scribd logo
1
Le séquençage haut débit:
NGS
Une révolution de la biologie
moléculaire au service des patients
MALLEK Ramdane
rmallek@lab-cerba.com
Biologie Moléculaire et génomique, Laboratoire Cerba, Saint-Ouen l'Aumône, France
IPT, Tunis 06 Avril 2019
UNE PETITE QUESTION POUR COMMENCER
• Quelle est la taille (en bases) du génome ?
• Humain :
• Bactérie Escherichia coli :
• Cytomégalovirus humain :
2
UNE PETITE QUESTION POUR COMMENCER
• Quelle est la taille (en bases) du génome ?
• Humain : 2,99 Milliards
• Environ 20.000 gènes (1,2% du génome) de 0,9Kb (SRY) à
2,4Mb (DMD)
• Environ 220.000 exons
• Bactérie Escherichia coli : 4,64 Millions
• Cytomégalovirus humain : 2360
3
UN PEU DE TERMINOLOGIE
• Séquençage « ancienne génération » ou bas débit =
Séquençage type Sanger  méthode de référence
Permet de décrypter quelques centaines de pb à la fois
• Séquençage de nouvelle génération (Next Generation
Sequencing NGS) = Séquençage à très haut débit (High
Throughput Sequencing HTS)= Séquençage massif en
parrallèle MPS= dénomination unique « post Sanger »
Permet de décrypter jusqu’à 6 milliards de pb à la fois
4
PROJET GÉNOME HUMAIN : 1990-2003
5
1866 1953 1977 1983 2003 2005 2008
2019: ILLUMINA annonce WGS entre 1000 et 2000 $
caryotype
FISH
SNP-arrays
PCR
LES OUTILS DIAGNOSTIQUES EN GÉNÉTIQUE
Séquençage
6
SÉQUENÇAGE DE TYPE SANGER
7
https://www.youtube.com/watch?v=3M0PyxFPwkQ
SÉQUENÇAGE DE TYPE SANGER
8
• Avantages
• Relativement peu coûteux (sauf rapporté à la base séquencée)
• Equipement « standard »
• Analyse des résultats simples (expertise limitée)
• Les limites
• Connaissance à priori de la cible (ce sont des produits de PCR qui sont
séquencés et non pas la séquence originelle)
• Faible débit
• Analyse séquentielle individuelle
• Pas de possibilité de multiplexage
• Seuil de sensibilité (détection de variant minoritaire) faible : environ 20%
Par run Séquençage SANGER Séquençage NGS
Petit débit
Séquençage NGS
Moyen débit
Séquençage NGS
Haut débit
Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500
Nombre de reads 96 25 millions
(single reads 36bp)
400 millions
(single reads 75bp)
1.5 milliards
(single reads 27bp)
Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9)
Durée 24H 56H
(2*300bp)
29H
(2*150bp)
11J
(2*100bp)
LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT
DÉBIT (NGS) A PARTIR DE 2006
X 400.000 X 1.000.000X 50.000
Par run Séquençage SANGER Séquençage NGS
Petit débit
Séquençage NGS
Moyen débit
Séquençage NGS
Haut débit
Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500
Nombre de reads 96 25 millions
(single reads 36bp)
400 millions
(single reads 75bp)
1.5 milliards
(single reads 27bp)
Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9)
Durée 24H 56H
(2*300bp)
29H
(2*150bp)
11J
(2*100bp)
LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT
DÉBIT (MPS)
AUDI A1 105CH ARIANE 5 21.500CH
10
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
11
Pour ADN plusieurs approches possibles selon le besoin
- Séquençage de 1 ou plusieurs gènes en même temps (panel)
- Séquençage de l’exome ou WES
- Séquençage de l’ensemble du génome WGS
1- Définir le besoin
2- Extraction des Acides nucléiques à partir de l’échantillon biologique (ADN ou ARN)
Sang Total EDTA
Plasma
Tumeur
FFPE
Liquide Amniotique
Biopsie liquide
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
12
2- Préparation de l’échantillon = Préparation de la Librairie
Adaptateur (INDEX)
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
13
Flowcell= lame de verre sur laquelle
va se fixer la librairie et avoir lieu de
séquençage
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
14
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
15
*La librairie est ensuite amplifiée sur la Flowcell
Librairie
SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ?
16
*Séquençage par synthèse:
17
Etudier le génome
La bioinformatique
Si vous tapiez les lettres du génome humain à raison de 60 mots par minute
durant 8 heures par jour, il vous faudrait... 50 ans pour le transcrire.
Duffourd Yannis Bioinformaticien – CHU Dijon 18
Etudier le génome
La bioinformatique
La bioinformatique est l’ensemble
des méthodes qui convertissent
les données biologiques en
informations.
Approche multidisciplinaire impliquant
l’informatique, les mathématiques, des
méthodes statistiques, ainsi qu’une
profonde compréhension des
problématiques biologiques.
Au delà de la prouesse technologique
le NGS nécessite de disposer de
compétences Bioinformatique
Etudier le génome
La bioinformatique
A quoi sert la bioinformatique ?
TCGATCTGATGAAA
GCATGATCGCATCGCATCACATATCT
 Reconstituer ces séquences pour
retrouver la séquence totale
 Comparer la séquence à la séquence
de référence
 Identifier les variants
 Déterminer leur impact
Analyser un génome requiert environ
1 Milliard de séquences de 150 bases
Duffourd Yannis Bio-informaticien – CHU Dijon
 Mise en place d’un environnement Haute performance (HPC) avec serveurs sur site
pour analyse et stockage des données
INTÉRÊT, CONSÉQUENCE ET IMPACT DE
L’IMPLÉMENTATION DU NGS DANS UN LABORATOIRE
21
Réduction du coût de
séquençage (par base*)
Augmentation des
capacités (par run)
Possibilité de
séquençage de novo
Plus de gènes
séquencés par patient
Plus de patients
séquencés par gène
Nouvelles applications
Réduction du temps au
diagnostic
ET/OU
QUESTION :
POUR QUELLES
APPLICATIONS ?
22
23
Diagnostic
prénatal
Génétique
constitutionnelle
Maladies
infectieuses
Génétique
somatique
NGS
GÉNÉTIQUE CONSTITUTIONNELLE
24
Génétique
constitutionnelle
MPS
 Les maladies rares
- Une maladie est dite « rare » lorsqu’elle atteint moins de une
personne sur 2 000.
- Très nombreuses (plus de 8.000 décrites)
*En Tunisie, plus de 400 maladies rares et environ 600 000
Tunisiens, soit une personne sur vingt serait atteinte d’une
maladie rare, dont 85 % sont d’origine génétique. C’est ce
que Sanofi Tunisie et l’Association Tunisienne des Maladies
Lysosomales (ATML) ont annoncé lors de la 12ème Journée
internationale des maladies rares, le 28 février 2019.
25
Errance diagnostique (8 ans!):
Séquençage ciblé des gènes MID1, MED12, UPF3B négatif !
Caryotype avec recherche de microdélétion 22q11.2 négatif
WES le 01/03/2017: NM_001101.3(ACTB):c.1043C>T (p.Ser348Leu)
hétérozygote de novo
ACTB est à l’origine du Syndrome de Baraitser-Winter
autosomique dominante
Le Syndrome de Baraitser Winter est une maladie très rare, seulement 30 patients
rapportés !
Déficience intellectuelle, retard global des
acquisitions, retard du langage, retard de
motricité, retard de croissance, dysmorphie,
suspicion de malformation cardiaque.
Maladie rare non reconnue = errance Diagnostique
La médecine de précision a pour objectif de
proposer au patient un traitement adapté
aux caractéristiques génétiques
de sa tumeur
MEDECINE DE PRECISION
26
Génétique Somatique (onco)
27
Pathologie Biomarqueur Nombre de patients testés
Pourcentage de patients
présentant une altération
moléculaire
Thérapies ciblées associées
 Cancer du sein Amplification d’HER2 10 832 19,7 %
Trastuzumab, Pertuzumab
Lapatinib
 Cancer de l’estomac Amplification d’HER2 770 23,5 % Trastuzumab
 Cancer colorectal
Mutations de KRAS 21 923 43,7 % Panitumumab, Cetuximab
Mutations de NRAS 17 814 5,2 % Panitumumab, Cetuximab
 GIST
Mutations de KIT 1 218 65,5 % Imatinib
Mutations de PDGFRA 1 083 15,4 % Imatinib
 Cancer du poumon
Mutations d’EGFR 28 563 13,4 %
Gefitinib, Erlotinib
Afatinib, Osimeritinib
Translocation d’ALK 12 434 3,1 % Crizotinib, Ceritinib
Translocation de ROS1 17 680 1,0 % Crizotinib
 Mélanome Mutation de BRAF V600 5 583 37,2 %
Vemurafenib, Dabrafenib
Cobimetinib, Trametinib
 Leucémies
Détection de BCR-ABL 10 263 16,7 %
Imatinib, Dasatinib, Nilotinib,
Bosutinib, Ponatinib
Mutations d’ABL 1 014 22,4 %
Imatinib, Dasatinib, Nilotinib,
Bosutinib
Ponatinib
 Leucémie lymphoïde
chronique
Mutation de TP53 2 309 1 % Idelalisib
 Ovaire Mutation somatique de BRCA 1 608 12,6 % Olaparib
LES THERAPIES CIBLEES
27
VERS UNE MÉDECINE PERSONNALISÉE
28
NGS ET DIAGNOSTIC PRÉNATAL
29
Diagnostic
prénatal
MPS
 Dépistage des trisomies 13, 18 et 21 par analyse de l’ADN fœtal circulant
o Implémentation en routine clinique en France : Novembre 2013
Prélèvement tissulaire
Biopsie liquide
Vallée et Denis, Corresp Onco-Ther. 2013
ADN
circulant
(fragments)
Cellules
Tumorales
Circulantes
NGS ET « ADN CIRCULANT » (SUITE)
 Concept de biopsie liquide : le patrimoine tumoral dans un tube
30
31
EN CONCLUSION…
32
LA SUITE :
LES TECHNOLOGIES DE 3ÈME GÉNÉRATION
Oxford Nanopores
Single Molecule Real Time Sequencing
Le passage de la molécule d’ADN à
travers le nanopore provoque un
différentiel osmotique mesurable et
quantifiable en fonction de la base
Utilisation d’un nanopore
modifié dans une membrane
LA NOUVELLE ARME DE LA GÉOLOCALISATION ?
LA NOUVELLE ARME DE LA GÉOLOCALISATION ?
34
• Avec 1 connexion internet et utilisation de données publiques , il est capable
d’identifier l’identité de personnes qui ont bénéficiés de tests génétiques

Contenu connexe

Tendances

Lymphocytotoxicité
Lymphocytotoxicité Lymphocytotoxicité
Lymphocytotoxicité
Nasreddine Saidi
 
Génomique généralités jd
Génomique généralités jdGénomique généralités jd
Génomique généralités jd
judec12
 
tous sur les anticorps monoclonaux
tous sur les anticorps monoclonauxtous sur les anticorps monoclonaux
tous sur les anticorps monoclonaux
Kîïmâã Šîímâã
 
Diagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème versionDiagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème version
esf3
 
La régulation du cycle cellulaire
La régulation du cycle cellulaireLa régulation du cycle cellulaire
La régulation du cycle cellulaire
Asmae LGUENSAT
 
Biologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieBiologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologie
IMANE HALIMA BENLARIBI
 
Rapport de microbiologie
Rapport de microbiologieRapport de microbiologie
Rapport de microbiologie
Hassan NAIT-SI
 
Biotechnologies végétales
Biotechnologies végétalesBiotechnologies végétales
Biotechnologies végétales
Loïc Lepiniec
 
Les mutations
Les mutationsLes mutations
Les mutations
SELLANI Halima
 
Maladie de gaucher Jérôme Stirnemann SMMI _21_9_2018_
Maladie de gaucher Jérôme Stirnemann  SMMI _21_9_2018_Maladie de gaucher Jérôme Stirnemann  SMMI _21_9_2018_
Maladie de gaucher Jérôme Stirnemann SMMI _21_9_2018_
SMMI2015
 
Les plasmides groupe 02
Les plasmides groupe 02Les plasmides groupe 02
Les plasmides groupe 02
Miraj Microbio
 
Oral Diagnostic moléculaire PCR Multiplex Sérotypage
Oral Diagnostic moléculaire PCR Multiplex SérotypageOral Diagnostic moléculaire PCR Multiplex Sérotypage
Oral Diagnostic moléculaire PCR Multiplex Sérotypage
Emmanuelle Pretseille
 
PFGE
PFGEPFGE
Les Réactions Antigènes- Anticorps
Les Réactions  Antigènes- AnticorpsLes Réactions  Antigènes- Anticorps
Les Réactions Antigènes- Anticorps
S/Abdessemed
 
Tout sur la bactériologie
Tout sur la bactériologieTout sur la bactériologie
Tout sur la bactériologie
S/Abdessemed
 
Régulation de la glycémie "homéostasie glycémique"
 Régulation de la glycémie  "homéostasie glycémique"  Régulation de la glycémie  "homéostasie glycémique"
Régulation de la glycémie "homéostasie glycémique"
Nadia Terranti
 
Biochimie acides aminés et protéines
Biochimie acides aminés et protéinesBiochimie acides aminés et protéines
Biochimie acides aminés et protéines
Khalef LEFSIH
 
Identification des bactéries "Galerie biohimique "API"
Identification  des bactéries "Galerie biohimique "API"Identification  des bactéries "Galerie biohimique "API"
Identification des bactéries "Galerie biohimique "API"
S/Abdessemed
 
Système Immunitaire
Système ImmunitaireSystème Immunitaire
Système Immunitaire
Mehdi Razzok
 

Tendances (20)

COURS 2 PCR.ppt
COURS 2 PCR.pptCOURS 2 PCR.ppt
COURS 2 PCR.ppt
 
Lymphocytotoxicité
Lymphocytotoxicité Lymphocytotoxicité
Lymphocytotoxicité
 
Génomique généralités jd
Génomique généralités jdGénomique généralités jd
Génomique généralités jd
 
tous sur les anticorps monoclonaux
tous sur les anticorps monoclonauxtous sur les anticorps monoclonaux
tous sur les anticorps monoclonaux
 
Diagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème versionDiagnostic antenatal et foetal 2ème version
Diagnostic antenatal et foetal 2ème version
 
La régulation du cycle cellulaire
La régulation du cycle cellulaireLa régulation du cycle cellulaire
La régulation du cycle cellulaire
 
Biologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieBiologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologie
 
Rapport de microbiologie
Rapport de microbiologieRapport de microbiologie
Rapport de microbiologie
 
Biotechnologies végétales
Biotechnologies végétalesBiotechnologies végétales
Biotechnologies végétales
 
Les mutations
Les mutationsLes mutations
Les mutations
 
Maladie de gaucher Jérôme Stirnemann SMMI _21_9_2018_
Maladie de gaucher Jérôme Stirnemann  SMMI _21_9_2018_Maladie de gaucher Jérôme Stirnemann  SMMI _21_9_2018_
Maladie de gaucher Jérôme Stirnemann SMMI _21_9_2018_
 
Les plasmides groupe 02
Les plasmides groupe 02Les plasmides groupe 02
Les plasmides groupe 02
 
Oral Diagnostic moléculaire PCR Multiplex Sérotypage
Oral Diagnostic moléculaire PCR Multiplex SérotypageOral Diagnostic moléculaire PCR Multiplex Sérotypage
Oral Diagnostic moléculaire PCR Multiplex Sérotypage
 
PFGE
PFGEPFGE
PFGE
 
Les Réactions Antigènes- Anticorps
Les Réactions  Antigènes- AnticorpsLes Réactions  Antigènes- Anticorps
Les Réactions Antigènes- Anticorps
 
Tout sur la bactériologie
Tout sur la bactériologieTout sur la bactériologie
Tout sur la bactériologie
 
Régulation de la glycémie "homéostasie glycémique"
 Régulation de la glycémie  "homéostasie glycémique"  Régulation de la glycémie  "homéostasie glycémique"
Régulation de la glycémie "homéostasie glycémique"
 
Biochimie acides aminés et protéines
Biochimie acides aminés et protéinesBiochimie acides aminés et protéines
Biochimie acides aminés et protéines
 
Identification des bactéries "Galerie biohimique "API"
Identification  des bactéries "Galerie biohimique "API"Identification  des bactéries "Galerie biohimique "API"
Identification des bactéries "Galerie biohimique "API"
 
Système Immunitaire
Système ImmunitaireSystème Immunitaire
Système Immunitaire
 

Similaire à Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au service des patients

Anticorps thérapeutiques
Anticorps thérapeutiquesAnticorps thérapeutiques
Anticorps thérapeutiques
Sofia Azirar
 
AVORTEMENTS des PETITS RUMINANTS : une nouvelle PCR digitale multiplex pour...
AVORTEMENTS des PETITS RUMINANTS :  une nouvelle PCR digitale multiplex  pour...AVORTEMENTS des PETITS RUMINANTS :  une nouvelle PCR digitale multiplex  pour...
AVORTEMENTS des PETITS RUMINANTS : une nouvelle PCR digitale multiplex pour...
Institut de l'Elevage - Idele
 
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
Claude EUGENE
 
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
Nicolas Peschanski, MD, PhD
 
Canceropole1109strasbourg
Canceropole1109strasbourgCanceropole1109strasbourg
Canceropole1109strasbourg
OKCC/C3O and CREM/université Lorraine
 
La leptospirose
La leptospirose La leptospirose
La leptospirose
MBOUSSOU Yoan
 
Bases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesBases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditaires
Pasteur_Tunis
 
Introduction la science Genomique, slides
Introduction la science Genomique, slidesIntroduction la science Genomique, slides
Introduction la science Genomique, slides
ssuserbc9423
 
melanome
melanomemelanome
melanome
Patou Conrath
 
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Vih.org
 
Place des tests de diagnostic rapide dans le traitement du paludisme
Place des tests de diagnostic rapide dans le traitement du paludismePlace des tests de diagnostic rapide dans le traitement du paludisme
Place des tests de diagnostic rapide dans le traitement du paludisme
Institut Pasteur de Madagascar
 
Prévention du cancer du col de l’utérus
Prévention du cancer du col de l’utérusPrévention du cancer du col de l’utérus
Prévention du cancer du col de l’utérus
harlicot
 
Chirurgie guidée par la fluorescence - N. Golse
Chirurgie guidée par la fluorescence - N. GolseChirurgie guidée par la fluorescence - N. Golse
Chirurgie guidée par la fluorescence - N. Golse
Centre Hepato-Biliaire / AP-HP Hopital Paul Brousse
 
Radiothérapie Amiens - Actualités 2017 en pathologie ORL
Radiothérapie Amiens - Actualités 2017 en pathologie ORLRadiothérapie Amiens - Actualités 2017 en pathologie ORL
Radiothérapie Amiens - Actualités 2017 en pathologie ORL
coutte
 
78517_633524719761562500
78517_63352471976156250078517_633524719761562500
78517_633524719761562500
Jerry Ch
 
Diversité, multiplicité des infections et résistance aux antipaludiques de P....
Diversité, multiplicité des infections et résistance aux antipaludiques de P....Diversité, multiplicité des infections et résistance aux antipaludiques de P....
Diversité, multiplicité des infections et résistance aux antipaludiques de P....
Institut Pasteur de Madagascar
 
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
Centre Hepato-Biliaire / AP-HP Hopital Paul Brousse
 
cti3-Ploy
cti3-Ploycti3-Ploy
cti3-Ploy
kumanai
 
Les explorations en odonto-stomatologie dr sal (2).pptx
Les explorations en odonto-stomatologie  dr sal (2).pptxLes explorations en odonto-stomatologie  dr sal (2).pptx
Les explorations en odonto-stomatologie dr sal (2).pptx
ssusere3e6a5
 

Similaire à Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au service des patients (20)

Anticorps thérapeutiques
Anticorps thérapeutiquesAnticorps thérapeutiques
Anticorps thérapeutiques
 
AVORTEMENTS des PETITS RUMINANTS : une nouvelle PCR digitale multiplex pour...
AVORTEMENTS des PETITS RUMINANTS :  une nouvelle PCR digitale multiplex  pour...AVORTEMENTS des PETITS RUMINANTS :  une nouvelle PCR digitale multiplex  pour...
AVORTEMENTS des PETITS RUMINANTS : une nouvelle PCR digitale multiplex pour...
 
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
CANCER PRIMITIF DU FOIE (CHC). Après les recommandations 2019 du TNCD.
 
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
Controverse - Trauma Crânien Léger avec ou sans S100B ? COMUN 2019
 
Canceropole1109strasbourg
Canceropole1109strasbourgCanceropole1109strasbourg
Canceropole1109strasbourg
 
La leptospirose
La leptospirose La leptospirose
La leptospirose
 
Bases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditairesBases moléculaires des pathologies mitochondriales héréditaires
Bases moléculaires des pathologies mitochondriales héréditaires
 
Introduction la science Genomique, slides
Introduction la science Genomique, slidesIntroduction la science Genomique, slides
Introduction la science Genomique, slides
 
melanome
melanomemelanome
melanome
 
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
 
Place des tests de diagnostic rapide dans le traitement du paludisme
Place des tests de diagnostic rapide dans le traitement du paludismePlace des tests de diagnostic rapide dans le traitement du paludisme
Place des tests de diagnostic rapide dans le traitement du paludisme
 
Prévention du cancer du col de l’utérus
Prévention du cancer du col de l’utérusPrévention du cancer du col de l’utérus
Prévention du cancer du col de l’utérus
 
Chirurgie guidée par la fluorescence - N. Golse
Chirurgie guidée par la fluorescence - N. GolseChirurgie guidée par la fluorescence - N. Golse
Chirurgie guidée par la fluorescence - N. Golse
 
Radiothérapie Amiens - Actualités 2017 en pathologie ORL
Radiothérapie Amiens - Actualités 2017 en pathologie ORLRadiothérapie Amiens - Actualités 2017 en pathologie ORL
Radiothérapie Amiens - Actualités 2017 en pathologie ORL
 
IPREM placement poster
IPREM placement posterIPREM placement poster
IPREM placement poster
 
78517_633524719761562500
78517_63352471976156250078517_633524719761562500
78517_633524719761562500
 
Diversité, multiplicité des infections et résistance aux antipaludiques de P....
Diversité, multiplicité des infections et résistance aux antipaludiques de P....Diversité, multiplicité des infections et résistance aux antipaludiques de P....
Diversité, multiplicité des infections et résistance aux antipaludiques de P....
 
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
Les maladies pédiatriques que les hépatologues doivent connaître - Emmanuel G...
 
cti3-Ploy
cti3-Ploycti3-Ploy
cti3-Ploy
 
Les explorations en odonto-stomatologie dr sal (2).pptx
Les explorations en odonto-stomatologie  dr sal (2).pptxLes explorations en odonto-stomatologie  dr sal (2).pptx
Les explorations en odonto-stomatologie dr sal (2).pptx
 

Plus de Pasteur_Tunis

Rapport 2021 Institut Pasteur de Tunis
Rapport 2021 Institut Pasteur de Tunis Rapport 2021 Institut Pasteur de Tunis
Rapport 2021 Institut Pasteur de Tunis
Pasteur_Tunis
 
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
Pasteur_Tunis
 
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
Pasteur_Tunis
 
Les marchés publics à l’ère de la digitalisation
Les marchés publics  à l’ère de la digitalisationLes marchés publics  à l’ère de la digitalisation
Les marchés publics à l’ère de la digitalisation
Pasteur_Tunis
 
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
Pasteur_Tunis
 
Gestion du patrimoine
Gestion du patrimoineGestion du patrimoine
Gestion du patrimoine
Pasteur_Tunis
 
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
Pasteur_Tunis
 
LES PRINCIPES DE PASSATION DES MARCHES PUBLICS
LES PRINCIPES DE PASSATION DES MARCHES PUBLICSLES PRINCIPES DE PASSATION DES MARCHES PUBLICS
LES PRINCIPES DE PASSATION DES MARCHES PUBLICS
Pasteur_Tunis
 
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICSLA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
Pasteur_Tunis
 
Exposé audit interne et controle interne
Exposé audit interne et controle interneExposé audit interne et controle interne
Exposé audit interne et controle interne
Pasteur_Tunis
 
ABUS DE POSITION DOMINANTE: DROIT DE LA CONCURRENCE
ABUS  DE  POSITION DOMINANTE:  DROIT DE LA CONCURRENCE ABUS  DE  POSITION DOMINANTE:  DROIT DE LA CONCURRENCE
ABUS DE POSITION DOMINANTE: DROIT DE LA CONCURRENCE
Pasteur_Tunis
 
Fiscalité Internationale des Marchés Publics en l’absence de convention fiscale
Fiscalité Internationale des Marchés Publics  en l’absence de convention fiscaleFiscalité Internationale des Marchés Publics  en l’absence de convention fiscale
Fiscalité Internationale des Marchés Publics en l’absence de convention fiscale
Pasteur_Tunis
 
Rapport 2020 Institut Pasteur de Tunis
Rapport 2020 Institut Pasteur de TunisRapport 2020 Institut Pasteur de Tunis
Rapport 2020 Institut Pasteur de Tunis
Pasteur_Tunis
 
Rapport de l'Institut Pasteur de Tunis 2019
Rapport de l'Institut Pasteur de Tunis 2019Rapport de l'Institut Pasteur de Tunis 2019
Rapport de l'Institut Pasteur de Tunis 2019
Pasteur_Tunis
 
Rapport d'activité de l'Institut Pasteur de Tunis 2018
Rapport d'activité de l'Institut Pasteur de Tunis 2018Rapport d'activité de l'Institut Pasteur de Tunis 2018
Rapport d'activité de l'Institut Pasteur de Tunis 2018
Pasteur_Tunis
 
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
Pasteur_Tunis
 
La gestion des Immobilisations
La gestion des ImmobilisationsLa gestion des Immobilisations
La gestion des Immobilisations
Pasteur_Tunis
 
PHINDaccess Conference Omics Challenges in Infectious Diseases Research - K...
PHINDaccess  Conference Omics Challenges in  Infectious Diseases Research - K...PHINDaccess  Conference Omics Challenges in  Infectious Diseases Research - K...
PHINDaccess Conference Omics Challenges in Infectious Diseases Research - K...
Pasteur_Tunis
 
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de TunisScience Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
Pasteur_Tunis
 
Rapport d'activité 2017 de l'Institut Pasteur de Tunis
Rapport d'activité 2017 de l'Institut Pasteur de TunisRapport d'activité 2017 de l'Institut Pasteur de Tunis
Rapport d'activité 2017 de l'Institut Pasteur de Tunis
Pasteur_Tunis
 

Plus de Pasteur_Tunis (20)

Rapport 2021 Institut Pasteur de Tunis
Rapport 2021 Institut Pasteur de Tunis Rapport 2021 Institut Pasteur de Tunis
Rapport 2021 Institut Pasteur de Tunis
 
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
Concomitant infection with Mycoplasma pneumoniae and SARS-CoV-2 in Tunisian p...
 
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
In vivo investigation of the genotoxic potential of C17-Sphinganine analog my...
 
Les marchés publics à l’ère de la digitalisation
Les marchés publics  à l’ère de la digitalisationLes marchés publics  à l’ère de la digitalisation
Les marchés publics à l’ère de la digitalisation
 
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
LA RELATION ENTRE LA CULTURE DE LA DISCIPLINE ,LE LAXISME ET LA VALEUR DU TRA...
 
Gestion du patrimoine
Gestion du patrimoineGestion du patrimoine
Gestion du patrimoine
 
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
Le règlement définitif : Une radioscopie du respect du titulaire du marché de...
 
LES PRINCIPES DE PASSATION DES MARCHES PUBLICS
LES PRINCIPES DE PASSATION DES MARCHES PUBLICSLES PRINCIPES DE PASSATION DES MARCHES PUBLICS
LES PRINCIPES DE PASSATION DES MARCHES PUBLICS
 
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICSLA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
LA CONVENTION DE L’ONU SUR LA LUTTE CONTRE LA CORRUPTION ET MARCHES PUBLICS
 
Exposé audit interne et controle interne
Exposé audit interne et controle interneExposé audit interne et controle interne
Exposé audit interne et controle interne
 
ABUS DE POSITION DOMINANTE: DROIT DE LA CONCURRENCE
ABUS  DE  POSITION DOMINANTE:  DROIT DE LA CONCURRENCE ABUS  DE  POSITION DOMINANTE:  DROIT DE LA CONCURRENCE
ABUS DE POSITION DOMINANTE: DROIT DE LA CONCURRENCE
 
Fiscalité Internationale des Marchés Publics en l’absence de convention fiscale
Fiscalité Internationale des Marchés Publics  en l’absence de convention fiscaleFiscalité Internationale des Marchés Publics  en l’absence de convention fiscale
Fiscalité Internationale des Marchés Publics en l’absence de convention fiscale
 
Rapport 2020 Institut Pasteur de Tunis
Rapport 2020 Institut Pasteur de TunisRapport 2020 Institut Pasteur de Tunis
Rapport 2020 Institut Pasteur de Tunis
 
Rapport de l'Institut Pasteur de Tunis 2019
Rapport de l'Institut Pasteur de Tunis 2019Rapport de l'Institut Pasteur de Tunis 2019
Rapport de l'Institut Pasteur de Tunis 2019
 
Rapport d'activité de l'Institut Pasteur de Tunis 2018
Rapport d'activité de l'Institut Pasteur de Tunis 2018Rapport d'activité de l'Institut Pasteur de Tunis 2018
Rapport d'activité de l'Institut Pasteur de Tunis 2018
 
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
Evolution des Exigences pour la Reconnaissance des Compétences LES ENJEUX DE ...
 
La gestion des Immobilisations
La gestion des ImmobilisationsLa gestion des Immobilisations
La gestion des Immobilisations
 
PHINDaccess Conference Omics Challenges in Infectious Diseases Research - K...
PHINDaccess  Conference Omics Challenges in  Infectious Diseases Research - K...PHINDaccess  Conference Omics Challenges in  Infectious Diseases Research - K...
PHINDaccess Conference Omics Challenges in Infectious Diseases Research - K...
 
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de TunisScience Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
Science Ensemble : La boutique des Sciences de l'Institut Pasteur de Tunis
 
Rapport d'activité 2017 de l'Institut Pasteur de Tunis
Rapport d'activité 2017 de l'Institut Pasteur de TunisRapport d'activité 2017 de l'Institut Pasteur de Tunis
Rapport d'activité 2017 de l'Institut Pasteur de Tunis
 

Le séquençage haut débit: NGS, une révolution de la biologie moléculaire au service des patients

  • 1. 1 Le séquençage haut débit: NGS Une révolution de la biologie moléculaire au service des patients MALLEK Ramdane rmallek@lab-cerba.com Biologie Moléculaire et génomique, Laboratoire Cerba, Saint-Ouen l'Aumône, France IPT, Tunis 06 Avril 2019
  • 2. UNE PETITE QUESTION POUR COMMENCER • Quelle est la taille (en bases) du génome ? • Humain : • Bactérie Escherichia coli : • Cytomégalovirus humain : 2
  • 3. UNE PETITE QUESTION POUR COMMENCER • Quelle est la taille (en bases) du génome ? • Humain : 2,99 Milliards • Environ 20.000 gènes (1,2% du génome) de 0,9Kb (SRY) à 2,4Mb (DMD) • Environ 220.000 exons • Bactérie Escherichia coli : 4,64 Millions • Cytomégalovirus humain : 2360 3
  • 4. UN PEU DE TERMINOLOGIE • Séquençage « ancienne génération » ou bas débit = Séquençage type Sanger  méthode de référence Permet de décrypter quelques centaines de pb à la fois • Séquençage de nouvelle génération (Next Generation Sequencing NGS) = Séquençage à très haut débit (High Throughput Sequencing HTS)= Séquençage massif en parrallèle MPS= dénomination unique « post Sanger » Permet de décrypter jusqu’à 6 milliards de pb à la fois 4
  • 5. PROJET GÉNOME HUMAIN : 1990-2003 5 1866 1953 1977 1983 2003 2005 2008 2019: ILLUMINA annonce WGS entre 1000 et 2000 $
  • 7. SÉQUENÇAGE DE TYPE SANGER 7 https://www.youtube.com/watch?v=3M0PyxFPwkQ
  • 8. SÉQUENÇAGE DE TYPE SANGER 8 • Avantages • Relativement peu coûteux (sauf rapporté à la base séquencée) • Equipement « standard » • Analyse des résultats simples (expertise limitée) • Les limites • Connaissance à priori de la cible (ce sont des produits de PCR qui sont séquencés et non pas la séquence originelle) • Faible débit • Analyse séquentielle individuelle • Pas de possibilité de multiplexage • Seuil de sensibilité (détection de variant minoritaire) faible : environ 20%
  • 9. Par run Séquençage SANGER Séquençage NGS Petit débit Séquençage NGS Moyen débit Séquençage NGS Haut débit Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500 Nombre de reads 96 25 millions (single reads 36bp) 400 millions (single reads 75bp) 1.5 milliards (single reads 27bp) Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9) Durée 24H 56H (2*300bp) 29H (2*150bp) 11J (2*100bp) LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT DÉBIT (NGS) A PARTIR DE 2006 X 400.000 X 1.000.000X 50.000
  • 10. Par run Séquençage SANGER Séquençage NGS Petit débit Séquençage NGS Moyen débit Séquençage NGS Haut débit Instrument ABI3130XL Illimuna MiSeq Illimuna NextSeq Illimuna 1500 Nombre de reads 96 25 millions (single reads 36bp) 400 millions (single reads 75bp) 1.5 milliards (single reads 27bp) Capacité 300KB (300 10+3) 15GB (15 10+9) 120GB (120 10+9) 300GB (300 10+9) Durée 24H 56H (2*300bp) 29H (2*150bp) 11J (2*100bp) LA RUPTURE TECHNOLOGIQUE DU SÉQUENÇAGE A HAUT DÉBIT (MPS) AUDI A1 105CH ARIANE 5 21.500CH 10
  • 11. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 11 Pour ADN plusieurs approches possibles selon le besoin - Séquençage de 1 ou plusieurs gènes en même temps (panel) - Séquençage de l’exome ou WES - Séquençage de l’ensemble du génome WGS 1- Définir le besoin 2- Extraction des Acides nucléiques à partir de l’échantillon biologique (ADN ou ARN) Sang Total EDTA Plasma Tumeur FFPE Liquide Amniotique Biopsie liquide
  • 12. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 12 2- Préparation de l’échantillon = Préparation de la Librairie Adaptateur (INDEX)
  • 13. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 13 Flowcell= lame de verre sur laquelle va se fixer la librairie et avoir lieu de séquençage
  • 14. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 14
  • 15. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 15 *La librairie est ensuite amplifiée sur la Flowcell Librairie
  • 16. SÉQUENÇAGE A HAUT DÉBIT : COMMENT ÇA FONCTIONNE ? 16 *Séquençage par synthèse:
  • 17. 17
  • 18. Etudier le génome La bioinformatique Si vous tapiez les lettres du génome humain à raison de 60 mots par minute durant 8 heures par jour, il vous faudrait... 50 ans pour le transcrire. Duffourd Yannis Bioinformaticien – CHU Dijon 18
  • 19. Etudier le génome La bioinformatique La bioinformatique est l’ensemble des méthodes qui convertissent les données biologiques en informations. Approche multidisciplinaire impliquant l’informatique, les mathématiques, des méthodes statistiques, ainsi qu’une profonde compréhension des problématiques biologiques. Au delà de la prouesse technologique le NGS nécessite de disposer de compétences Bioinformatique
  • 20. Etudier le génome La bioinformatique A quoi sert la bioinformatique ? TCGATCTGATGAAA GCATGATCGCATCGCATCACATATCT  Reconstituer ces séquences pour retrouver la séquence totale  Comparer la séquence à la séquence de référence  Identifier les variants  Déterminer leur impact Analyser un génome requiert environ 1 Milliard de séquences de 150 bases Duffourd Yannis Bio-informaticien – CHU Dijon  Mise en place d’un environnement Haute performance (HPC) avec serveurs sur site pour analyse et stockage des données
  • 21. INTÉRÊT, CONSÉQUENCE ET IMPACT DE L’IMPLÉMENTATION DU NGS DANS UN LABORATOIRE 21 Réduction du coût de séquençage (par base*) Augmentation des capacités (par run) Possibilité de séquençage de novo Plus de gènes séquencés par patient Plus de patients séquencés par gène Nouvelles applications Réduction du temps au diagnostic ET/OU
  • 24. GÉNÉTIQUE CONSTITUTIONNELLE 24 Génétique constitutionnelle MPS  Les maladies rares - Une maladie est dite « rare » lorsqu’elle atteint moins de une personne sur 2 000. - Très nombreuses (plus de 8.000 décrites) *En Tunisie, plus de 400 maladies rares et environ 600 000 Tunisiens, soit une personne sur vingt serait atteinte d’une maladie rare, dont 85 % sont d’origine génétique. C’est ce que Sanofi Tunisie et l’Association Tunisienne des Maladies Lysosomales (ATML) ont annoncé lors de la 12ème Journée internationale des maladies rares, le 28 février 2019.
  • 25. 25 Errance diagnostique (8 ans!): Séquençage ciblé des gènes MID1, MED12, UPF3B négatif ! Caryotype avec recherche de microdélétion 22q11.2 négatif WES le 01/03/2017: NM_001101.3(ACTB):c.1043C>T (p.Ser348Leu) hétérozygote de novo ACTB est à l’origine du Syndrome de Baraitser-Winter autosomique dominante Le Syndrome de Baraitser Winter est une maladie très rare, seulement 30 patients rapportés ! Déficience intellectuelle, retard global des acquisitions, retard du langage, retard de motricité, retard de croissance, dysmorphie, suspicion de malformation cardiaque. Maladie rare non reconnue = errance Diagnostique
  • 26. La médecine de précision a pour objectif de proposer au patient un traitement adapté aux caractéristiques génétiques de sa tumeur MEDECINE DE PRECISION 26 Génétique Somatique (onco)
  • 27. 27 Pathologie Biomarqueur Nombre de patients testés Pourcentage de patients présentant une altération moléculaire Thérapies ciblées associées  Cancer du sein Amplification d’HER2 10 832 19,7 % Trastuzumab, Pertuzumab Lapatinib  Cancer de l’estomac Amplification d’HER2 770 23,5 % Trastuzumab  Cancer colorectal Mutations de KRAS 21 923 43,7 % Panitumumab, Cetuximab Mutations de NRAS 17 814 5,2 % Panitumumab, Cetuximab  GIST Mutations de KIT 1 218 65,5 % Imatinib Mutations de PDGFRA 1 083 15,4 % Imatinib  Cancer du poumon Mutations d’EGFR 28 563 13,4 % Gefitinib, Erlotinib Afatinib, Osimeritinib Translocation d’ALK 12 434 3,1 % Crizotinib, Ceritinib Translocation de ROS1 17 680 1,0 % Crizotinib  Mélanome Mutation de BRAF V600 5 583 37,2 % Vemurafenib, Dabrafenib Cobimetinib, Trametinib  Leucémies Détection de BCR-ABL 10 263 16,7 % Imatinib, Dasatinib, Nilotinib, Bosutinib, Ponatinib Mutations d’ABL 1 014 22,4 % Imatinib, Dasatinib, Nilotinib, Bosutinib Ponatinib  Leucémie lymphoïde chronique Mutation de TP53 2 309 1 % Idelalisib  Ovaire Mutation somatique de BRCA 1 608 12,6 % Olaparib LES THERAPIES CIBLEES 27
  • 28. VERS UNE MÉDECINE PERSONNALISÉE 28
  • 29. NGS ET DIAGNOSTIC PRÉNATAL 29 Diagnostic prénatal MPS  Dépistage des trisomies 13, 18 et 21 par analyse de l’ADN fœtal circulant o Implémentation en routine clinique en France : Novembre 2013
  • 30. Prélèvement tissulaire Biopsie liquide Vallée et Denis, Corresp Onco-Ther. 2013 ADN circulant (fragments) Cellules Tumorales Circulantes NGS ET « ADN CIRCULANT » (SUITE)  Concept de biopsie liquide : le patrimoine tumoral dans un tube 30
  • 32. 32 LA SUITE : LES TECHNOLOGIES DE 3ÈME GÉNÉRATION Oxford Nanopores Single Molecule Real Time Sequencing Le passage de la molécule d’ADN à travers le nanopore provoque un différentiel osmotique mesurable et quantifiable en fonction de la base Utilisation d’un nanopore modifié dans une membrane
  • 33. LA NOUVELLE ARME DE LA GÉOLOCALISATION ?
  • 34. LA NOUVELLE ARME DE LA GÉOLOCALISATION ? 34 • Avec 1 connexion internet et utilisation de données publiques , il est capable d’identifier l’identité de personnes qui ont bénéficiés de tests génétiques

Notes de l'éditeur

  1. Caractéristiques génétiques de la tumeur sur le sang (cf DPNi)